Primer probe combination for detecting various bifidobacteria and application thereof

By designing primer-probe combinations for singleton and multiplex PCR and combining them with fluorescent PCR detection methods, the accuracy and efficiency issues of detecting various Bifidobacteria in existing technologies have been resolved. This enables efficient and sensitive identification of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis, making it suitable for quality screening of probiotic products and research on gut microbiota.

CN122081531APending Publication Date: 2026-05-26SCIENCE & TECHNOLOGY RESEARCH CENTER OF CHINA CUSTOMS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610551475.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-24
Publication Date
2026-05-26

Smart Images

  • Figure CN122081531A_ABST
    Figure CN122081531A_ABST
Patent Text Reader

Abstract

The invention discloses a primer probe combination for detecting various bifidobacteria and application of the primer probe combination, and belongs to the field of molecular biological detection. The primer probe combination provided by the invention comprises a primer probe group for detecting bifidobacterium breve, a primer probe group for detecting bifidobacterium bifidum and a primer probe group for detecting bifidobacterium adolescentis. Based on the primer probe combination, the invention respectively develops a single PCR detection method and a triple PCR detection method for detecting the three bifidobacteria. Experimental results show that the detection method provided by the invention can be used for accurately detecting bifidobacterium breve, bifidobacterium bifidum and bifidobacterium adolescentis. According to the invention, a foundation is laid for authenticity identification of products containing bifidobacterium breve, bifidobacterium bifidum and bifidobacterium adolescentis, and a more convenient method is provided for detection of bifidobacterium breve, bifidobacterium bifidum and bifidobacterium adolescentis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection, and in particular to a primer-probe combination for detecting various Bifidobacteria and its application. Background Technology

[0002] Bifidobacterium breve ( Bifidobacterium breve Bifidobacterium bifidum ( B. bifidum ) and Bifidobacterium adolescentis ( B. adolescentis These are three widely used probiotics from the genus *Bifidobacterium*. *Bifidobacterium adolescentis* effectively inhibits the growth and reproduction of harmful bacteria in the gut through competitive inhibition and the production of organic acids, maintaining intestinal microecological balance and thus helping to improve chronic diarrhea, constipation, and gastrointestinal disorders. It can also increase the content and activity of superoxide dismutase in the blood, helping to eliminate free radicals and playing a role in anti-aging and longevity. In addition, it also has the effects of enhancing human immunity, promoting nutrient absorption, and regulating blood lipids. *Bifidobacterium bifidum* has a relieving effect on lactose intolerance and has potential in improving obesity, reducing allergic reactions, and producing beneficial metabolites. *Bifidobacterium breve* can help regulate the immune system, inhibit inflammatory responses, improve intestinal health, promote fat metabolism, and relieve childhood asthma. All three bacteria are listed in the "List of Microbial Strains that Can Be Used in Food".

[0003] Current national standards use modified MRS or TOS media and anaerobic culture to distinguish Bifidobacterium from other genera, thus enabling the counting of Bifidobacterium in products. While specific sugar fermentation experiments can differentiate between Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis, modified MRS or TOS media cannot differentiate species within the Bifidobacterium genus. If multiple Bifidobacterium species are present in the product, and the amounts of different species vary by orders of magnitude, traditional biochemical reactions may result in biased test results because representative monoclonal colonies of all types cannot be picked from the plate. Therefore, this method still cannot meet the need for accurate detection of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis in compound probiotic products. Molecular biology detection techniques have become powerful auxiliary identification methods. Currently, 16S rRNA sequencing, whole-genome sequencing and phylogenetic trees, PCR-RFLP, and PCR-DGGE are commonly used to distinguish different species, but these methods are complex, time-consuming, and costly. Existing PCR detection methods mostly target single bacterial species and are largely based on differentially expressed 16S rRNA gene fragments. This makes it difficult to achieve rapid multiplex detection of *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis*, failing to meet the demands for high-efficiency, high-throughput detection in practical applications. For example, in large-scale probiotic product quality screening or gut microbiota studies, detecting only one species at a time is inefficient and increases detection costs and time. Therefore, developing a primer-probe combination capable of accurately, rapidly, and efficiently detecting *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis*, and supporting both single-species and multiplex detection, is of significant practical importance. Summary of the Invention

[0004] The purpose of this invention is to provide a primer-probe combination for detecting various Bifidobacteria and its application, thereby solving the problems existing in the prior art. This invention provides a primer-probe combination for *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* that can be used for both singleton and multiplex PCR detection. It can be used to accurately detect *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis*, enabling the authentication of products containing these bacteria. This invention provides a more convenient method for detecting *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis*.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides a primer-probe combination for detecting three types of Bifidobacteria, the primer-probe combination including a primer-probe set for detecting Bifidobacterium breve, a primer-probe set for detecting Bifidobacterium difformis, and a primer-probe set for detecting Bifidobacterium adolescentis; The primer-probe set for detecting Bifidobacterium breve consists of an upstream primer with nucleotide sequences as shown in SEQ ID NO.1, a downstream primer with nucleotide sequences as shown in SEQ ID NO.2, and a probe with SEQ ID NO.3. The primer-probe set for detecting Bifidobacterium bifidum consists of an upstream primer with nucleotide sequences as shown in SEQ ID NO.5, a downstream primer with nucleotide sequences as shown in SEQ ID NO.6, and a probe with SEQ ID NO.7. The primer-probe set for detecting Bifidobacterium adolescentis consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.9, a downstream primer as shown in SEQ ID NO.10, and a probe as shown in SEQ ID NO.11.

[0006] The present invention also provides the application of the above-mentioned primer-probe combination in the preparation of a single detection kit for detecting Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis.

[0007] The present invention also provides a single detection kit for detecting Bifidobacterium breve, Bifidobacterium bifidum and Bifidobacterium adolescentis, the single detection kit comprising the above-described primer-probe combination.

[0008] This invention also provides a single-detection method for non-diagnostic Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis, comprising the following steps: Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template with the single detection kit described in claim 3. If the sample to be tested is detected using a primer and probe set of Bifidobacterium breve and an amplification curve is observed, and the Ct value is ≤25, then it is determined that Bifidobacterium breve is present in the sample to be tested; if the sample to be tested is detected using a primer and probe set of Bifidobacterium breve and no amplification curve is observed, or an amplification curve is observed and the Ct value is ≥30, then it is determined that Bifidobacterium breve is not detected in the sample to be tested. If the sample to be tested is detected using a primer and probe set of Bifidobacterium bifidum and an amplification curve is observed, and the Ct value is ≤25, then it is determined that Bifidobacterium bifidum is present in the sample to be tested; if the sample to be tested is detected using a primer and probe set of Bifidobacterium bifidum and no amplification curve is observed, or if an amplification curve is observed and the Ct value is ≥30, then it is determined that Bifidobacterium bifidum is not detected in the sample to be tested. If the sample to be tested is detected using the primer and probe set of Bifidobacterium adolescentis and an amplification curve is observed, and the Ct value is ≤25, then it is determined that Bifidobacterium adolescentis is present in the sample to be tested; if the sample to be tested is detected using the primer and probe set of Bifidobacterium adolescentis and no amplification curve is observed, or an amplification curve is observed and the Ct value is ≥30, then it is determined that Bifidobacterium adolescentis is not detected in the sample to be tested. If the sample to be tested has an amplification curve, but 25 < Ct value < 30, it is determined to be an uncertain sample, and the sample extraction amount needs to be increased for retesting.

[0009] Furthermore, the reaction system for the fluorescent PCR detection is as follows: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL of probe, 1 μL of DNA template, and ddH2O to bring the total to 20 μL. The reaction conditions for the fluorescence PCR detection were: hot start at 95℃ for 10 min; denaturation at 95℃ for 10 s; annealing and extension at 60℃ for 30 s, for a total of 35 cycles.

[0010] The present invention also provides an application of the above-mentioned primer-probe combination in the preparation of a triple detection kit for detecting Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis; The probe for detecting Bifidobacterium breve is equipped with a FAM fluorescent group; the probe for detecting Bifidobacterium difformis is equipped with a VIC fluorescent group; and the probe for detecting Bifidobacterium adolescentis is equipped with a Cy5 fluorescent group.

[0011] The present invention also provides a triple detection kit for detecting Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis, the triple detection kit comprising the above-mentioned primer-probe combination; The probe for detecting Bifidobacterium breve is equipped with a FAM fluorescent group; the probe for detecting Bifidobacterium difformis is equipped with a VIC fluorescent group; and the probe for detecting Bifidobacterium adolescentis is equipped with a Cy5 fluorescent group.

[0012] This invention also provides a triple detection method for Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis for non-diagnostic purposes, comprising the following steps: Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template and the triple detection kit described above. If the sample to be tested has an amplification curve in the FAM detection channel and the Ct value is ≤25, then it is determined that there is Bifidobacterium breve in the sample to be tested. If the sample to be tested has an amplification curve in the VIC detection channel and the Ct value is ≤25, then it is determined that Bifidobacterium bifidum is present in the sample to be tested. If the sample to be tested has an amplification curve in the Cy5 detection channel and the Ct value is ≤25, then it is determined that Bifidobacterium adolescentis is present in the sample to be tested. If the sample to be tested has an amplification curve in the corresponding fluorescence detection channel, but 25 < Ct value < 30, it is determined to be an uncertain sample and the sample extraction amount needs to be increased for retesting.

[0013] Furthermore, the reaction system for the fluorescent PCR detection is as follows: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL each of probes, 1 μL of DNA template, and ddH2O to bring the total to 20 μL. The reaction conditions for the fluorescence PCR detection were: hot start at 95℃ for 10 min; denaturation at 95℃ for 10 s; annealing and extension at 60℃ for 30 s, for a total of 35 cycles.

[0014] The present invention also provides the application of the above-described single detection kit or the above-described triple detection kit in the identification of authenticity of products containing Bifidobacterium breve, Bifidobacterium bifidum and / or Bifidobacterium adolescentis.

[0015] The present invention discloses the following technical effects: This invention involves aligning the complete genome sequences of different strains of *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* from the NCBI genome database to obtain highly conserved common sequences for each species. These common sequences are then BLAST-aligned with genome databases of non-target species to obtain species-specific single-copy sequences with high coverage and conservation. Primers and probes are designed using these species-specific single-copy sequences as target sequences to achieve accurate identification of *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis*.

[0016] The primer-probe combination designed in this invention for *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* can be used for both singleton and tripleton PCR detection, offering high flexibility and allowing for adjustments based on actual needs, thereby reducing detection costs. This primer-probe combination boasts advantages such as high sensitivity, strong specificity, and rapid detection. In singleton detection, the limits of detection for *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* can all reach 0.01 ng / μL; in tripleton detection, the limits of detection for these three bacteria can also reach 0.01 ng / μL. The primer-probe combination and detection method of this invention have extremely high application value in the development of *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* strain resources and in the authentication of products containing these bacteria. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1The figure shows the results of the exclusivity verification of the primer-probe combination for Bifidobacterium breve. Figure 2 Figure showing the results of the exclusivity verification of the Bifidobacterium bifidum primer-probe combination; Figure 3 Figure showing the results of the exclusivity verification of the primer-probe combination for Bifidobacterium adolescentis; Figure 4 The figure shows the results of the inclusion validation of the Bifidobacterium breve primer-probe combination; Figure 5 The figure shows the results of the inclusion validation of the Bifidobacterium bifidum primer-probe combination; Figure 6 Figure showing the inclusion validation results of the Bifidobacterium adolescentis primer-probe combination; Figure 7 The graph shows the sensitivity detection results of the Bifidobacterium breve primer-probe combination. Figure 8 The graph shows the sensitivity detection results of the Bifidobacterium bifidum primer-probe combination. Figure 9 The graph shows the sensitivity detection results of the primer-probe combination for Bifidobacterium adolescentis. Figure 10 The graph shows the amplification efficiency detection results of the Bifidobacterium breve primer-probe combination; Figure 11 Standard curve of primer-probe combination for Bifidobacterium breve; Figure 12 The graph shows the amplification efficiency detection results of the Bifidobacterium bifidum primer-probe combination; Figure 13 Standard curve for primer-probe combination of Bifidobacterium bifidum; Figure 14 The graph shows the amplification efficiency detection results of the primer-probe combination for Bifidobacterium adolescentis. Figure 15 Standard curve for primer-probe combination of Bifidobacterium adolescentis; Figure 16 The graph shows the sensitivity detection results of Bifidobacterium breve in triple PCR detection of Bifidobacterium bifidum, Bifidobacterium difficile, and Bifidobacterium adolescentis. Figure 17 The graph shows the sensitivity detection results of Bifidobacterium bifidum in triple PCR detection of Bifidobacterium breve, Bifidobacterium difficile, and Bifidobacterium adolescentis. Figure 18 The graph shows the sensitivity detection results of Bifidobacterium adolescentis in triple PCR detection of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis. Figure 19 The graph shows the amplification efficiency of Bifidobacterium breve in triple PCR detection of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis. Figure 20Standard curve for triple PCR detection of Bifidobacterium brevis, Bifidobacterium bifidum, and Bifidobacterium adolescentis; Figure 21 The graph shows the amplification efficiency of Bifidobacterium bifidum in triple PCR detection of Bifidobacterium breve, Bifidobacterium difficile, and Bifidobacterium adolescentis. Figure 22 The standard curve for Bifidobacterium bifidum in triple PCR detection of Bifidobacterium breve, Bifidobacterium difidum, and Bifidobacterium adolescentis; Figure 23 The graph shows the amplification efficiency of Bifidobacterium adolescentis in triple PCR detection of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis. Figure 24 The standard curve for triple PCR detection of Bifidobacterium adolescentis (Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis) is shown. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Example 1: Design of Specific Primers and Probes 1. Primer and probe screening methods Based on the verified complete genome sequence of the target bacterial species, specific sequences were screened using multiple bioinformatics tools. First, complete genome sequences of multiple strains of the target bacterial species and reference genome sequences of closely related bacterial species were downloaded from the NCBI database. Then, the complete genomes of multiple strains of the target bacterial species were aligned using Mauve software to extract conserved core blocks. To further screen for specific regions of the target bacterial species, a BLAST+local alignment method was used to align the core blocks with a database constructed from the genomes of non-target bacterial species. Strict filtering thresholds were set during the alignment process, retaining only single-copy fragments not appearing in non-target databases as candidate specific sequences. Finally, statistical analysis and coverage evaluation were performed on the candidate fragments to screen for specific sequences with high coverage. For each target bacterial species, 2-5 high-coverage single-copy specific sequences were selected as target sequences. Primers and probes were designed using Primer Express 3.0 software, and the amplified fragments were re-aligned using BLAST in NCBI to correct for degenerate bases. The specificity and amplification efficiency of the primers and probes were tested using Bifidobacterium and other probiotic standard strains.

[0025] 2. Primer and probe screening results The specific primers and probes (5'-3') for Bifidobacterium breve are as follows: Upstream primer B. Breve-F: TGAYTCRACCGGCCATGAG, SEQ ID NO.1; Downstream primer B. Breve-R: TGCTTATCCATCGTGTCCACTACT, SEQ ID NO.2; Fluorescent probe B. Breve-P: CATCCGCCACGCGCACRGTC, SEQ ID NO.3.

[0026] Because different species of *Bifidobacterium breve* exhibit single-base mutations at certain sites in the amplified fragment, degenerate bases are used at these sites to ensure the inclusiveness of the primers and probes. Taking GenBank: CP006712.1 as an example, the target sequence of the primers and probes for *Bifidobacterium breve* is shown in SEQ ID NO. 4. During detection, the 5' end of the probe for this *Bifidobacterium breve* carries a FAM fluorescent group.

[0027] SEQ ID NO.4:

[0028] The specific primers and probes (5'-3') for Bifidobacterium bifidum are as follows: Upstream primer B. Bifidum-F: CGGWTGCATGGCGATCAT, SEQ ID NO.5; Downstream primer B. Bifidum-R: ACGCGTAGGCACCAAGGA, SEQ ID NO.6; Fluorescent probe B. Bifidum-P: ATCTCATGGTCGTTCCCGCCAATTC, SEQ ID NO.7.

[0029] Because different species of *Bifidobacterium bifidum* exhibit single-base mutations at certain sites in the amplified fragment, degenerate bases are used at these sites to ensure the inclusiveness of the primers and probes. Taking GenBank: AP012323.1 as an example, the target sequence of the primers and probes for *Bifidobacterium bifidum* is shown in SEQ ID NO. 8. During detection, the 5' end of the probe for this *Bifidobacterium bifidum* carries a VIC fluorescent group.

[0030] SEQ ID NO.8:

[0031] The specific primers and probes (5'-3') for Bifidobacterium adolescentis are as follows: Upstream primer B. adolescentis-F: AGCCGGCCGCTTCAG, SEQ ID NO.9; Downstream primer B. adolescentis-R: TCGGCATTGGATAGTTTGGAT, SEQ ID NO.10; Fluorescent probe B. adolescentis-P: TCCAAGCCGGTTGAAACGCAGTC, SEQ ID NO.11.

[0032] Taking GenBank: CP156177.1 as an example, the target sequence of the primers and probes for Bifidobacterium adolescentis is shown in SEQ ID NO. 12. During detection, the 5' end of the probe for Bifidobacterium adolescentis carries a Cy5 fluorescent group.

[0033] SEQ ID NO.12: GCCGCCCGCCTGCTTGCCGGTCGTGAGACGGGCGTGGTCGCGCAAGCCGCCGCACCATCGTCCGGCATGCCGGAAGCTGGGCATGCGGGCGGTGCCGCAGCGTCTGAATCGCAGCGTCCGTCCGG TTCCCGTAGGTACGCCGCGCAATCGGCACGTAGAAGGCATGCCGTGGAACCGTCCGCGGCTCCCACGAATCCGGCCGATGCCGTCGTTTCCGGAGCGGCCTCCGGTATTGGCGGAAGTCCAGCAGG CGATGGGTGGACCTCTGTCGGAAGGCAGCGAGCCGGCCGCTTCAGCCGAGTCCAAGCCGGTTGAAACGCAGTCTGCGCCATCCAAACTATCCAATGCCGAACCATCCGCTCCCACCCAGTCCGTG GCTCAGTCCCGTGCCTCAGCCTGCGGCAACGGACGATCGCACTCCCGGCCAGAAGTGGGACGCGATCGTTGCCGGCCTGCCTGAGGATGTCCGTCGCTACGTGGACCGCGAGAAAGTGCCCCGCGT.

[0034] Example 2 Construction of a singlet fluorescent PCR reaction system DNA was extracted from the samples using a bacterial genomic DNA extraction kit and stored at -20°C for later use.

[0035] Fluorescent PCR reaction system (total volume 20 μL): 10 μL 2×PCR Mix, 1 μL each of forward and reverse primers (10 pmol / μL), 0.5 μL each of probe (10 pmol / μL), 1 μL sample DNA template, and ddH2O to make up the volume.

[0036] Fluorescent PCR reaction conditions: 95℃ hot start for 10 min; 95℃ denaturation for 10 s; 60℃ annealing / extension for 30 s, for a total of 35 cycles.

[0037] Result interpretation: If the sample to be tested shows an amplification curve when detected with a primer probe of a certain Bifidobacterium and the Ct value is ≤25, then the Bifidobacterium species is detected in the sample to be tested; if the sample to be tested does not show an amplification curve when detected with a primer probe of a certain Bifidobacterium and the Ct value is ≥30, then the Bifidobacterium species is not detected in the sample to be tested; if the sample to be tested shows an amplification curve when detected with a primer probe of a certain Bifidobacterium and 25 < Ct < 30, then it is considered an indeterminate sample and requires retesting with an increased sample extraction amount.

[0038] Example 3: Establishment of a single-color fluorescent PCR detection kit This quantitative real-time PCR kit for rapid identification of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis includes: 2×PCR Mix, primers and probes for Bifidobacterium breve (concentration 100 pmol / μL), primers and probes for Bifidobacterium bifidum (concentration 100 pmol / μL), primers and probes for Bifidobacterium adolescentis (concentration 100 pmol / μL), positive control, negative control, instructions, and the kit itself.

[0039] The positive controls mentioned above were mixtures of plasmids containing amplified fragments prepared in equal proportions, with corresponding Ct values ​​ranging from 18 to 21.

[0040] The plasmid for Bifidobacterium breve was obtained by cloning the 66 bp fragment sequence (nucleotides 528-593 of SEQ ID NO.4) corresponding to the artificially synthesized Bifidobacterium breve primers and probes into the pGM-T vector; The plasmid of Bifidobacterium bifidum was obtained by cloning the 65 bp fragment sequence (nucleotides 972-1036 of SEQ ID NO. 8) corresponding to the artificially synthesized Bifidobacterium bifidum primers and probes into the pGM-T vector; The plasmid of Bifidobacterium adolescentis was obtained by cloning the 70 bp fragment sequence (nucleotides 281-350 of SEQ ID NO.12) corresponding to the artificially synthesized Bifidobacterium adolescentis primers and probes into the pGM-T vector.

[0041] The negative control mentioned above is Escherichia coli genomic DNA.

[0042] Example 4: Exclusivity Verification of Single-Fluorescence PCR Detection System To verify the exclusivity of the fluorescent PCR detection system for Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis constructed in this invention, the genomic DNA of the standard strains shown in Table 1 was used as PCR reaction templates to verify the exclusivity of the fluorescent PCR detection system.

[0043] Table 1. Information on standard strains used for exclusion verification. The primers and probes for *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* from the kit in Example 3 were used to detect the 36 strains listed in Table 1. The DNA extraction process, PCR reaction system, and reaction conditions were the same as in Example 2. The results of the exclusion verification for each strain are as follows: Figures 1-3 As shown, where, Figure 1 The results of primer and probe detection for Bifidobacterium breve are shown. The amplification reaction using strain number 1 in Table 1 as a template showed an S-shaped amplification curve. Figure 2 The results of primer and probe detection for Bifidobacterium bifidum are shown. The amplification reaction using strain number 2 in Table 1 as a template showed an S-shaped amplification curve. Figure 3 The detection results for primers and probes for *Bifidobacterium adolescentis* show an S-shaped amplification curve for the amplification reaction using strain number 3 in Table 1 as a template. It is evident that only the target strain exhibits an amplification curve; non-target strains, negative controls, and blank controls (water) show no amplification curve or have a Ct value ≥30. This result indicates that the fluorescent PCR detection system of this invention has excellent exclusivity.

[0044] Example 5: Inclusivity Validation of Single-Fluorescence PCR Detection System To verify the inclusiveness of the fluorescent PCR detection system for Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis constructed in this invention, the genomic DNA of the standard strains and industrial production strains shown in Table 2 were used as PCR reaction templates to verify the inclusiveness of the fluorescent PCR detection system.

[0045] Table 2. Information on standard strains used for inclusion validation and validation results. The strains listed in Table 2 were detected using primers and probes for *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* from the kit in Example 3. The DNA extraction process, PCR reaction system, and reaction conditions were the same as in Example 2. The inclusion verification results for each strain are as follows: Figure 4 , Figure 5 and Figure 6 As shown, where, Figure 4 It is a short-lived Bifidobacterium. Figure 5 It is Bifidobacterium bifidum. Figure 6 The target strain was *Bifidobacterium adolescentis*. All strains of the corresponding target species showed amplification curves, while non-target species, negative controls, and blank controls (water) showed no amplification curves or Ct values ​​≥30. This result indicates that the fluorescent PCR detection system of this invention has excellent compatibility.

[0046] Example 6 Sensitivity Detection of Single-Fluorescence PCR Detection System Genomic DNA was collected from *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis*, and its concentration was determined using Nanodrop. The DNA was then serially diluted 10-fold, with 1.0 × 10⁻⁶ samples taken. 0 -1.0×10 -4 DNA at a concentration of ng / μL was used as a PCR template, and the assay was performed using the kit in Example 3 and the method in Example 2.

[0047] The results are as follows Figure 7 , Figure 8 and Figure 9 As shown in Tables 3, 4 and 5, the minimum detectable concentration of this kit for Bifidobacterium breve, Bifidobacterium bifidum and Bifidobacterium adolescentis is 0.01 ng / μL.

[0048] Table 3. Ct values ​​of Bifidobacterium breve primer-probe combinations Table 4. Ct values ​​of Bifidobacterium bifidum primer-probe combinations Table 5. Ct values ​​of Bifidobacterium adolescentis primer-probe combinations Example 7: Detection of amplification efficiency in a single-color fluorescent PCR detection system Genomic DNA from *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* was collected and serially diluted 10-fold. The PCR reaction system and conditions were the same as in Example 2, with each gradient repeated in triplicate. The detection results are shown below. Figure 10 , Figure 12 and Figure 14 The standard curve constructed based on the average Ct value is as follows: Figure 11 , Figure 13 and Figure 15As shown, the slopes of the standard curves for the three sets of primers and probes used to detect *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* were -3.444, -3.471, and -3.466, respectively, corresponding to amplification efficiencies of 95.1%, 94.1%, and 94.3%. The correlation coefficient R0... 2 All values ​​were greater than 0.99. These results indicate that, combined with the standard curve of the standard products, the kit and method of this invention can achieve the quantitative detection of *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis*.

[0049] Example 8: Detection of real samples Five probiotic solid beverage products purchased from Taobao and JD.com were used as test subjects. Primers and probes for detecting Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis from the kit in Example 3 were used for detection. The DNA extraction process, PCR reaction system, and reaction conditions were the same as in Example 2.

[0050] The results are shown in Table 6. The detection rate of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis in real samples by this kit can reach 100%.

[0051] Table 6. Test results of real samples Example 9: Establishment of a Triple Fluorescent PCR Detection Kit This fluorescent PCR detection kit for rapid identification of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis includes: 2×PCR Mix, primers and probes for Bifidobacterium breve (concentration 100 pmol / μL), primers and probes for Bifidobacterium bifidum (concentration 100 pmol / μL), primers and probes for Bifidobacterium adolescentis (concentration 100 pmol / μL), positive control, negative control, instructions, and the kit itself.

[0052] The probes for *Bifidobacterium breve* have a FAM fluorescent group at their 5' end; the probes for *Bifidobacterium bifidum* have a VIC fluorescent group at their 5' end; and the probes for *Bifidobacterium adolescentis* have a Cy5 fluorescent group at their 5' end. Positive and negative controls are the same as in Example 3.

[0053] Example 10 Construction of a triplet PCR fluorescent PCR reaction system DNA was extracted from the sample using a bacterial genomic DNA extraction kit and stored at -20°C for later use.

[0054] Fluorescent PCR reaction system (total volume 20 μL): 10 μL 2×PCR Mix, 1 μL each of forward and reverse primers (10 pmol / μL), 0.5 μL each of probe (10 pmol / μL), 1 μL sample DNA template, and ddH2O to make up the volume.

[0055] The fluorescent PCR reaction conditions were: 95℃ for 10 min hot start; 95℃ for 10 s denaturation; 60℃ for 30 s annealing / extension, for a total of 35 cycles.

[0056] Result Interpretation: If the sample shows an amplification curve in the FAM detection channel and the Ct value is ≤25, then *Bifidobacterium breve* is detected in the sample; if the sample shows an amplification curve in the VIC detection channel and the Ct value is ≤25, then *Bifidobacterium bifidum* is detected in the sample; if the sample shows an amplification curve in the Cy5 detection channel and the Ct value is ≤25, then *Bifidobacterium adolescentis* is detected in the sample; if the sample shows an amplification curve in the corresponding fluorescence detection channel when detected with a primer probe of a certain Bifidobacterium, but 25 < Ct value < 30, then it is considered an uncertain sample and requires retesting with increased sample extraction.

[0057] Example 11 Sensitivity Validation of Triple Fluorescence PCR Detection System Genomic DNA from *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* was collected and its concentration was determined using Nanodrop to prepare a mixed sample. The template concentration of each of *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* in the mixed sample was 1 ng / μL. The mixed sample was then serially diluted 10-fold, and 1.0 × 10⁻⁶ ng / μL was collected. 0 -1.0×10 -4 DNA at a concentration of ng / μL was used as a PCR template, and the assay was performed using the kit of Example 9 and the method of Example 10.

[0058] The results are shown in Table 7. Figure 16 , Figure 17 and Figure 18 As shown, the minimum detectable concentration of this kit for Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis is 0.01 ng / μL.

[0059] Table 7 Ct values ​​of the triple PCR detection system Example 12 Validation of Amplification Efficiency of Triple Fluorescent PCR Detection System Genomic DNA from *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis* was mixed in equal proportions to prepare a pooled sample, which was then serially diluted 10-fold. The PCR reaction system and conditions were the same as in Example 10, with each gradient repeated in triplicate. The detection results are shown below. Figure 19 , Figure 21 and Figure 23 The standard curve constructed based on the average Ct value is as follows: Figure 20 , Figure 22 and Figure 24 As shown, the slopes of the standard curves for the three primer-probe combinations are -3.333 for *Bifidobacterium breve*, -3.368 for *Bifidobacterium bifidum*, and -3.525 for *Bifidobacterium adolescentis*, corresponding to amplification efficiencies of 99.6%, 98.1%, and 92.2%, respectively. The correlation coefficient R0... 2 All values ​​were greater than 0.99. These results demonstrate that the kit and method of the present invention can achieve quantitative detection of *Bifidobacterium breve*, *Bifidobacterium bifidum*, and *Bifidobacterium adolescentis*.

[0060] Example 13 Detection of real samples Five probiotic solid beverage products purchased from Taobao and JD.com were used as test subjects. Primers and probes for Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis from the kit in Example 9 were used for detection. The DNA extraction process, PCR reaction system, and reaction conditions were the same as in Example 10.

[0061] The results are shown in Table 8. The detection rate of Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis in real samples by this kit can reach 100%.

[0062] Table 8. Test results of real samples The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer-probe combination for detecting three types of Bifidobacteria, characterized in that, The primer-probe combination includes a primer-probe set for detecting Bifidobacterium breve, a primer-probe set for detecting Bifidobacterium bifidum, and a primer-probe set for detecting Bifidobacterium adolescentis. The primer-probe set for detecting Bifidobacterium breve consists of an upstream primer with nucleotide sequences as shown in SEQ ID NO.1, a downstream primer with nucleotide sequences as shown in SEQ ID NO.2, and a probe with SEQ ID NO.

3. The primer-probe set for detecting Bifidobacterium bifidum consists of an upstream primer with nucleotide sequences as shown in SEQ ID NO.5, a downstream primer with nucleotide sequences as shown in SEQ ID NO.6, and a probe with SEQ ID NO.

7. The primer-probe set for detecting Bifidobacterium adolescentis consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.9, a downstream primer as shown in SEQ ID NO.10, and a probe as shown in SEQ ID NO.

11.

2. The application of the primer-probe combination as described in claim 1 in the preparation of a single detection kit for detecting Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis.

3. A single-detection kit for detecting Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis, characterized in that, The single detection kit comprises the primer-probe combination as described in claim 1.

4. A single-detection method for non-diagnostic Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis, characterized in that, Includes the following steps: Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template with the single detection kit described in claim 3. If the sample to be tested is detected using a primer and probe set of Bifidobacterium breve and an amplification curve is observed, and the Ct value is ≤25, then it is determined that Bifidobacterium breve is present in the sample to be tested; if the sample to be tested is detected using a primer and probe set of Bifidobacterium breve and no amplification curve is observed, or an amplification curve is observed and the Ct value is ≥30, then it is determined that Bifidobacterium breve is not detected in the sample to be tested. If the sample to be tested is detected using a primer and probe set of Bifidobacterium bifidum and an amplification curve is observed, and the Ct value is ≤25, then it is determined that Bifidobacterium bifidum is present in the sample to be tested; if the sample to be tested is detected using a primer and probe set of Bifidobacterium bifidum and no amplification curve is observed, or if an amplification curve is observed and the Ct value is ≥30, then it is determined that Bifidobacterium bifidum is not detected in the sample to be tested. If the sample to be tested is detected using the primer and probe set of Bifidobacterium adolescentis and an amplification curve is observed, and the Ct value is ≤25, then it is determined that Bifidobacterium adolescentis is present in the sample to be tested. If the sample to be tested is detected with the primer and probe combination of Bifidobacterium adolescentis and there is no amplification curve, or there is an amplification curve and the Ct value is ≥30, then it is determined that Bifidobacterium adolescentis is not detected in the sample to be tested. If the sample to be tested has an amplification curve, but 25 < Ct value < 30, it is determined to be an uncertain sample, and the sample extraction amount needs to be increased for retesting.

5. The single-detection method as described in claim 4, characterized in that, The reaction system for the fluorescent PCR detection is as follows: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL of probe, 1 μL of DNA template, and ddH2O to bring the total to 20 μL. The reaction conditions for the fluorescence PCR detection were: hot start at 95℃ for 10 min; denaturation at 95℃ for 10 s; annealing and extension at 60℃ for 30 s, for a total of 35 cycles.

6. The application of the primer-probe combination as described in claim 1 in the preparation of a triple detection kit for detecting Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis; in, The probe for detecting Bifidobacterium breve is supplemented with FAM fluorescent group; the probe for detecting Bifidobacterium bifidum is supplemented with VIC fluorescent group; and the probe for detecting Bifidobacterium adolescentis is supplemented with Cy5 fluorescent group.

7. A triple detection kit for detecting Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis, characterized in that, The triple detection kit comprises the primer-probe combination as described in claim 1; The probe for detecting Bifidobacterium breve is equipped with a FAM fluorescent group; the probe for detecting Bifidobacterium difformis is equipped with a VIC fluorescent group; and the probe for detecting Bifidobacterium adolescentis is equipped with a Cy5 fluorescent group.

8. A triple detection method for non-diagnostic Bifidobacterium breve, Bifidobacterium bifidum, and Bifidobacterium adolescentis, characterized in that, Includes the following steps: Genomic DNA was extracted from the sample to be tested, and fluorescent PCR was performed using the genomic DNA as a template with the triple detection kit described in claim 7. If the sample to be tested has an amplification curve in the FAM detection channel and the Ct value is ≤25, then it is determined that there is Bifidobacterium breve in the sample to be tested. If the sample to be tested has an amplification curve in the VIC detection channel and the Ct value is ≤25, then it is determined that Bifidobacterium bifidum is present in the sample to be tested. If the sample to be tested has an amplification curve in the Cy5 detection channel and the Ct value is ≤25, then it is determined that Bifidobacterium adolescentis is present in the sample to be tested. If the sample to be tested has an amplification curve in the corresponding fluorescence detection channel, but 25 < Ct value < 30, it is determined to be an uncertain sample and the sample extraction amount needs to be increased for retesting.

9. The triple detection method as described in claim 8, characterized in that, The reaction system for the fluorescent PCR detection is as follows: 10 μL of 2×PCR Mix, 1 μL each of upstream and downstream primers, 0.5 μL each of probes, 1 μL of DNA template, and ddH2O to bring the total to 20 μL. The reaction conditions for the fluorescence PCR detection were: hot start at 95℃ for 10 min; denaturation at 95℃ for 10 s; annealing and extension at 60℃ for 30 s, for a total of 35 cycles.

10. The application of a single detection kit as described in claim 3 or a triple detection kit as described in claim 7 in the authentication of products containing Bifidobacterium breve, Bifidobacterium bifidum, and / or Bifidobacterium adolescentis.