A recombinant yeast strain for efficiently synthesizing astaxanthin, a construction method and application thereof

Abstract

This invention belongs to the field of bioengineering technology, specifically relating to a recombinant yeast strain that utilizes yeast as a host cell and achieves efficient astaxanthin biosynthesis through metabolic engineering. The invention further discloses its construction method and applications. The recombinant yeast strain of this invention is obtained by introducing expression cassettes of geranylgeranyl diphosphate synthase (GGPPS), phytoene synthase / lycopene cyclase (CrtYB), phytoene desaturase (CrtI), 3-hydroxy-3-methylglutaryl-CoA reductase (HMG2), β-carotene ketolase (CrtW), and β-carotene hydroxylase (CrtZ) into *Saccharomyces cerevisiae* and dynamically regulating the expression of the ERG20 gene. The modified recombinant *Saccharomyces cerevisiae* strain of this invention can efficiently synthesize astaxanthin, achieving the efficient synthesis of the natural product astaxanthin in *Saccharomyces cerevisiae*.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a recombinant yeast strain that uses yeast as a host cell and achieves efficient biosynthesis of astaxanthin through metabolic engineering, and further discloses its construction method and application. Background Technology

[0002] Astaxanthin is a red, naturally occurring tetraterpenoid compound with the molecular formula C2. 40 H 52 O4, or oxygen, possesses strong antioxidant capabilities and has broad application prospects in the food, cosmetics, and pharmaceutical industries. In the food sector, astaxanthin can be added to various foods as a natural colorant and antioxidant, improving their nutritional value and shelf life. Furthermore, there is significant demand for astaxanthin among certain population groups, such as vegetarians. However, the current production of food-grade astaxanthin is very limited and its price is high, restricting its application in large-scale food production. In the cosmetics sector, astaxanthin is widely used in various makeup and skincare products, giving them unique color and antioxidant functions. With consumers' increasing preference for natural cosmetics, the demand for astaxanthin in the cosmetics industry will continue to grow. However, currently, cosmetic-grade astaxanthin mainly relies on extraction from shellfish, resulting in insufficient supply and poor sustainability. In the pharmaceutical field, astaxanthin possesses various biological activities, including antioxidant, anti-inflammatory, and anti-tumor effects, demonstrating great potential in treating various diseases. However, due to the shortage of astaxanthin supply and its high cost, its application in the pharmaceutical field remains limited.

[0003] Astaxanthin exists in three main configurations: 3S,3'S, 3R,3'R, and 3R,3'S, with the 3S,3'S configuration exhibiting the strongest antioxidant capacity. Currently, methods for obtaining astaxanthin primarily include natural extraction, chemical synthesis, and heterologous biosynthesis. Furthermore, some microalgae, bacteria, and yeasts also possess the ability to naturally synthesize astaxanthin, allowing for direct extraction. Astaxanthin derived from Haematococcus pluvialis has a 3S,3'S configuration and can be used in high-end fields such as health supplements, food, and cosmetics; however, the high overall extraction cost and strict requirements for the cultivation environment limit the supply of 3S,3'S astaxanthin. Astaxanthin derived from Rhodotorula rubrum has a 3R,3'R configuration and possesses some antioxidant activity, making it suitable as a feed additive.

[0004] Currently, over 95% of astaxanthin on the market is obtained through chemical synthesis. However, chemically synthesized astaxanthin is susceptible to contamination by other harmful substances during the synthesis process, and the products often contain large amounts of cis isomers, affecting their bioavailability and reducing their safety. This significantly limits the application of chemically synthesized astaxanthin in food, pharmaceuticals, and cosmetics. With the rapid development of synthetic biology, heterologous biosynthesis of astaxanthin has become a hot topic. This involves introducing heterologous astaxanthin synthesis pathways into microbial hosts to obtain astaxanthin with high safety and high activity.

[0005] Saccharomyces cerevisiae, as a model strain in this field, has advantages such as short operation cycle, mature gene editing tools, well-defined modification sites, and diverse regulatory methods, and is widely used in microbial metabolic engineering. However, to date, reports on the production of astaxanthin using Saccharomyces cerevisiae have generally shown low yields, which are completely unable to meet industrial-scale demands. Therefore, there is an urgent need in this field to develop new methods to increase the astaxanthin yield in Saccharomyces cerevisiae strains. Summary of the Invention

[0006] Therefore, the technical problem to be solved by the present invention is to provide a recombinant yeast strain that can efficiently synthesize astaxanthin. The strain is constructed by introducing heterologous genes, overexpressing key enzymes, and regulating key metabolic nodes, which can effectively increase astaxanthin yield, help reduce product costs, and lay the foundation for large-scale production of astaxanthin.

[0007] The second technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned recombinant yeast strain for efficient astaxanthin synthesis;

[0008] The third technical problem to be solved by the present invention is to provide a method for efficiently synthesizing astaxanthin, wherein the method is based on the above-constructed recombinant yeast strain for efficient astaxanthin synthesis, and the astaxanthin yield is greatly increased.

[0009] To solve the above-mentioned technical problems, the present invention provides a recombinant yeast strain, wherein the recombinant yeast strain has the following gene recombination characteristics (1)-(2):

[0010] (1) Introduce the genes for phytoene synthase / lycopene cyclase crtYB, phytoene desaturase crtI, β-carotene ketolase crtW and β-carotene hydroxylase crtZ.

[0011] (2) Overexpression of the geraniol geraniol diphosphate synthase PaGGPPS gene and the 3-hydroxy-3-methylglutaryl-CoA reductase HMG2 gene.

[0012] Specifically, in the recombinant yeast strain:

[0013] The crtYB gene is derived from Mucor circinelloides; and / or,

[0014] The crtI gene is derived from Mucor circinelloides; and / or,

[0015] The crtW gene is derived from Rhodococcus erythropolis; and / or,

[0016] The crtZ gene is derived from Saccharolobus solfataricus P2; and / or,

[0017] The PaGGPPS gene is derived from Phomopsysamygdali; and / or,

[0018] The HMG2 gene is derived from yeast itself.

[0019] Specifically, in the recombinant yeast strain:

[0020] The nucleotide sequence of the crtYB gene is shown in SEQ ID No. 1; and / or,

[0021] The nucleotide sequence of the crtI gene is shown in SEQ ID No. 2; and / or,

[0022] The nucleotide sequence of the crtW gene is shown in SEQ ID No. 3; and / or,

[0023] The nucleotide sequence of the crtZ gene is shown in SEQ ID No. 4; and / or,

[0024] The nucleotide sequence of the PaGGPPS gene is shown in SEQ ID No. 5; and / or,

[0025] The nucleotide sequence of the HMG2 gene is shown in SEQ ID No. 6.

[0026] Specifically, the recombinant yeast strain also includes the following gene recombination feature: replacing the ERG20 gene promoter with an inducible promoter.

[0027] Specifically, the recombinant yeast strain includes Saccharomyces cerevisiae;

[0028] Preferably, the brewing yeast includes brewing yeast CEN.PK113-5D.

[0029] The present invention also discloses a method for constructing the recombinant yeast strain, comprising the steps of introducing an expression cassette containing the CrtYB, CrtI, CrtW, CrtZ, PaGGPPS, and HMGR genes into the yeast strain and dynamically regulating the expression of the ERG20 gene.

[0030] Specifically, the method for constructing the recombinant yeast strain is as follows:

[0031] The promoter of the expression cassette includes P of Saccharomyces cerevisiae. PGK1 promoter, P TEF1 promoter, P TDH3 promoters and P TPI1 promoter; and / or,

[0032] The terminator of the expression cassette includes the T of Saccharomyces cerevisiae. CYC1 Termination, T PYK1 Termination, T PRM9 Terminator and T FBA1 Termination of contract.

[0033] Specifically, the method for constructing the recombinant yeast strain further includes the step of increasing the copy number of the crtYB, crtI, crtW, and crtZ genes.

[0034] The present invention also discloses the application of the recombinant yeast strain in the field of astaxanthin biosynthesis.

[0035] The present invention also discloses a method for biosynthesizing astaxanthin, comprising the step of using the recombinant yeast strain as the fermentation strain and carrying out fermentation culture in a suitable fermentation medium.

[0036] Specifically, the method for biosynthesizing astaxanthin:

[0037] In some embodiments, the fermentation medium can be a conventional medium in the art, such as YPD medium known in the art, which includes the following components in mass content: 20 g / L peptone, 10 g / L yeast extract, and 20 g / L glucose.

[0038] In some embodiments, the conditions for the fermentation culture step include: picking a single colony and incubating it overnight in a test tube containing 2 mL of fermentation medium, then transferring it to a 100 mL shake flask containing 20 mL of fermentation broth, and setting the initial OD... 600 Ferment at 0.1, 220 rpm, and 30℃ for 4 days.

[0039] The recombinant yeast strain of this invention was obtained by introducing expression cassettes of geranylgeranyl diphosphate synthase (GGPPS), phytoene synthase / lycopene cyclase (CrtYB), phytoene desaturase (CrtI), 3-hydroxy-3-methylglutaryl-CoA reductase (HMG2), β-carotene ketolase (CrtW), and β-carotene hydroxylase (CrtZ) into *Saccharomyces cerevisiae* and dynamically regulating the expression of the ERG20 gene. The modified recombinant *Saccharomyces cerevisiae* strain of this invention can efficiently synthesize astaxanthin, achieving a shake-flask yield of 180 mg / L, thus realizing the efficient synthesis of the natural product astaxanthin in *Saccharomyces cerevisiae*.

[0040] In the recombinant yeast strain described in this invention, the GGPPS gene was screened from *Phomopsysamygdali*, the CrtYB and CrtI genes were from *Mucor circinelloides*, the HMG2 gene was from *Saccharobus sacchariformis*, the CrtW gene was from *Rhodococcus erythropolis*, and the CrtZ gene was from *Saccharolobus solvatarcis* P2. Among these, the *crtW* gene from *Rhodococcus erythropolis* and the *crtZ* gene from *Saccharolobus solvatarcis* P2 exhibit high catalytic efficiency for β-carotene production. Furthermore, overexpression of HMG2 and PaGGPPS and regulation of ERG20 gene expression significantly increased astaxanthin production, providing a theoretical basis for constructing an efficient *Saccharobus sacchariformis* cell factory for astaxanthin synthesis in industry using synthetic biology techniques.

[0041] The recombinant yeast strain described in this invention was obtained by introducing heterologous genes, overexpressing key enzymes, and regulating key metabolic nodes. When this strain is used in industrial production, it can greatly increase astaxanthin yield and reduce costs. It effectively solves the problems of complex astaxanthin synthesis pathways, complex intermediate metabolites, and low astaxanthin content, laying the foundation for large-scale astaxanthin production. Attached Figure Description

[0042] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0043] Figure 1 This is a schematic diagram of the biosynthesis of astaxanthin according to the present invention;

[0044] Figure 2 The astaxanthin yield of the recombinant yeast strain described in this invention. Detailed Implementation

[0045] Based on the astaxanthin biosynthesis route, this application provides a recombinant yeast strain, which has the following gene recombination characteristics (1)-(2):

[0046] (1) Introduce the genes for phytoene synthase / lycopene cyclase crtYB, phytoene desaturase crtI, β-carotene ketolase crtW and β-carotene hydroxylase crtZ.

[0047] (2) Overexpression of the gerany-gerany diphosphate synthase PaGGPPS gene and the 3-hydroxy-3-methylglutaryl-CoA reductase HMG2 gene;

[0048] Preferably, the gene recombination characteristics of the recombinant yeast strain further include: replacing the ERG20 gene promoter with an inducible promoter.

[0049] In some embodiments, the crtYB gene is derived from Mucor circinelloides; as an exemplary embodiment, the nucleotide sequence of the crtYB gene is shown in SEQ ID No. 1.

[0050] In some embodiments, the crtI gene is derived from Mucor circinelloides; as an exemplary embodiment, the nucleotide sequence of the crtI gene is shown in SEQ ID No. 2.

[0051] In some embodiments, the crtW gene is derived from Rhodococcus erythropolis; as an exemplary embodiment, the nucleotide sequence of the crtW gene is shown in SEQ ID No. 3.

[0052] In some embodiments, the crtZ gene is derived from Saccharolobus sofataricus P2; as an exemplary embodiment, the nucleotide sequence of the crtZ gene is shown in SEQ ID No. 4.

[0053] In some embodiments, the PaGGPPS gene is derived from Phomopsysamygdali; as an exemplary embodiment, the nucleotide sequence of the PaGGPPS gene is shown in SEQ ID No. 5.

[0054] In some embodiments, the HMG2 gene is derived from yeast itself; as an exemplary embodiment, the nucleotide sequence of the HMG2 gene is shown in SEQ ID No. 6.

[0055] As an exemplary preferred embodiment, the recombinant yeast strain provided in this application is obtained by introducing expression cassettes of geranylgeranyl diphosphate synthase (GGPPS), phytoene synthase / lycopene cyclase (CrtYB), phytoene desaturase (CrtI), 3-hydroxy-3-methylglutaryl-CoA reductase (HMG2), β-carotene ketolase (CrtW), and β-carotene hydroxylase (CrtZ) into *Saccharomyces cerevisiae* and dynamically regulating the expression of the ERG20 gene; wherein, the GGPPS gene is derived from *Phomopsysamygdali*, the CrtYB and CrtI genes are derived from *Mucor circinelloides*, the HMG2 gene is derived from *Saccharomyces cerevisiae*, the CrtW gene is derived from *Rhodococcus erythropolis*, and the CrtZ gene is derived from *Saccharolobus solfatarcus* P2.

[0056] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods not specifically described in the following embodiments are performed according to conventional methods and conditions or as specified in the product instructions.

[0057] In the following embodiments of the present invention, the modification of the gene involved is carried out using the CRISPR-Cas9 system, as can be found in the reference (Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. CRISPR / Cas9: a molecular Swissarmy knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Res. 2015 Mar; 15(2): fov004.).

[0058] In the following embodiments of the present invention, as an exemplary implementation, the Saccharomyces cerevisiae CEN.PK113-5D and CRISPR-Cas9 plasmids involved were purchased from Baosai Biotechnology, and the primers were synthesized by Qingke Biotechnology Co., Ltd.

[0059] In the following embodiments of the present invention, as exemplary implementations, the reagents involved are as follows: 2×Phanta FlashMaster Mix (Dye Plus) and 2×Taq Master Mix (Dye Plus) were purchased from Nanjing Vazyme Biotechnology Co., Ltd.; plasmid extraction kit and yeast genomic DNA extraction kit were purchased from omega; astaxanthin standard was purchased from Sigma-Aldrich (USA); and the remaining biochemical reagents were domestically produced analytical grade reagents.

[0060] In the following embodiments of the present invention, the culture medium used in the fermentation culture step of constructing the strain can be any culture medium known in the art. As an exemplary scheme, the following culture media are prepared respectively to verify the effect of the scheme of the present invention.

[0061] LB medium: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, used for screening E. coli transformants. Solid medium is supplemented with 20g / L agar powder, and ampicillin antibiotic is added to a final concentration of 100g / L as required.

[0062] YPD medium: 20 g / L tryptone, 10 g / L yeast extract, 20 g / L glucose, for the culture of Saccharomyces cerevisiae. Solid medium is supplemented with 20 g / L agar powder.

[0063] SD solid medium: 6.7 g / L amino acid-free yeast nitrogen source, 10 g / L glucose, 20 g / L agar powder; if necessary, the URA3 gene is lost, and 5-fluoroorotic acid is added to YNB solid medium at a final concentration of 1 g / L and uracil 0.02 g / L.

[0064] Example 1

[0065] like Figure 1 The process for synthesizing astaxanthin shown in this embodiment is based on the above synthesis process, and the astaxanthin synthesis pathway is constructed and optimized based on the Saccharomyces cerevisiae strain.

[0066] The following enzymes were screened: phytopene synthase / lycopene cyclase CrtYB (SEQ ID No. 1) and phytopene desaturase CrtI (SEQ ID No. 2) from *Mucor circinelloides*, β-carotene ketolase CrtW (SEQ ID No. 3) from *Rhodococcus erythropolis*, and β-carotene hydroxylase CrtZ (SEQ ID No. 4) from *Saccharolobus solfatarcus* P2. After codon optimization, they were ligated into expression cassettes with corresponding promoters and terminators using OE-PCR (as shown in Table 2 below). These cassettes were then integrated into the IX-1 site of *Saccharomyces cerevisiae* CEN.PK113-5D using the CRISPR-Cas9 system (site selection reference: FEMS Microbiology Letters, 2022, 369, 1-5), resulting in the engineered strain AST01.

[0067] The specific steps of this embodiment based on the CRISPR / Cas9 system include: obtaining complete homologous recombination fragments containing upstream and downstream sequences of the integration site and the promoter P through fusion PCR. TEF1 Termination of sub-T CYC1 The Cas9 gene and the selection resistant KanMX gene were synthesized, and 500 ng of the homologous recombination fragment was transformed into the X3 site of the *Saccharomyces cerevisiae* starter strain CENPK113-7D, resulting in the *Saccharomyces cerevisiae* strain 7D-Cas9 carrying the Cas9 protein. Further, an sgRNA expression vector targeting the chromosomal integration site IX-1 was constructed. After screening with LB and ampicillin antibiotics, the corresponding plasmid was extracted. The donor DNA for the IX-1 site, i.e., IX-1::(P...), was obtained by fusion PCR. TEF1 -crtZ-T CYC1 )+(P TDH3 -crtW-T PRM9 )+(P TPI1 -crtYB-T PYK1 )+(P PGK1 -crtI-T FBA1 Subsequently, the sgRNA expression vector and donor DNA (500 ng each) were transformed into Saccharomyces cerevisiae 7D-Cas9 via chemical transformation. The transformed samples were plated on SD solid medium plates and incubated at 30°C for 3 days. After the transformants were cultured on liquid SD medium, the results were verified by colony PCR. The transformed samples were then plated on plates containing 5-fluoroorotic acid to induce plasmid loss. The resulting strains were named engineered strain AST01.

[0068] In the following embodiments of the present invention, other Saccharomyces cerevisiae genome editing processes follow a method similar to that used in the construction of engineered strain AST01.

[0069] Example 2

[0070] Referring to the construction method of engineered strain AST01 in Example 1 above, 3-hydroxy-3-methylglutaryl-CoA reductase HMG2 (SEQ ID No. 6) derived from Saccharomyces cerevisiae and geranyl-geranyl diphosphate synthase GGPPS (SEQ ID No. 5) derived from Phomopsysamygdali were screened. After codon optimization of GGPPS, it was ligated with HMG2 using OE-PCR and corresponding promoters and terminators to form an expression cassette (as shown in Table 2 below), and integrated into the IX-2 site of AST01 to obtain engineered strain AST02.

[0071] Example 3

[0072] Referring to the construction method of engineered bacteria AST01 in Example 1 above, the above-mentioned expression cassettes crtYB (SEQ ID No. 1), crtI (SEQ ID No. 2), crtW (SEQ ID No. 3) and crtZ (SEQ ID No. 4) were further integrated into the VIII-1 site of AST02. The expression cassettes were described in Table 2 below to obtain engineered bacteria AST03.

[0073] Example 4

[0074] Following the construction method of engineered bacteria AST01 in Example 1 above, pgRNA-P targeting the ERG20 promoter was constructed. ERG20 To combine the ERG20 gene with P HXT1 The promoter and upstream and downstream homologous arms were ligated into an expression cassette using OE-PCR. Based on the engineered strain AST03, the ERG20 promoter was replaced with P. HXT1 Promoter, to obtain engineered bacteria AST04.

[0075] In summary, the strain and plasmid information involved in the above embodiments 1-4 of the present invention are detailed in Table 1 below, and the gene modification information involved is detailed in Table 2 below.

[0076] Table 1. Strains and plasmids involved in the experiment.

[0077]

[0078]

[0079] Table 2 shows the genetic modification information involved in the examples.

[0080]

[0081] Example 5

[0082] In this embodiment, fermentation was carried out based on the engineered bacteria constructed in the aforementioned embodiments 1-4, and the astaxanthin yield of the engineered bacteria was detected.

[0083] Single colonies of AST01, AST02, AST03, and AST04 were picked from the preserved YPD solid medium and inoculated into test tubes containing 2 ml of YPD liquid medium. After incubation for 24 h, the colonies were analyzed by OD... 600 The solution was transferred to a shake flask containing 50 mL of YPD liquid medium at a concentration of 0.1 and incubated at 220 rpm and 30 °C for 96 h using standard methods.

[0084] Take 200 μL of fermentation broth, centrifuge at 12000 rpm for 2 min and collect the cells. Then add 500 μL of DMSO to resuspend the cells and place them in a 55℃ water bath for 30 min. Add 500 μL of acetone, vortex for 1 min, place them in a 55℃ water bath for 15 min again, centrifuge at 12000 rpm for 2 min, and filter the supernatant into a chromatographic bottle.

[0085] In this embodiment, the astaxanthin content was detected by HPLC using a Shimadzu LC-20A UV detector at a wavelength of 450 nm. The chromatographic column used was an Agilent ZORBAX SB-C18 column (250 mm × 4.6 mm, 5 μm), with a column temperature of 40 °C. The mobile phase was acetonitrile-methanol-isopropanol (5:3:2 v / v), and the flow rate was 1 mL / min.

[0086] In this embodiment, the astaxanthin (SS configuration) yield in the fermentation products of each engineered strain was detected according to the above method, and the results are shown in the appendix. Figure 2 .

[0087] Among them, the astaxanthin yield of the fermentation product of engineered bacteria AST01 was 22 mg / L; the astaxanthin yield of the fermentation product of engineered bacteria AST02 was 40 mg / L; the astaxanthin yield of the fermentation product of engineered bacteria AST03 was 106 mg / L; and the astaxanthin yield of the fermentation product of engineered bacteria AST04 was 180 mg / L.

[0088] As can be seen, the recombinant yeast strain of the present invention, through the introduction of geranylgeranyl diphosphate synthase GGPPS, phytoene synthase / lycopene cyclase CrtYB, phytoene desaturase CrtI, β-carotene ketolase CrtW, and β-carotene hydroxylase CrtZ, as well as overexpression of 3-hydroxy-3-methylglutaryl-CoA reductase HMGR, increasing the copy number of key genes, and dynamically regulating the expression of farnesyl pyrophosphate synthase ERG20, has enabled the genetically modified Saccharomyces cerevisiae strain to efficiently synthesize astaxanthin, with a shake flask yield of 180 mg / L, thus achieving the efficient synthesis of the natural product astaxanthin in Saccharomyces cerevisiae.

[0089] SEQ ID No.1(CrtYB):

[0090]

[0091] SEQ ID No.2(CrtI):

[0092]

[0093] SEQ ID No.3(CrtW):

[0094]

[0095] SEQ ID No.4(CrtZ):

[0096] ATGATGTTAATTTATTATGTTGGAATGGCTGTATTAACTTTCGTAGGTATGGAATTTGTTGCTAGGCTTATGCATAAATACGTAATGCATGGTTTGTTGTGTTATTCACGAAGACCACCACAAAGAAAAGCAAGCTGAGTTGGAGAAGAACGACCTATTCGGACTGGTTTTCGCTAGTGTCTCAGTATATCTGTTCTTTCTGGGTATCCAGGGTAGCTATGTGGCTTTATCCATAGCTATAGGCATGAGTTCCTATGGCATCGCTTATTTCTTTATACATGACATGGTTATTCACGACAGACACTTACATTTGCGTTCTTGGGGCTTGAAACATCGTCCGTTCAAAGACCTTATCTTAGTTCACGACATCCACCACAAGGAAGGTAAAGGTAATTGGGGATTTTTGTTTGTCATAAAAGGCTTGGATAAGGTTCCCATACTGAAGGATGAATAG。

[0097] SEQ ID No.5(PaGGPPS):

[0098]

[0099] SEQ ID No.6(HMG2):

[0100]

[0101] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A recombinant yeast strain, characterized in that, The recombinant yeast strain has the following gene recombination characteristics (1)-(2): (1) Introduce the genes for phytoene synthase / lycopene cyclase crtYB, phytoene desaturase crtI, β-carotene ketolase crtW and β-carotene hydroxylase crtZ. (2) Overexpression of the geraniol geraniol diphosphate synthase PaGGPPS gene and the 3-hydroxy-3-methylglutaryl-CoA reductase HMG2 gene.

2. The recombinant yeast strain according to claim 1, characterized in that, In the recombinant yeast strain: The crtYB gene is derived from Mucor circinelloides; and / or, The crtI gene is derived from Mucor circinelloides; and / or, The crtW gene is derived from Rhodococcus erythropolis; and / or, The crtZ gene is derived from Saccharolobus solfataricus P2; and / or, The PaGGPPS gene is derived from Phomopsysamygdali; and / or, The HMG2 gene is derived from yeast itself.

3. The recombinant yeast strain according to claim 1 or 2, characterized in that, In the recombinant yeast strain: The nucleotide sequence of the crtYB gene is shown in SEQ ID No. 1; and / or, The nucleotide sequence of the crtI gene is shown in SEQ ID No. 2; and / or, The nucleotide sequence of the crtW gene is shown in SEQ ID No. 3; and / or, The nucleotide sequence of the crtZ gene is shown in SEQ ID No. 4; and / or, The nucleotide sequence of the PaGGPPS gene is shown in SEQ ID No. 5; and / or, The nucleotide sequence of the HMG2 gene is shown in SEQ ID No.

6.

4. The recombinant yeast strain according to any one of claims 1-3, characterized in that, The recombinant yeast strain also includes the following gene recombination feature: the ERG20 gene promoter is replaced with an inducible promoter.

5. The recombinant yeast strain according to any one of claims 1-4, characterized in that, The recombinant yeast strain includes Saccharomyces cerevisiae; Preferably, the brewing yeast includes brewing yeast CEN.PK113-5D.

6. A method for constructing a recombinant yeast strain as described in any one of claims 1-5, characterized in that, The method includes the steps of introducing an expression cassette containing the genes CrtYB, CrtI, CrtW, CrtZ, PaGGPPS, and HMGR into the yeast strain and dynamically regulating the expression of the ERG20 gene.

7. The method for constructing the recombinant yeast strain according to claim 6, characterized in that: The promoter of the expression cassette includes P of Saccharomyces cerevisiae. PGK1 promoter, P TEF1 promoter, P TDH3 promoters and P TPI1 promoter; and / or, The terminator of the expression cassette includes the T of Saccharomyces cerevisiae. CYC1 Termination, T PYK1 Termination, T PRM9 Terminator and T FBA1 Termination of contract.

8. The method for constructing the recombinant yeast strain according to claim 6 or 7, characterized in that, The construction method further includes the step of increasing the copy number of the crtYB, crtI, crtW and crtZ genes.

9. The application of the recombinant yeast strain according to any one of claims 1-5 in the field of astaxanthin biosynthesis.

10. A method for biosynthesizing astaxanthin, characterized in that, The method includes the step of fermenting the recombinant yeast strain described in any one of claims 1-5 in a suitable fermentation medium.

Images