Multi-effect gene CsSUS3 for regulating and controlling cucumber traits and application of multi-effect gene CsSUS3
By knocking out the cucumber CsSUS3 gene using CRISPR/Cas9 technology, we achieved a reduction in parthenocarpy, an increase in fruit length, and an increase in the content of photosynthetic pigments in leaves. This solved the problem of synergistic regulation of cucumber yield-related traits and created a new high-yielding, photosynthetically efficient cucumber germplasm.
Patent Information
- Application Number
- CN202610318957.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-05-01
AI Technical Summary
In the existing technology, the synergistic regulatory mechanism of parthenocarpy, fruit morphology and photosynthetic efficiency in cucumber has not been reported, which limits the molecular design optimization of cucumber yield-related traits.
The CRISPR/Cas9 technology was used to knock out the cucumber CsSUS3 gene. By designing sgRNA1 and sgRNA2 to form a dual-target vector, a CRISPR-CsSUS3 gene editing vector was constructed and transformed into cucumber plants to achieve multi-effect regulation of the CsSUS3 gene, regulating parthenocarpy, fruit development and photosynthesis.
It significantly reduces parthenocarpy, increases fruit length, and improves the content of photosynthetic pigments in leaves, creating a new high-yield, photosynthetically efficient cucumber germplasm that provides key gene resources for cucumber variety improvement.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
A pleiotropic gene CsSUS3 that regulates cucumber traits and its application Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a pleiotropic gene CsSUS3 that regulates cucumber traits and its applications. Background Technology
[0002] Cucumber (Cucumis sativus L.) is a widely cultivated and consumed vegetable globally. It is not only refreshing in taste but also rich in nutrients and has multiple uses, playing an important role in diet, health, beauty, and even ecological agriculture. As of 2023, the total planting area of cucumbers reached 2.2 million hectares. Parthenocarpy is a core trait ensuring stable cucumber yields, especially in greenhouse cultivation without pollination. Meanwhile, fruit size (length) and plant photosynthetic efficiency are key factors determining the final yield. Therefore, identifying key genes that can synergistically regulate these complex agronomic traits is of great significance for achieving breakthrough improvements in cucumber yield.
[0003] Currently, no "one cause, multiple effects" mechanism has been reported in cucumbers that simultaneously affects fruit setting, fruit morphogenesis, and source organ function, which limits the synergistic optimization of yield-related traits through molecular design. Summary of the Invention
[0004] Objective of the Invention: To address the shortcomings of existing technologies, this invention provides a multi-functional regulatory gene for cucumber traits, CsSUS3. This gene simultaneously regulates multiple biological functions, including parthenocarpy, fruit elongation, and leaf photosynthetic pigment accumulation. The CsSUS3 gene of this invention can guide the breeding and improvement of high-yield cucumber germplasm resources, providing technical support for achieving breakthrough improvements in cucumber yield.
[0005] This invention also provides the application of the multi-effect gene CsSUS3, which regulates parthenocarpy, fruit development and photosynthesis in cucumber.
[0006] Technical solution: In order to achieve the above objectives, the present invention provides a pleiotropic gene CsSUS3 that regulates cucumber traits. The nucleotide sequence of the gene CsSUS3 is shown in SEQ ID NO.1. The cucumber traits include one or more of parthenocarpy, fruit development, and photosynthesis.
[0007] The primer pair used to amplify the CsSUS3 gene is as follows:
[0008] SUS3-F: 5'- ATGGCAGAACGAGTTCTCAA -3';
[0009] SUS3-R: 5'-TGCAACACATCCTAATCCCTTTG -3'.
[0010] The CDS gene sequence of the CsSUS3 gene is shown in SEQ ID NO.2.
[0011] The primer pair used to amplify the CDS gene of the CsSUS3 gene is as follows:
[0012] SUS3-F-1: 5'-ATGGCAGAACGAGTTCTCAACC -3';
[0013] SUS3-R-1: 5'-CTCATCCACAGCCGGTGGC-3'.
[0014] The gene knockout vector CRISPR-CsSUS3 for the pleiotropic gene CsSUS3 that regulates cucumber traits is described in this invention.
[0015] The gene knockout vector CRISPR-CsSUS3 is constructed by designing the target gene sequences sgRNA1 and sgRNA2 of CsSUS3.
[0016] sgRNA1: 5'-CGATCAGTTCATGATGTTGCAGG-3';
[0017] sgRNA2: 5'-CCCCATCAGCTAGTTTCCTTCGG -3';
[0018] Using pCBC-DT1T2(Cm) as a template, the dual targets were amplified, and the resulting double-stranded sgRNA1 / 2 was ligated into a vector. After transformation, the plasmid was extracted, and the gene knockout vector CRISPR-CsSUS3 was finally obtained.
[0019] The application of the gene CsSUS3, the CDS gene, the gene knockout vector, or a host bacterium containing the above gene or vector in regulating the parthenocarpy rate, fruit length, and leaf photosynthetic characteristics of cucumber.
[0020] Among them, editing the cucumber CsSUS3 gene with CRISPR / Cas9 reduced its parthenocarpy ability, increased fruit length, and increased the content of photosynthetic pigments in the leaves.
[0021] The application of the gene CsSUS3, the CDS gene, the gene knockout vector, or the host bacteria containing the above-mentioned gene or vector in the creation of new cucumber germplasm with high fruit yield and high photosynthetic efficiency.
[0022] This invention utilizes gene editing technology to knock out the CsSUS3 gene. Compared to the wild type, the mutant exhibits a lower parthenocarpy rate, but significantly increased fruit length, deeper leaf color, and higher photosynthetic pigment content. The CsSUS3 gene in this invention possesses a "one-gene-multiple-effects" regulatory function, providing a key target gene and core technological tool for creating new cucumber germplasm with high fruit yield and high photosynthetic efficiency.
[0023] This invention uses the cucumber variety "CCMC" as material and constructs a dual-target CRISPR / Cas9 technology to obtain stable CRISPR-CsSUS3 gene-edited material. The parthenocarpy rate of the CRISPR-CsSUS3 transgenic material and the control material (WT) were statistically analyzed, and phenotypic changes in the plants were observed. The results showed that after knocking out the CsSUS3 gene, the parthenocarpy rate was significantly lower than that of the control, but the fruit length was significantly increased, the leaf color was darker, and the photosynthetic pigment content was improved. Systematic phenotypic analysis of the mutants revealed the pleiotropic nature of this gene.
[0024] The CsSUS3 gene of this invention, as a resource allocation optimization gene, can reveal a new mechanism for cucumber source-sink balance and provide key gene resources for the targeted breeding of high-quality cucumbers.
[0025] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0026] This invention is the first systematic identification of the cucumber CsSUS3 gene as a key gene with "one cause and multiple effects". Knocking out this gene can create a unique new cucumber germplasm with a moderately reduced parthenocarpy rate but significantly increased fruit size and enhanced leaf photosynthetic capacity, providing the possibility of synergistic optimization of multiple yield-related traits through a single target.
[0027] This invention provides new gene resources for improving the parthenocarpy trait of cucumber, which is conducive to promoting the development of new high-yield cucumber varieties and has good prospects for agricultural application. Attached Figure Description
[0028] Figure 1 shows the phenotypes of transgenic cucumber plants after the CsSUS3 gene was knocked out using CRISPR / Cas9 technology. (a) Schematic diagram of the CRISPR / Cas9-CsSUS3 target site and the obtained mutant DNA sequence; (b) Phenotypic observation of gene-edited plants (Cssus3-1, Cssus3-3) and control plants; (c) Results of CsSUS3 gene expression level determination in wild-type CCMC and gene-edited mutant (Cssus3-1, Cssus3-3) fruits;
[0029] Figure 2 shows the leaf and fruit phenotypes of transgenic cucumber plants after the CsSUS3 gene was knocked out using CRISPR / Cas9 technology.
[0030] Figure 3 shows the determination of chlorophyll content and fruit traits in transgenic cucumber plants after the CsSUS3 gene was knocked out using CRISPR / Cas9 technology. Detailed Implementation
[0031] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0032] This invention uses the cultivated cucumber variety "ZK" for related experiments. This variety comes from the germplasm resource bank of the Cucurbit Vegetable Genetics and Breeding and Molecular Science Innovation Team of the College of Horticulture and Landscape Architecture, Yangzhou University, and was provided by Yangzhou University. (Cytokinin and auxin modulate cucumber parthenocarpy fruit development. Scientia)
[0033] Horticulturae, 2021, 282, 110026.).
[0034] The cucumber transformation receptor material, “CCMC”, is a well-known receptor material, provided by Yangzhou University (A CsEIL3-CsARN6.1 module promotes waterlogging-triggered adventitious root formation in cucumber by activating the expression of CsPrx5, The Plant Journal, 2023, 114, 824-835).
[0035] Example 1
[0036] The cloning method for the CsSUS3 gene includes the following steps:
[0037] (1) Cucumber tissue cDNA synthesis: RNA was extracted from cucumber “ZK” fruit tissue and reverse transcribed to obtain first-strand cDNA;
[0038] (2) PCR amplification of the CsSUS3 gene and its CDS sequence:
[0039] Primers were designed (CsSUS3-F: 5'-ATGGCAGAACGAGTTCTCAA-3'; CsSUS3-R: 5'-TGCAACACATCCTAATCCCTTTG-3'), and cucumber tissue DNA was used as a template for PCR amplification. The PCR amplification products were recovered, purified, and sequenced.
[0040] Primers were designed (CsSUS3-F-1: 5'-ATGGCAGAACGAGTTCTCAACC -3'; CsSUS3-R-1: 5'-CTCATCCACAGCCGGTGGC -3'), and cucumber tissue cDNA was used as a template for PCR amplification. The PCR amplification products were recovered, purified, and sequenced.
[0041] The nucleotide sequence encoding the cucumber CsSUS3 gene of this invention is shown in SEQ ID NO.1, and the CDS coding region sequence is shown in SEQ ID NO.2.
[0042] Example 2
[0043] (1) CRISPR / Cas9 vector was constructed using cucumber CsSUS3 gene.
[0044] Construction of CsSUS3 gene knockout vector: Two target gene primer sequences for CsSUS3, sgRNA1 and sgRNA2, were designed. The designed target gene sequences are as follows:
[0045] sgRNA1: 5'-CGATCAGTTCATGATGTTGCAGG-3';
[0046] sgRNA2: 5'-CCCCATCAGCTAGTTTCCTTCGG-3'.
[0047] Using pCBC-DT1T2(Cm) as a template, dual-target products were obtained by PCR amplification using PrimerSTAR high-fidelity enzyme. The reaction volume was 50 μL, containing 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP Mixture, 1 μL each of sgRNA1 and sgRNA2 primers, 32.5 μL of ddH2O, 1 μL of pCBC-DT1T2(Cm) plasmid, and 0.5 μL of PrimerSTAR high-fidelity enzyme. The reaction program was 95℃ for 5 min; 95℃ for 15 sec, 55℃ for 15 sec, 72℃ for 15 sec, 35 cycles; 72℃ for 5 min.
[0048] The amplified dual-target product sgRNA1 / 2 was ligated into the pkSE402 vector. The reaction volume was 15 μL, containing 1.2 μL of pkSE402 vector, 2 μL of dual-target product, 1 μL of Bsal, 1 μL of T4 Liguse, 1.5 μL of 10×NEB T4 Buffer, and 8.3 μL of ddH2O. The reaction program was 37℃ for 5 min; 16℃ for 5 min, 60℃ for 5 min, and 12℃ for incubation. 10 μL of the ligation product was added to 50 μL of competent E. coli cells, mixed thoroughly, and then frozen on ice for 30 min. After heat shock at 42℃ for 30 sec, the mixture was placed on ice for 2 min, and 700 μL of LB liquid medium was added. The mixture was then incubated at 37℃ for 1 h using a shaker. 100 μL of the bacterial cells were spread onto Kan+LB solid medium and incubated at 37℃ for 12–16 h. Single colonies were selected for positive testing and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Correct single clones were selected for propagation. Plasmids were extracted using the FastPure® Plasmid Mini Kit to obtain the gene knockout vector CRISPR-CsSUS3. The plasmid was transformed into Agrobacterium competent cells EHA105. The competent cells were thawed on ice. 50 μL of competent cells and 2 μL of plasmid were mixed and then incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, at 37°C for 5 min, and on ice for 5 min. 700 μL of LB liquid medium was added, mixed, and cultured in a shaker at 28°C for 2-3 h. 100 μL of bacterial cells were spread on Kan+Rif LB solid medium and incubated in a constant temperature incubator at 28°C for 2-3 days. Single clones were selected for testing and preservation to obtain Agrobacterium carrying the CRISPR-CsSUS3 gene for subsequent transgenic applications.
[0049] (2) Obtaining CRISPR-CsSUS3 transgenic plants and positive detection
[0050] Transgenic plants were obtained using Agrobacterium-mediated genetic transformation. The recipient material was "CCMC". The basic method was as follows: "CCMC" seeds were soaked in distilled water in a 55℃ water bath for 30 min, the seed coat was removed, and the seeds were rinsed 3-4 times with sterile water. They were then soaked in 75% alcohol for 30 sec, soaked in 2% sodium hypochlorite solution for 10 min, and rinsed 4-5 times with sterile ddH2O. The seeds were then sown on SGM medium, wrapped in aluminum foil, and placed in a 28℃ incubator for 36 h. Agrobacterium carrying the CRISPR-CsSUS3 gene was cultured in LB solid medium containing Kan and Rif antibiotics for 12 h. The bacterial cells were added to 40 mL of IM liquid medium, mixed well, and the OD was measured. 600 , making OD600 =0.2, placed in a 28℃ constant temperature incubator; remove the buds, cut off 1 / 3 of the seed and divide it in half, soak in IM liquid medium, after the seeds are treated, transfer them together to IM liquid medium containing bacterial solution, sonicate for 20 seconds with a KQ5200DE type CNC ultrasonic cleaner, vacuum penetrate for 90 seconds (twice in total), finally place the explants on IM solid medium with tweezers, wrap with aluminum foil and place in a 25℃ constant temperature incubator for 3 days; transfer the explants to SRM medium and culture in a 26℃ light 16 h / dark 8 h environment for 2-3 weeks; observe under a fluorescence microscope and select explants with green fluorescence, cut off the putative transformant about 1 cm in length, place the remaining part in RM medium to induce rooting, transfer the rooted tissue culture seedlings to the substrate for acclimatization culture, and finally transplant them to the greenhouse for cultivation.
[0051] CRISPR-CsSUS3 transgenic positive plants were screened by PCR, and the gene editing type of the knockout plants was further determined by sequencing.
[0052] Design specific primers near the CsSUS3 target gene sequence to detect gene knockout fragment sequences:
[0053] CRISPR-CsSUS3-F: 5'- CAACCGTATTCATAGCC -3';
[0054] CRISPR-CsSUS3-R: 5'- CTGGTTGGGTTCTGATA -3';
[0055] Using CRISPR-CsSUS3 transgenic plant leaf DNA as a template, PCR amplification and sequencing were performed using PrimerSTAR high-fidelity enzyme to obtain the editing sites. The reaction system was 50 μL, containing 10 μL of 5× PrimeSTAR Buffer, 4 μL of dNTP™ enzyme, 1 μL of CRISPR-CsSUS3-F primer, 1 μL of CRISPR-CsSUS3-R primer, 32.5 μL of ddH2O, 1 μL of DNA template, and 0.5 μL of PrimerSTAR high-fidelity enzyme. The reaction program was 95℃ for 5 min; 95℃ for 15 sec, 55℃ for 15 sec, 72℃ for 15 sec, for 35 cycles; 72℃ for 5 min. The results, as shown in Figure 1(a), revealed two types of editing. Sequencing analysis showed that the transgenic plants Cssus3-1 and Cssus3-3 had deletions of 50 bp and 3 bp, respectively.
[0056] Example 3
[0057] Gene phenotype observation and expression level detection of CRISPR-CsSUS3 transgenic cucumber plants
[0058] (1) Phenotypic observation of CRISPR-CsSUS3 transgenic cucumber plants
[0059] To confirm the ability of the CsSUS3 gene to regulate parthenocarpy in cucumber, female flowers of the control wild-type plant (CCMC) and CRISPR-CsSUS3 transgenic plants (Cssus3-1 and CsSUS3-3) were subjected to a flower-clamping treatment one day before flowering. After one week of continuous flower clamping, the parthenocarpy rate was calculated and the phenotype was observed. As shown in Figures 1(b) and 1(c), the parthenocarpy rates of the CRISPR-CsSUS3 transgenic plants were 20.37% and 14.85%, respectively, which were lower than the 81.25% of the control wild-type plant. The parthenocarpy ability of the two types of transgenic plants was significantly lower than that of the control plant. As shown in Figures 2 and 3, the length of the fruit at market maturity was measured under normal pollination conditions. Compared with WT, the average fruit length of Cssus3-1 and Cssus3-3 increased by 18.5% and 16.2%, respectively (P<0.05). At the same time, the functional leaves of the mutants showed a distinct dark green phenotype. The chlorophyll content of functional leaves was determined using the acetone-ethanol mixture extraction method. The chlorophyll content in leaves of the mutant plants Cssus3-1 and Cssus3-3 was 3.34 mg / g·FW and 2.56 mg / g·FW, respectively, while the chlorophyll content in leaves of the control wild-type plant was 1.75 mg / g·FW. The chlorophyll content in leaves of the mutant plants Cssus3-1 and Cssus3-3 was significantly higher than that in the control wild-type plant.
[0060] (2) Detection of gene expression levels in CRISPR-CsSUS3 transgenic cucumber plants
[0061] Fruits from control plants (WT) and CRISPR-CsSUS3 transgenic plants (Cssus3-1, CsSUS3-3) were subjected to flower-pinching treatment one day before flowering. RNA was extracted from fruits one day after flowering (1d) for reverse transcription and detected by real-time fluorescent PCR.
[0062] Cucumber actin (CsaV3_6G041900) was used as an internal reference gene:
[0063] actin-F: 5'-GCTGGATTCTGGTGATGGTG-3';
[0064] actin-R: 5'-AGCAAGGTCCAAACGGAGAA-3';
[0065] Primer sequences designed for the target gene CsSUS3:
[0066] SUS3-F: 5'- CCTGTGGATTGCCTACCTTT -3';
[0067] SUS3-R: 5'-TGGGTCTTCCTTGCTCTTCT-3'.
[0068] Expression levels of CsSUS3 in control plants and three types of edited transgenic plants. As shown in Figure 1(c), one day after flowering (1d), the expression levels of both types of edited transgenic plants were significantly lower than those in the control plants.
Claims
1. A pleiotropic gene CsSUS3 that regulates cucumber traits, characterized in that, The nucleotide sequence of the gene CsSUS3 is shown in SEQ ID NO.1, and the cucumber traits include one or more of the following: parthenocarpy, fruit development, and photosynthesis.
2. The pleiotropic gene CsSUS3 for regulating cucumber traits according to claim 1, characterized in that, The preferred primer pairs for amplifying the CsSUS3 gene are: SUS3-F: 5'-ATGGCAGAACGAGTTCTCAA-3'; SUS3-R: 5'-TCGACACATCCTAATCCCTTTG-3'.
3. A pleiotropic gene CsSUS3 that regulates cucumber traits, characterized in that, The CDS gene sequence of the gene CsSUS3 is shown in SEQ ID NO.
2.
4. The CDS gene of CsSUS3, a pleiotropic gene regulating cucumber traits according to claim 3, is characterized in that, The preferred primer pairs for amplifying the CDS gene of the CsSUS3 gene are: SUS3-F-1: 5'-ATGGCAGAACGAGTTCTCAACC-3'; SUS3-R-1: 5'-CTCATCCACAGCCGGTGGC-3'.
5. A gene knockout vector CRISPR-CsSUS3 based on the pleiotropic gene CsSUS3 that regulates cucumber traits as described in claim 1.
6. The gene knockout vector CRISPR-CsSUS3 according to claim 5, characterized in that, The gene knockout vector CRISPR-CsSUS3 was constructed by designing the target gene sequences sgRNA1 and sgRNA2 for CsSUS3; sgRNA1: 5'- CGATCAGTTCATGATGTTGCAGG -3'; sgRNA2: 5'- CCCCATCAGCTAGTTTCCTTCGG -3'; using pCBC-DT1T2(Cm) as a template to amplify the dual targets, ligating the resulting double-stranded sgRNA1 / 2 into the vector, transforming, extracting the plasmid, and finally obtaining the gene knockout vector CRISPR-CsSUS3.
7. The application of the gene CsSUS3 of claim 1, the CDS gene of claim 2, or the gene knockout vector of claim 5, or a host bacterium containing the above-mentioned gene or vector, in regulating the parthenocarpy rate, fruit length, and leaf photosynthetic characteristics of cucumber.
8. The application according to claim 7, characterized in that, Editing the cucumber CsSUS3 gene using CRISPR / Cas9 resulted in a decrease in parthenocarpy, an increase in fruit length, and an increase in the content of photosynthetic pigments in the leaves.
9. The application of the gene CsSUS3 of claim 1, the CDS gene of claim 2, or the gene knockout vector of claim 5, or a host bacterium containing the above-mentioned gene or vector, in the creation of new cucumber germplasm with high fruit yield and high photosynthetic efficiency.