A DNA sulfur-modified bacillus subtilis and its application in alleviating alcoholic diseases

Drugs or foods prepared by using DNA sulfur-modified Bacillus subtilis E10-1 have solved the treatment problem of alcoholic diseases, achieving the effects of reducing serum indicators, reducing tissue damage, and restoring intestinal flora homeostasis.

CN122256174APending Publication Date: 2026-06-23SHANGHAI JIAOTONG UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610247797.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-02
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Current technologies lack effective drugs or treatments to alleviate alcoholic disorders, and the application of probiotics such as Bacillus subtilis in this field has not been reported.

Method used

A DNA sulfur-modified Bacillus subtilis E10-1 is provided for the preparation of pharmaceuticals, fermented foods or health products. It can restore intestinal flora homeostasis and reduce inflammation and oxidative stress by reducing serum indicators and tissue damage in patients with alcoholic disorders.

Benefits of technology

DNA sulfur-modified Bacillus subtilis E10-1 significantly reduced serum markers in patients with alcoholic disorders, reduced tissue damage, restored intestinal barrier function, increased the richness and diversity of gut microbiota, and alleviated oxidative stress damage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256174A_ABST
    Figure CN122256174A_ABST
Patent Text Reader

Abstract

The application discloses a DNA sulfur-modified bacillus subtilis and application thereof in alleviating alcoholic diseases, and relates to the field of biochemistry.The application provides a DNA sulfur-modified bacillus subtilis, which is named as Bacillus subtilis E10-1 and has a preservation number of CCTCC NO: M20253036.It is verified through animal experiments that the DNA sulfur-modified bacillus subtilis E10-1 is more resistant to alcohol than a strain in which sulfur modification is knocked out, can reduce the levels of indexes such as glutathione pyrotransaminase, glutathione transaminase and urea nitrogen in serum of a host after drinking alcohol, and the level of interferon gamma, can increase the levels of total protein, superoxide dismutase and glutathione peroxidase, can alleviate oxidative stress damage caused by alcohol, can reduce inflammatory reactions of various organ tissues, can maintain normal physiological functions of cells, can repair intestinal barriers, and can maintain intestinal flora homeostasis, so that alcoholic related diseases can be prevented and / or treated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biochemical technology and relates to a DNA sulfur-modified Bacillus subtilis and its application in alleviating alcoholic diseases. Background Technology

[0002] Worldwide, 5.3% of deaths are attributable to alcohol use. The leading causes of alcohol-related deaths are cardiovascular disease and diabetes (33.4%), trauma (17.1%), gastrointestinal disease (16.2%), and cancer (12.5%). High-risk alcohol consumption has pathophysiological consequences on most organ systems, including the liver, heart, muscles, gastrointestinal tract, pancreas, endocrine system, and immune system. Alcohol metabolism increases ROS production, reduces the host's antioxidant capacity, and leads to oxidative stress. To date, no drugs or treatments have been approved for patients with alcohol-related diseases. Therefore, developing drugs or treatments to alleviate alcohol-related diseases is a global challenge, and there is an urgent need for safer and more effective drugs to bring hope to patients with alcohol-related diseases.

[0003] The World Health Organization defines probiotics as "live microorganisms that, when ingested in adequate amounts, provide health benefits to the host." Numerous animal and clinical trials have demonstrated that probiotics can help alleviate alcohol-related health problems by regulating the gut microbiota, promoting the growth of beneficial gut microbes, increasing nutrient digestion and absorption, producing antimicrobial substances, modulating the immune system, restoring intestinal barrier function, stimulating or suppressing immune responses, and preventing pathogens from colonizing the intestinal mucosa, thus maintaining host health. Compared to chemical drugs, probiotics do not have issues such as drug resistance, making them a natural, simple, effective, and side-effect-free alternative.

[0004] Bacillus subtilis is a Gram-positive, aerobic or facultative anaerobic, non-pathogenic bacterium that produces various beneficial enzymes and secretes antimicrobial compounds. Its spore formation provides advantages such as high survival rate during passage in the acidic gastrointestinal tract, easy proliferation, and improved stability during probiotic processing and storage. It is considered a perfect multifunctional probiotic for humans and animals. Animal studies have shown that Bacillus subtilis can also alleviate alcohol-induced liver damage and inhibit acute alcohol-induced intestinal barrier damage.

[0005] DNA sulfur modification is a modification formed by replacing non-bridging oxygen atoms in the sugar-phosphate backbone with sulfur atoms. Its unique structure endows DNA with mild antioxidant properties. It can help bacteria resist attacks from oxygen free radicals such as hydrogen peroxide. Nematodes fed a diet of sulfur-modified bacteria for a long period showed a decrease in reactive oxygen species and an extended lifespan. To date, there are no reports of sulfur-modified Bacillus subtilis being used to alleviate alcohol-related diseases. Summary of the Invention

[0006] The purpose of this invention is to provide a DNA sulfur-modified Bacillus subtilis strain and its application in alleviating alcoholic diseases, in order to overcome the above-mentioned defects in the prior art. This strain can alleviate alcohol-related diseases and has potential application prospects in the field of prevention and treatment of alcoholic diseases.

[0007] The objective of this invention can be achieved through the following methods:

[0008] In a first aspect, the present invention provides a DNA sulfur-modified Bacillus subtilis, wherein the DNA sulfur-modified Bacillus subtilis is Bacillus subtilis E10-1, with accession number CCTCC NO: M20253036, deposited at the China Center for Type Culture Collection, located at Wuhan University, China, and the deposit date is December 29, 2025.

[0009] Secondly, the present invention provides a DNA sulfur-modified Bacillus subtilis, wherein the nucleotide sequence of the 16S rRNA gene of the DNA sulfur-modified Bacillus subtilis is shown in SEQ ID NO:1.

[0010] Thirdly, the present invention provides the application of the DNA sulfur-modified Bacillus subtilis in the preparation of products for the prevention and / or treatment of alcohol-related diseases caused by drinking, the products including pharmaceuticals, fermented foods or health products.

[0011] Fourthly, the present invention provides a pharmaceutical composition whose active ingredient includes the DNA sulfur-modified Bacillus subtilis.

[0012] As one embodiment of the present invention, the pharmaceutical composition prevents and / or treats alcohol-related diseases caused by alcohol consumption at the blood biochemical level through one or more of the following pathways: (1) Reduce serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels in patients with alcoholic disorders; (2) Reduce serum urea nitrogen and creatinine levels in patients with alcoholic disorders; (3) Reduce serum triglyceride and total cholesterol levels in patients with alcoholic disorders; (4) Reduce the levels of malondialdehyde and protein carbonyl groups in the serum of patients with alcoholic disorders; (5) Reduce the level of glutathione S-transferase in the serum of patients with alcoholic disorders; (6) Increase the levels of total protein, superoxide dismutase and glutathione peroxidase in the serum of patients with alcoholic diseases.

[0013] As one embodiment of the present invention, the pharmaceutical composition prevents and / or treats alcohol-related diseases caused by alcohol consumption at the histopathological level through one or more of the following pathways: (1) Reduce the organ coefficients of the heart, liver, spleen, lungs and kidneys in patients with alcoholic disorders; (2) Reduce inflammatory cell infiltration in various tissues of patients with alcoholic disorders; (3) Reduce cardiac vacuolar degeneration and congestion in patients with alcoholic disorders; (4) Reduces hepatic steatosis, cell necrosis and fibroblast proliferation in patients with alcoholic diseases; (5) Reduce the level of interferon-γ in the liver of patients with alcoholic disorders; (6) Reduce splenic cell necrosis in patients with alcoholic disorders; (7) Reduces lung cell proliferation, cell necrosis and vascular congestion in patients with alcoholic disorders; (8) Reduces renal cell degeneration in patients with alcoholic disorders; (9) Restore the intestinal barrier integrity in patients with alcoholic disorders; (10) Reduce intestinal villi loss and congestion in patients with alcoholic disorders.

[0014] As one embodiment of the present invention, the pharmaceutical composition prevents and / or treats alcohol-related diseases caused by alcohol consumption at the gut microbiota level through one or more of the following pathways: (1) Improve the richness and diversity of gut microbiota in patients with alcoholic disorders; (2) Increase the abundance of beneficial bacteria in the gut microbiota of patients with alcoholic disorders; (3) Reduce the abundance of harmful bacteria in the gut microbiota of patients with alcoholic diseases.

[0015] As one embodiment of the present invention, the pharmaceutical composition further includes other drugs that are combined with the DNA sulfur-modified Bacillus subtilis, as well as pharmaceutically acceptable carriers and / or excipients for drug delivery (such as starch, trehalose, skim milk, magnesium stearate, and sodium alginate).

[0016] Furthermore, the other drugs are used in combination with the DNA sulfur-modified Bacillus subtilis without causing the DNA sulfur-modified Bacillus subtilis to become inactive or lose its physicochemical functions. They are not limited to drugs that, when used synergistically, can enhance the ability of the DNA sulfur-modified Bacillus subtilis to alleviate alcohol-related diseases.

[0017] Furthermore, the other drugs include one or more of silymarin, glycyrrhizic acid, polyene phosphatidylcholine, glutathione, B vitamins, and prebiotics.

[0018] As one embodiment of the present invention, the pharmaceutical composition is a pharmaceutically acceptable dosage form, including one of powder, tablet, injection, capsule, oral liquid, and bacterial agent.

[0019] Fifthly, the present invention provides the use of the pharmaceutical composition thereof in the preparation of a medicament for reducing the levels of serum alanine aminotransferase, aspartate aminotransferase, blood urea nitrogen, creatinine, triglycerides, total cholesterol, malondialdehyde, protein carbonyl or glutathione S-transferase in patients, and / or increasing the levels of serum total protein, superoxide dismutase or glutathione peroxidase.

[0020] Sixthly, the present invention provides the use of the pharmaceutical composition in the preparation of a medicament for reducing organ coefficients of the heart, liver, spleen, lungs and kidneys, inflammatory cell infiltration in various tissues, cardiac vacuolar degeneration and congestion, hepatic steatosis, cell necrosis and fibroblast proliferation, interferon-γ levels in the liver, splenic cell necrosis, lung cell proliferation, cell necrosis, vascular congestion, renal cell degeneration or intestinal villus shedding and congestion, and / or restoring the integrity of the intestinal barrier.

[0021] In a seventh aspect, the present invention provides the use of the pharmaceutical composition thereof in the preparation of a medicament that improves the richness and diversity of a patient's gut microbiota, and / or increases the abundance of beneficial bacteria in a patient's gut microbiota, and / or decreases the abundance of harmful bacteria in a patient's gut microbiota.

[0022] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention isolates and screens a sulfur-modified Bacillus subtilis strain E10-1 from fermented soybeans, a traditional Chinese food. This strain is safe and non-toxic, and has been verified for the first time to alleviate alcohol-induced diseases. It can be used in pharmaceuticals, food, or health products. It is a new strain with potential applications in the prevention and / or treatment of alcohol-related diseases.

[0023] 2. In a chronic alcohol exposure weaned piglet model, strain E10-1 showed greater alcohol tolerance compared to its sulfur-knockout variant. At the blood biochemical level, it reduced serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), creatinine, triglycerides, cholesterol, malondialdehyde (MDA), protein carbonyl groups, and glutathione S-transferase (GSLT) after alcohol consumption; it increased total protein, superoxide dismutase (SOD), and glutathione peroxidase (GSLP) levels, alleviating alcohol-induced oxidative stress damage. At the histopathological level, it reduced organ coefficients in the heart, liver, spleen, lungs, and kidneys, as well as interferon-γ levels in the liver, decreasing inflammatory infiltration, cell degeneration and necrosis, and vascular congestion in the heart, liver, spleen, lungs, kidneys, and intestines, and reducing lipid accumulation in the liver. At the gut microbiota level, it restored the integrity of the intestinal barrier function, maintained gut microbiota homeostasis, increased the abundance of beneficial bacteria, decreased the abundance of harmful bacteria, and improved the host's immunity. Compared to other conventional strains (such as Bacillus subtilis ZJ4-E4-1 with DNA phosphorus-sulfonation modification), the strain E10-1 screened in this invention not only exhibits superior antioxidant stress resistance but also demonstrates reduced inflammatory infiltration in various host tissues and increased richness and diversity of gut microbiota at the histopathological and gut microbiota levels, thus proving its ability to prevent and / or treat alcohol-related diseases. Furthermore, sulfur modification can be used to enhance the ethanol tolerance of host bacteria during bioethanol fermentation. Attached Figure Description

[0024] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 The colony morphology and scanning electron microscope image of sulfur-modified Bacillus subtilis E10-1 in Example 1 of this invention; Figure 2 This is a diagram showing the verification and knockout results of the sulfur-modified genes and phenotype of sulfur-modified Bacillus subtilis E10-1 in Example 1 of the present invention. Figure 3 The graph shows the survival rate and growth curve of alcohol tolerance of sulfur-modified Bacillus subtilis E10-1 compared with sulfur-knockout Bacillus subtilis in Example 1 of the present invention. Figure 4 The images show the results of HE and Oil Red O staining of liver tissue from weaned piglets in Example 2 of this invention, including the blank group, alcohol group, sulfur-modified Bacillus subtilis group, alcohol + sulfur-modified Bacillus subtilis group, sulfur-knockout Bacillus subtilis group, and alcohol + sulfur-knockout Bacillus subtilis group. Figure 5The images show the HE results of heart, spleen, lung, kidney and duodenum tissues from weaned piglets in Example 2 of this invention, including the blank group, alcohol group, sulfur-modified Bacillus subtilis group, alcohol + sulfur-modified Bacillus subtilis group, sulfur-knockout Bacillus subtilis group and alcohol + sulfur-knockout Bacillus subtilis group. Figure 6 The diagram shows the Chao1 and Shannon indices, as well as the β diversity results, of the gut microbiota of weaned piglets in Example 2 of this invention, including the blank group, alcohol group, sulfur-modified Bacillus subtilis group, alcohol + sulfur-modified Bacillus subtilis group, sulfur-knockout Bacillus subtilis group, and alcohol + sulfur-knockout Bacillus subtilis group. Detailed Implementation

[0025] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. The following examples are implemented under the premise of the technical solution of the present invention, providing detailed implementation methods and specific operating procedures, which will help those skilled in the art to further understand the present invention. It should be noted that the scope of protection of the present invention is not limited to the following embodiments; any adjustments and improvements made under the concept of the present invention are all within the scope of protection of the present invention.

[0026] The terminology used in this invention is for the purpose of describing particular embodiments only and is not intended to limit the invention. Furthermore, whenever a numerical range is mentioned, the range should be understood to include every intermediate value between its upper and lower limits, as well as any smaller range formed between the stated values ​​or intermediate values. The upper and lower limits of these smaller ranges may independently include or exclude the range.

[0027] Unless otherwise stated, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although only preferred methods and materials are described herein, any alternatives similar to or equivalent to the methods or materials described may be used in carrying out or testing the invention. All references cited in this specification are incorporated herein by reference to disclose and describe the methods and / or materials associated with those references. In the event of any conflict between the content of any incorporated reference and this specification, this specification shall prevail.

[0028] Various modifications and alterations can be made to the specific embodiments of this invention without departing from the spirit or scope of the invention, which will be obvious to those skilled in the art. Based on this specification, other embodiments will also be clear to those skilled in the art. This specification and embodiments should be considered exemplary rather than restrictive.

[0029] In this article, terms such as “include,” “including,” “have,” and “contain” are open-ended expressions, meaning that they include the listed elements but do not exclude other unlisted elements.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples can be purchased from regular biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were calculated as the average value and standard error.

[0031] Nutrient medium (NB): Weigh 10g peptone, 3g beef extract, and 5g sodium chloride, and dilute to 1L with distilled water. After dissolving, adjust the pH to 7.0, and sterilize at 121℃ for 20 minutes before use. When preparing nutrient medium agar plates (NA), add 1.5% agar.

[0032] LB broth medium (LB): Weigh 10g peptone, 10g sodium chloride, and 5g yeast extract, and distill water to a final volume of 1L. After dissolving, adjust the pH to 7.0 and sterilize at 121℃ for 20 minutes. When preparing LB agar plates (LA), add 1.5% agar.

[0033] Thirty healthy 21-day-old three-way crossbred (Duroc × Landrace × Large White) weaned piglets, half male and half female, weighing 6.45±0.17 kg, were taken from the experimental pig farm of Guangxi Nongken Yongxin Livestock Jinguang Co., Ltd., animal license number: Gxu-2025-232.

[0034] After a 3-day dietary adaptation period, administer 1×10 gavage daily. 9 CFU (Chemical Fusarium oxysporum) was used to administer 0.6 mL / kg of alcohol via gavage to piglets in the alcohol-induced modeling group for 5 weeks. The daily feed intake and calorie intake of each group were kept consistent. The rearing environment was maintained at a suitable temperature and with good ventilation. Growth and weight information were observed and recorded weekly. Piglets were then fasted for one day, euthanized after blood collection, and tissue samples were collected.

[0035] Serum biochemical indicators were measured using kits from Nanjing Jiancheng Bioengineering Institute, including total protein quantification reagent (A045-1-1), GPT / ALT kit (C009-2-1), GOT / AST kit (C010-2-1), blood urea nitrogen (BUN) test kit (C013-2-1), creatinine (Cr) assay kit (C011-2-1), total cholesterol (T-CHO) test kit (A111-1-1), triglyceride (TG) test kit (A110-1-1), and malondialdehyde (MDA) assay kit. MDA test kit (A003-1-1), superoxide dismutase (SOD) kit (A001-3-1), protein carbonyl kit (A087-1-2), glutathione S-transferase (GSH-ST) kit (A004-1-1), glutathione peroxidase (GSH-PX) assay kit (A005-1-2); serum and liver IFNγ levels were detected using the porcine interferon-gamma (IFN-γ) ELISA quantitative detection kit (ml038236) from Shanghai Enzyme-Link Biotechnology Co., Ltd.

[0036] Example 1: Isolation and identification of sulfur-modified Bacillus subtilis from fresh fermented soybeans, a traditional fermented food from Zhijin County, Guizhou Province, China. I. Sample Source It originates from fresh fermented soybeans, a traditional fermented food from Guizhou, China.

[0037] II. Isolation of Bacillus from Fermented Food Fresh Soybeans Take 1g of fermented fresh black soybeans, add 9ml of physiological saline, and shake thoroughly on a shaker at 37℃ for 30 minutes. Heat in a water bath at 80℃ for 20 minutes. Dilute the suspension using a gradient method, taking 10g of each solution. -3 10 -4 10 -5 10 -6 Four dilution gradients of 500 μL were spread onto nutrient agar (NB) medium and incubated at 37°C for 24 h under aerobic conditions. After single colonies grew on the plates, possible Bacillus strains were selected based on colony morphology and incubated overnight at 37°C in 96-well plates. A small amount of the bacterial culture was taken for rescreening, and the remaining bacterial culture was mixed with sterile glycerol to a glycerol concentration of 20%. The bacterial culture was then frozen at -80°C.

[0038] III. Screening of Bacillus strains containing DNA phosphorylation modification by real-time quantitative PCR (qPCR) Based on the dndB gene sequence of Bacillus subtilis DKU_NT_03, a search was conducted in the NCBI database. After downloading all the retrieved dndB gene sequences of Bacillus subtilis, multiple sequence alignment was performed. Primers dndB-F (CACGCAGTCAATACTACTTCTTC, SEQ ID NO:2) and dndB-R (AGAGATTCTATAAAGACACCATGACC, SEQ ID NO:3) were designed to select the most conserved region of this gene among all Bacillus subtilis for subsequent specific amplification of the dndB gene and screening for Bacillus subtilis carrying the Dnd gene cluster.

[0039] The bacterial culture of a single colony of Bacillus subtilis used for secondary screening was added to the qPCR system for amplification. The Bacillus subtilis DKU_NT_03dndB gene was used as a positive control template, and water as a negative control template. Samples with CT values ​​between the positive and negative controls were considered to potentially contain the DNA phosphorus thioylation modification gene. After qPCR screening of samples capable of amplifying the dndB gene-specific product, the specificity of the amplified product bands was confirmed by agarose gel electrophoresis. Strains with CT values ​​and product band results meeting the standards were further purified by streaking multiple times on nutrient agar plates to isolate single colonies. Single colonies were then incubated overnight at 37°C in NB medium, and the bacterial cells were collected, added to 20% sterile glycerol, and stored at -80°C.

[0040] IV. Colony Identification The E10-1 strain initially exhibited pale yellow, translucent, round colonies with a moist, viscous surface, neat edges, and slightly raised margins. Later in the culture, the surface dried and wrinkled, with a central depression and slightly whitish, curled edges. The color of the culture medium remained consistent throughout. Electron microscopy revealed that the bacteria were rod-shaped. Figure 1 As shown.

[0041] The 16S rRNA of strain E10-1 was cloned and sequenced using universal primers 27F (AGAGTTTGATCCTGGCTCA, SEQ ID NO:4) and 1492R (GGTTACCTTGTTACGACTT, SEQ ID NO:5). The nucleotide sequence of its 16S rRNA gene is shown in SEQ ID NO:1.

[0042] The 16S rRNA gene sequence of the strain was obtained and searched in GenBank using BLAST. The 16S rRNA sequence of the strain of this invention showed a 99% similarity to the NCBI Bacillus subtilis sequence.

[0043] Physiological and biochemical experiments were performed according to Bergey's Manual of Bacterial Identification (9th Edition). The results of the physiological and biochemical experiments on E10-1 are shown in Table 1. Based on the 16S rRNA sequence analysis and the results of the physiological and biochemical experiments, E10-1 can be identified as Bacillus subtilis.

[0044] Table 1. Physiological and biochemical experimental results of sulfur-modified Bacillus subtilis E10-1

[0045] Note: "+" in the table indicates a positive result, and "-" indicates a negative result.

[0046] V. Phenotypic Verification and Knockout of DNA Sulfur Modification Genes Using the Bacillus subtilis gene-editing plasmid pJOE8999, the dndC gene in sulfur-modified Bacillus subtilis E10-1 was knocked out using a traditional chemical transformation method, resulting in sulfur-knockout Bacillus subtilis. The knockout DNA was detected by 1% agarose gel electrophoresis. The sulfur-modified DNA phenotype was verified by cleaving the sulfur-modified DNA with iodine in ethanol solution. The reaction system is shown in Table 2. After reacting at 65℃ for 15 min, the DNA was detected by 1% agarose gel electrophoresis. The results are as follows: Figure 2 As shown.

[0047] Table 2. Reaction system for iodine-ethanol solution to cleave sulfur-modified DNA.

[0048] VI. Determination of the alcohol survival rate and growth curve of the strain Sulfate-modified Bacillus subtilis E10-1 and sulfur-knockout Bacillus subtilis were extracted from glycerol tubes and streaked onto LA plates for activation. Single colonies were picked and transferred to 5 mL of LB medium and incubated overnight at 37°C with shaking. The entire bacterial culture was then transferred to 50 mL centrifuge tubes and centrifuged at 4000 rpm for 15 min at room temperature. The old medium was discarded, and the culture was resuspended in fresh LB medium until the bacterial culture reached OD. 600 =0.2. Prepare LB solutions of EtOH at different concentrations. Take 500 μL of the solution into a 2 mL EP tube and add an equal volume of OD. 600 The bacterial culture was diluted to 0.2 mg / L and incubated at 37°C with shaking for 1 hour. It was then diluted to a 1:10 ratio with fresh LB medium. 4 100 μL of bacterial culture was spread onto LA plates and incubated overnight at 37°C. The number of colonies was counted and the survival rate was calculated.

[0049] Repeat the activation process, transferring the entire bacterial culture to a 50 mL centrifuge tube. Centrifuge at 4000 rpm for 15 min at room temperature, discard the old culture medium, and resuspend the culture in fresh LB medium until the OD value is reached. 600 =0.2. The resuspended bacterial culture was incubated at 37°C for 1 hour with shaking until the OD of the bacterial culture reached 0.2.600 =0.8, and simultaneously prepare LB solutions of different concentrations of EtOH. Add 150 μL of the prepared solution to the Bioscreen C° Pro honeycomb plate beforehand, then add an equal volume of OD. 600 For bacterial culture with a concentration of 0.8, the fully automated growth curve analyzer was programmed to incubate at 37°C with shaking, and OD values ​​were measured every 10 minutes. 600 The values ​​were continuously monitored for 24 hours, and the results were as follows: Figure 3 As shown, sulfur-modified Bacillus subtilis E10-1 exhibits superior alcohol tolerance and growth compared to sulfur-knockout Bacillus subtilis.

[0050] Example 2: Sulfur-modified Bacillus subtilis alleviates alcohol-induced related diseases I. Preparation of bacterial powder and bacterial solution 150 L of sulfur-modified Bacillus subtilis E10-1, sulfur-knockout Bacillus subtilis, and DNA phosphorus-sulfonylated modified Bacillus subtilis ZJ4-E4-1 (CGMCC No. 28472) were cultured in a 300 L fermenter. After washing and concentration to 5 L using a ceramic membrane, the concentrated bacterial solution was freeze-dried into bacterial blocks using a large-scale freeze dryer. The bacterial blocks were then broken into bacterial powder using a mixer, and the concentration of the bacterial powder was measured to be 1×10⁻⁶. 10 CFU / g. 0.15 g of bacterial powder was redissolved in 10 mL of physiological saline, yielding 1.5 × 10⁻⁶ CFU / g. 8 CFU / mL sulfur-modified Bacillus subtilis E10-1 bacterial suspension and DNA phosphorus-sulfonation modified Bacillus subtilis ZJ4-E4-1 bacterial suspension were administered to mice by gavage; 0.1 g of bacterial powder was redissolved in 10 mL of physiological saline to obtain 1×10⁻⁶ CFU / mL of each bacterial suspension. 9 CFU-modified sulfur-modified Bacillus subtilis E10-1 bacterial suspension and sulfur-knockout Bacillus subtilis bacterial suspension were used for gavage administration to weaned piglets.

[0051] II. Grouping Processing Method Forty healthy adult male mice weighing 25–30 g were randomly divided into four groups of ten mice each. All mice in each group were given the same diet. The grouping and treatment were as follows: Control group: Each mouse was simultaneously gavaged with 20 mL / kg BW of physiological saline at the beginning and end of the gavage. After the last gavage, the mouse was fasted for 16 h and then gavaged with 12 mL / kg BW of physiological saline once.

[0052] Alcohol group: Each mouse was simultaneously gavaged with 20 mL / kg BW of physiological saline at the beginning and end of the gavage. After the last gavage, the mouse was fasted for 16 h and then given a single gavage of 12 mL / kg BW of 50% alcohol solution.

[0053] DNA phosphorus-thioylated modified Bacillus subtilis ZJ4-E4-1 group: 1.5 × 10⁻⁶ cells were continuously administered by gavage at a dose of 20 mL / kg·BW per group. 8 Bacillus subtilis ZJ4-E4-1 modified with DNA phosphorus thioylation at CFU / mL was administered via gavage for 16 hours after the last gavage, followed by a single gavage administration of 12 ml / kg·BW of 50% alcohol solution.

[0054] Sulfur-modified Bacillus subtilis E10-1 group: 1.5 × 10⁻⁶ cells were continuously administered by gavage at a dose of 20 mL / kg·BW per group. 8 Sulfur-modified Bacillus subtilis E10-1 (CFU / mL) was administered via gavage after a 16-hour fast, followed by a single gavage administration of 12 ml / kg BW of 50% alcohol solution.

[0055] Thirty healthy 21-day-old crossbred weaned piglets, with a 50 / 50 male and 50 / 50 female, were randomly divided into 6 groups of 5 piglets each. The daily caloric intake of each group of piglets was kept consistent. The grouping and treatment were as follows: Control group: Each weaned piglet was simultaneously administered 10 mL of physiological saline by gavage from the beginning to the end of the experiment, as well as physiological saline (0.6 mL / kg) of the equivalent body weight in alcohol.

[0056] Alcohol group (EtOH): Each weaned piglet was simultaneously administered 10 mL of physiological saline and an equivalent amount of 50% alcohol solution (0.6 mL / kg) by gavage from the beginning to the end of the experiment.

[0057] Sulfur-modified Bacillus subtilis group (C+PT+): Each weaned piglet was given 10 mL of sulfur-modified Bacillus subtilis E10-1 suspension by gavage from the beginning to the end of the experiment, as well as physiological saline (0.6 mL / kg) with an equivalent body weight of alcohol.

[0058] Alcohol + sulfur modified Bacillus subtilis group (E+PT+): Each weaned piglet was given 10 mL of sulfur modified Bacillus subtilis E10-1 bacterial suspension by gavage from the beginning to the end of the experiment, as well as an equivalent amount of 50% alcohol solution (0.6 mL / kg) based on its body weight.

[0059] The group with sulfur-knocked Bacillus subtilis (C+PT-): Each weaned piglet was given 10 mL of sulfur-knocked Bacillus subtilis suspension by gavage from the beginning to the end of the experiment, as well as physiological saline (0.6 mL / kg) with an equivalent amount of body weight in alcohol.

[0060] Alcohol + sulfur-knockout Bacillus subtilis group (E+PT-): Each weaned piglet was given 10 mL of sulfur-knockout Bacillus subtilis suspension by gavage from the beginning to the end of the experiment, along with an equivalent amount of 50% alcohol solution (0.6 mL / kg) based on its body weight.

[0061] III. Serum-related indicator detection Six hours after the end of the alcohol experiment, blood was collected from each group of mice. The blood was centrifuged at 4°C and 3000 r / min for 15 min, and the serum was collected for the detection of superoxide dismutase (SOD) and malondialdehyde (MDA) levels.

[0062] The results of the serum marker tests are shown in Table 3.

[0063] Table 3 Results of blood biochemical markers in mice

[0064] Note: P < 0.001; all differences shown are comparisons with the alcohol group.

[0065] Compared with the ZJ4-E4-1 group, both Bacillus subtilis strains could increase the host's SOD level under alcohol-induced oxidative stress, and the levels were within the same range. However, the E10-1 group was able to reduce the production of the host's oxidative stress byproduct MDA, indicating that strain E10-1 had better antioxidant properties than strain ZJ4-E4-1.

[0066] In the alcohol experiment, weaned piglets were fasted for one day before euthanasia. Blood was collected in the morning, and the resulting blood was centrifuged at 4°C and 3000 rpm for 15 minutes to collect serum. The serum was then analyzed for total protein (TP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), creatinine (Cr), total cholesterol (T-CHO), triglycerides (TG), malondialdehyde (MDA), superoxide dismutase (SOD), protein carbonyl groups, glutathione S-transferase (GSH-ST), and glutathione peroxidase (GSH-PX).

[0067] The test results for all serum markers are shown in Table 4.

[0068] Table 4. Results of blood biochemical indicators in weaned piglets

[0069] Note: P < 0.05; P < 0.01; P < 0.001; all differences shown are comparisons with the alcohol group.

[0070] Compared to the alcohol group (EtOH), weaned piglets in the E+PT+ group, which received sulfur-modified Bacillus subtilis E10-1 via gavage, exhibited better health and showed better results than the E+PT- group, which had sulfur-modified Bacillus subtilis knocked out. Specifically, it reduced alcohol-induced serum levels of ALT, AST, BUN, Cr, T-CHO, TG, MDA, GST, and protein carbonyl groups; alleviated alcohol-induced oxidative stress damage; and increased TP, SOD, and GSH-PX levels. This indicates that sulfur-modified Bacillus subtilis can significantly improve the symptoms of alcohol-related diseases and reduce their incidence.

[0071] IV. Relevant Indicators for Each Organization After the experiment was completed and serum was collected, weaned piglets were euthanized and dissected. Samples were collected from the heart, liver, spleen, lungs, kidneys, and intestines. The organs were weighed and recorded, and the coefficients of each organ were calculated.

[0072] The organ coefficients of weaned piglets are shown in Table 5.

[0073] Table 5. Calculation results of organ coefficients in weaned piglets.

[0074] Note: P < 0.05; P < 0.01; P < 0.001; all differences shown are comparisons with the alcohol group.

[0075] Compared to the alcohol group (EtOH), the E+PT+ group, which received sulfur-modified Bacillus subtilis E10-1 via gavage, reduced the levels of alcohol in weaned piglets to normal levels, and the effect was even better than the E+PT- group, which had sulfur-modified Bacillus subtilis knocked out. These conclusions indicate that sulfur-modified Bacillus subtilis E10-1 can significantly improve damage to various organs and tissues, prevent organ enlargement from affecting host health, and alleviate the response to alcohol-related diseases.

[0076] Based on the above conclusions, we further examined the levels of IFNγ in the liver tissues with the greatest differences, and the results of the ELISA kit are shown in Table 6.

[0077] Table 6. Results of IFNγ level detection in liver tissue

[0078] Note: P < 0.001; all differences shown are comparisons with the alcohol group.

[0079] Compared to the alcohol group (EtOH), the E+PT+ group, which received gavage with sulfur-modified Bacillus subtilis E10-1, significantly reduced IFNγ levels in the livers of weaned piglets, and the effect was even better than the E+PT- group, which had sulfur-modified Bacillus subtilis knocked out. These results indicate that sulfur-modified Bacillus subtilis E10-1 can significantly reduce liver inflammatory damage, thereby inhibiting or slowing the development of alcoholic liver disease.

[0080] V. Observation of organizational morphology Samples of the heart, liver, spleen, lungs, kidneys, and intestines were collected after the experiment. Each tissue sample was sectioned and stained with hematoxylin-eosin (HE). The liver tissue was additionally stained with Oil Red O. The lesions in each tissue were observed under an optical microscope.

[0081] Results of HE and Oil Red O staining of liver tissue from weaned piglets are shown in the figure. Figure 4 In the control group, liver cells showed normal morphology and intact lobular structure, with no hepatocyte degeneration, necrosis, or inflammatory cell infiltration, and no significant lipid deposition. In the alcohol group, liver cells showed degeneration, increased size, and balloon-like fat vacuoles in the cytoplasm, with significant lipid deposition. In the sulfur-modified Bacillus subtilis group (E+PT+), liver cell morphology tended to be normal, and lipid deposition was significantly improved compared to the alcohol group. These HE and Oil Red O staining results suggest that alcohol can cause lipid accumulation in the liver, hepatocyte degeneration, increased size, fat vacuoles in the cytoplasm, and inflammatory cell infiltration, ultimately leading to alcoholic liver disease. Sulfur-modified Bacillus subtilis E10-1 can reduce the formation of fat vacuoles, reduce liver fat deposition, alleviate hepatocyte degeneration, and ultimately slow the progression of alcoholic liver disease.

[0082] HE staining results of other tissues from weaned piglets are shown below. Figure 5 The alcohol group exhibited cardiac vacuolar degeneration and congestion, splenic cell necrosis, lung cell proliferation, cell necrosis and vascular congestion, renal cell degeneration, intestinal barrier damage, villus shedding and congestion. The sulfur-modified Bacillus subtilis group showed a trend towards recovery in all tissues compared to the control group, indicating that sulfur-modified Bacillus subtilis E10-1 can alleviate alcohol-induced organ damage, maintain the integrity of the intestinal barrier, and ultimately alleviate the symptoms of alcohol-related diseases.

[0083] VI. Changes in the gut microbiota Cecal contents collected after the experiment were flash-frozen in liquid nitrogen, and DNA extraction and high-throughput sequencing were performed by Shanghai Ouyi Biomedical Technology Co., Ltd. Intestinal microbial diversity in each group of weaned piglets was assessed using the 16SV3-V4 region of standard bacteria.

[0084] The results of the 16S microbial diversity detection are shown below. Figure 6 Compared with the alcohol group, the sulfur-modified Bacillus subtilis group showed significant differences in the Chao1 and Shannon indices of gut microbial α-diversity and significantly different β-diversity clustering, demonstrating that supplementation with sulfur-modified Bacillus subtilis E10-1 can improve the richness and diversity of the alcohol-induced gut microbial community. Compared with the control group, the alcohol group showed a significant increase in harmful bacteria and a significant decrease in beneficial bacteria in the cecal contents of weaned piglets; compared with the alcohol group, the sulfur-modified Bacillus subtilis group showed a significant decrease in pathogenic bacteria and a significant increase in beneficial bacteria in the cecal contents of weaned piglets, and the expression levels were consistent with those in the blank group.

[0085] The 16S microbial diversity assay results showed that chronic alcohol exposure can upregulate the content of harmful bacteria and downregulate the content of beneficial bacteria in the gut. Sulfur-modified Bacillus subtilis E10-1 can improve the changes in the richness and diversity of the gut microbiota induced by alcohol, restore the upregulation of harmful bacteria and the downregulation of beneficial bacteria caused by alcohol, indicating that sulfur-modified Bacillus subtilis E10-1 may play a role in preventing and / or treating alcohol-related diseases by affecting the gut environment, repairing the intestinal barrier, reducing intestinal damage, reducing the transfer of harmful bacteria through the intestinal mucosa, and triggering inflammatory responses.

[0086] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A DNA sulfur-modified Bacillus subtilis, characterized in that, The DNA sulfur-modified Bacillus subtilis is Bacillus subtilis E10-1, with accession number CCTCC NO: M20253036.

2. A DNA sulfur-modified Bacillus subtilis, characterized in that, The nucleotide sequence of the DNA sulfur-modified 16S rRNA gene of Bacillus subtilis is shown in SEQ ID NO:

1.

3. The use of DNA sulfur-modified Bacillus subtilis as described in claim 1 or 2 in the preparation of products for the prevention and / or treatment of alcohol-related diseases caused by alcohol consumption, characterized in that, The products include pharmaceuticals, fermented foods, or health supplements.

4. A pharmaceutical composition, characterized in that, Its active ingredient includes DNA sulfur-modified Bacillus subtilis as described in claim 1 or 2.

5. The pharmaceutical composition according to claim 4, characterized in that, The pharmaceutical composition also includes other drugs that are combined with the DNA sulfur-modified Bacillus subtilis, as well as pharmaceutically acceptable carriers and / or excipients to aid in drug delivery.

6. The pharmaceutical composition according to claim 5, characterized in that, The other drugs include one or more of silymarin, glycyrrhizic acid, polyene phosphatidylcholine, glutathione, B vitamins, and prebiotics.

7. The pharmaceutical composition according to claim 4, characterized in that, The dosage form of the pharmaceutical composition includes one of the following: powder, tablet, injection, capsule, oral liquid, and bacterial agent.

8. Use of a pharmaceutical composition according to any one of claims 4-7 in the preparation of a medicament for reducing the levels of serum alanine aminotransferase, aspartate aminotransferase, blood urea nitrogen, creatinine, triglycerides, total cholesterol, malondialdehyde, protein carbonyl or glutathione S-transferase in patients, and / or increasing the levels of serum total protein, superoxide dismutase or glutathione peroxidase.

9. Use of a pharmaceutical composition according to any one of claims 4-7 in the preparation of a medicament for reducing organ coefficients, inflammatory cell infiltration, cardiac vacuolar degeneration and congestion, hepatic steatosis, cell necrosis and fibroblast proliferation, interferon-γ levels in the liver, splenic cell necrosis, lung cell proliferation and cell necrosis, vascular congestion, renal cell degeneration or intestinal villus shedding and congestion, and / or restoring intestinal barrier integrity in patients.

10. Use of a pharmaceutical composition according to any one of claims 4-7 in the preparation of a medicament for improving the richness and diversity of a patient's gut microbiota, or increasing the abundance of beneficial bacteria in a patient's gut microbiota, or decreasing the abundance of harmful bacteria in a patient's gut microbiota.