Desulfobulbaceae family cable bacteria strain and application thereof

Abstract

The application belongs to the field of environmental microorganism culture and sludge resource utilization, and relates to a Desulfobulbaceae The application discloses a cable bacteria strain and application thereof, and a 16S rRNA gene sequence of the cable bacteria strain is shown as SEQ ID NO:1. The strain can couple a sulfide oxidation process and an oxygen reduction process in sludge, can adapt to a complex oxidation-reduction environment in the sludge system, can form a stable vertical oxidation-reduction gradient in the sludge system, and can couple a deep sulfide oxidation process and a surface oxygen reduction process through long-distance electron transfer. The strain can promote migration and oxidation conversion of sulfide in the sludge from a deep layer to a surface layer, and can reduce local sulfide accumulation. Meanwhile, the strain can affect spatial distribution of Fe(II) / Fe(III) in the sludge system, and can promote iron oxidation-reduction circulation and a sulfur-iron coupling process.

Description

Technical Field

[0001] This invention belongs to the technical field of environmental microbial culture and sludge resource utilization, and more specifically, relates to a... Desulfobulbaceae Bacterial strains in cable optics and their applications. Background Technology

[0002] Cable bacteria are a type of filamentous microorganism capable of spatially separating oxidation and reduction reactions and achieving electron flow across micrometer to centimeter scales via electron transfer. They mainly belong to the […]. Desulfobulbaceae This family of microorganisms can grow in sediments, sludge, and other environments with significant redox gradients. They oxidize reducing substances such as sulfides at one end and reduce oxygen or other electron acceptors at the other, playing an important role in biogeochemical cycles, sulfur cycle regulation, pollutant transformation, and electron transfer.

[0003] Currently, with the continuous deepening of research on environmental functional microorganisms, cable bacteria have gradually become a research hotspot in the fields of environmental microbiology and environmental engineering due to their unique long-distance electron transfer capabilities and their application potential in sediment remediation, pollutant removal, and electron flow regulation in sludge systems.

[0004] However, most existing research on cable bacteria focuses on their distribution characteristics and electron transfer mechanisms in natural environments such as marine and lake sediments, but it cannot be applied to systems with high organic loads and complex redox conditions, such as sludge. Furthermore, the cable bacteria reported so far do not have stable electron transfer capabilities in sludge systems and cannot complete sulfide migration and transformation, iron redox cycles, and sulfur-iron coupling processes in sludge systems.

[0005] Therefore, there is an urgent need to develop a cable bacteria strain with stable electron transfer capabilities in the complex environment of sludge. Summary of the Invention

[0006] To address the aforementioned deficiencies or improvement needs of existing technologies, this invention provides a... Desulfobulbaceae The purpose of this study is to provide cable bacteria strains with stable electron transfer capabilities in sludge systems.

[0007] According to a first aspect of the present invention, a method is provided Desulfobulbaceae The cable bacteria strain, the 16S rRNA gene sequence of which is shown in SEQ ID NO:1.

[0008] Preferably, the cable bacteria strain has a continuous filamentous structure.

[0009] According to another aspect of the invention, the aforementioned DesulfobulbaceaeSpecific amplification primers for 16S rRNA of *Cyclophorus* strain, wherein the specific amplification primers are degenerate primers.

[0010] Preferably, the forward primer of the degenerate primer is shown in SEQ ID NO:2 and / or SEQ ID NO:3, and the reverse primer is shown in SEQ ID NO:4 and / or SEQ ID NO:5.

[0011] According to another aspect of the invention, the aforementioned Desulfobulbaceae Application of bacterial strains in cable manufacturing in the coupled hydrogen sulfide oxidation and oxygen reduction process in sludge.

[0012] Preferably, the Desulfobulbaceae The bacterial strains of KeCable are used to form a stable vertical redox gradient in the sludge system, improving the electron transfer efficiency and redox stability within the sludge.

[0013] Preferably, the application is specifically as follows: Desulfobulbaceae The bacterial strain of KeCable forms an electron transport pathway through a filamentous structure. It oxidizes hydrogen sulfide and releases electrons in the deep reduction zone of sludge. The electrons are transferred along the hyphae to the surface oxidation zone and coupled with the oxygen reduction process, thus achieving spatial coupling of hydrogen sulfide oxidation and oxygen reduction.

[0014] Preferably, the Desulfobulbaceae The bacterial strains of the cable promote the oxidation of Fe(II) in the surface layer and maintain the formation of Fe(II) in the deep layer, forming a stable spatial gradient distribution of Fe(II) / Fe(III).

[0015] In summary, the technical solutions conceived in this invention achieve the following beneficial effects compared with the prior art: (1) The present invention provides Desulfobulbaceae The 16S rRNA gene sequence of the *Cable Fibers* strain is shown in SEQ ID NO: 1. Compared with other existing *Cable Fibers* bacteria, the strain of this invention is similar in phylogenetic tree... Candidate Electrocnema They cluster into the same branch and form independent branches, and their sequence characteristics are different from those of existing cable bacteria.

[0016] (2) The present invention provides Desulfobulbaceae The cable bacteria strain exhibits a continuous filamentous structure with a relatively smooth surface, weakened or indistinct longitudinal ridges, and indistinct cell segmentation interfaces, distinguishing it from existing cable bacteria in terms of morphological characteristics.

[0017] (3) The present invention Desulfobulbaceae The specific amplification primers for the 16S rRNA of *Cyclophorus* strains are based on existing *Cyclophorus* genus (including...). Candidatus Electrothrix, Candidatus ElectrocnemaBy comparing and analyzing conserved 16S rRNA sequences (e.g., those from cable bacteria families), and while maintaining the conservation of the 16S rRNA gene, degenerate bases were introduced to target base differences between different strains, thus designing degenerate primers capable of covering closely related sequences of different cable bacteria. These specific amplification primers can specifically amplify the 16S rRNA gene of this new strain, enabling rapid screening, molecular identification, and phylogenetic classification of the strain in conjunction with sequencing, BLAST alignment, and phylogenetic tree construction. The specific amplification primers of this invention can effectively improve the amplification success rate of target cable bacteria in complex sludge systems and reduce interference from non-target microorganisms, providing a reliable molecular tool for the detection, identification, and subsequent applications of cable bacteria derived from sludge.

[0018] (4) The present invention Desulfobulbaceae The *Clostridium difficile* strain can adapt to the complex redox environment of sludge systems, forming a stable vertical redox gradient within the sludge system. This improves electron transfer efficiency and redox stability within the sludge, thus enabling the coupling of sulfide oxidation and oxygen reduction processes in sludge. Specifically, through long-distance electron transfer, it participates in sulfide migration and transformation, as well as iron redox coupling processes in the sludge system. This promotes the migration and oxidation of sulfides from deeper layers to the surface, reducing local sulfide accumulation. Furthermore, by promoting surface Fe(II) oxidation and maintaining deep Fe(II) formation, it creates a stable Fe(II) / Fe(III) spatial gradient distribution, thereby promoting the coupling of sulfur and iron cycling processes and ultimately stabilizing these processes within the sludge. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the structure of the cable bacteria enrichment and purification culture device of the present invention; wherein: 1-bacterial culture container, 2-culture chamber, 3-H2S storage chamber, 4-cable bacteria culture chamber, 5-partition, 6-pipeline, 7-ventilation valve.

[0020] Figure 2 This is an electrophoresis gel image of the 16S rRNA amplification product of *Cyclophorus* enriched and cultured in this invention using specific primers.

[0021] Figure 3 The images show optical microscope (left) and scanning electron microscope (right) images of the cable bacteria of the present invention.

[0022] Figure 4 This is the cable bacteria phylogenetic tree of the present invention.

[0023] Figure 5 This invention originates from sludge. Desulfobulbaceae A schematic diagram of the redox gradient and sulfur-iron coupling distribution formed by the bacterial strains of KeCable in the sludge system. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0025] The first embodiment of the present invention provides a Desulfobulbaceae A strain of *C. cableii*. The 16S rRNA gene sequence of this *C. cableii* is shown in SEQ ID NO:1, and it is related to... in the phylogenetic tree. Candidate Electrocnema They cluster together into the same branch and form independent branches.

[0026] The second embodiment of the present invention provides specific amplification primers for the 16S rRNA of the cable bacteria strain in the first embodiment. These specific amplification primers can specifically amplify the 16S rRNA gene of this new strain, accurately amplifying the target cable bacteria in the complex sludge system and reducing interference from the amplification of non-target microorganisms.

[0027] The third embodiment of the present invention provides the application of the cable bacteria strain from the first embodiment in the process of coupling sulfide oxidation and oxygen reduction in sludge. This cable bacteria strain from the Desulfobulbaceae family, derived from sludge, can form a cross-depth electron transport pathway through a filamentous structure. It oxidizes sulfides and releases electrons in the deep reduction zone of sludge, while simultaneously transferring electrons along the hyphae to the surface oxidation zone and coupling the oxygen reduction process. This achieves spatial separation and coupling of sulfide oxidation and oxygen reduction, forming a stable redox gradient structure.

[0028] In some implementations, the sludge-derived... Desulfobulbaceae The bacterial strain of the cable promotes the migration and oxidation of deep sulfides to the surface through electron transfer, and the oxidation transformation occurs in the surface oxidation zone, thereby reducing the local accumulation of sulfides. At the same time, by promoting the oxidation of surface Fe(II) to Fe(III) and maintaining the formation of deep Fe(II), a stable Fe(II) / Fe(III) spatial gradient distribution is formed, thereby promoting the coupling of the sulfur cycle and the iron cycle.

[0029] The beneficial effects of the present invention will be further illustrated below with reference to the following embodiments.

[0030] Example 1: Construction of a high-density bacterial culture device for cables This embodiment provides a cable bacterium Desulfobulbaceae High-density culture device for new strains of the family, Figure 1 This is a schematic diagram of the device, including a sulfide generation unit, a gas delivery unit, and a cable-based bacterial culture unit. The sulfide generation unit is bacterial culture container 1, which is used to generate H2S gas by culturing sulfate-reducing bacteria. The cable bacteria culture unit includes a culture chamber 2, which is equipped with an H2S storage chamber 3 and a cable bacteria culture chamber 4 located above the H2S storage chamber 3. There is a partition 5 between the H2S storage chamber 3 and the cable bacteria culture chamber 4. The partition 5 is a G3 type quartz sand core with a pore size of 25 μm and a porosity of 40%.

[0031] The gas delivery unit is a gas delivery pipe 6. One end of the pipe 6 is connected to the bacterial culture container 1, and the other end is connected to the H2S storage chamber 3. A vent valve 7 is provided on the pipe 6. The pipe 6 is used to deliver the H2S generated in the bacterial culture container 1 to the H2S storage chamber 3. The H2S storage chamber 3 is used to store H2S gas and to allow the H2S gas to diffuse from bottom to top into the cable bacterial culture chamber 4 through the partition 5. The cable bacterial culture chamber 4 has an opening at the top, allowing oxygen to diffuse from the air downwards into the chamber.

[0032] Through the above structure, a stable H2S diffusion gradient from bottom to top and an O2 diffusion gradient from top to bottom are formed in the cable bacteria culture chamber 4, thereby constructing a redox stratified environment suitable for the growth of cable bacteria.

[0033] Example 2: Enrichment Culture Method for Cable Bacteria Based on the apparatus of Example 1, cable bacteria enrichment culture was performed, and the specific steps are as follows: (1) Sample acquisition and inoculation Excess sludge from the secondary sedimentation tank of the Tangxun Lake Wastewater Treatment Plant in Wuhan was used as a sample and inoculated into the cable bacteria culture chamber of the cable bacteria culture unit. The culture medium for the sample included: acetic acid, yeast extract, tryptone, amino acid composition, vitamin composition, and mineral composition; (2) H2S generation and input Sulfate-reducing bacteria are inoculated into the sulfide generation unit and cultured under anaerobic conditions to continuously produce H2S gas; the H2S is then introduced into the H2S storage chamber at the bottom of the cable bacteria culture unit through the gas delivery unit. (3) Oxygen supply and gradient formation O2 is supplied to the system from the top of the cable bacteria culture unit, and the culture system is kept in a static or low-disturbance state, so that H2S diffuses from bottom to top and O2 diffuses from top to bottom, forming a stable vertical redox gradient in the cable bacteria culture chamber 4. The system is then cultured at 20℃ to 30℃ for 7 to 21 days to achieve the enrichment and high-density growth of cable bacteria. (4) Static incubation Incubate at 28℃ for 7 days, keeping the system in a semi-closed state during the incubation process and avoiding drastic disturbances; (5) Cultivation and Regulation The H2S input rate is controlled by adjusting the ventilation valve, and the O2 supply intensity is adjusted according to the culture conditions to maintain the stability of the gradient interface and preserve the activity and culture stability of the cable bacteria.

[0034] After the above culture process, a significant enrichment of cable bacteria can be observed in the culture substrate layer.

[0035] Example 3: Molecular identification of cable bacteria Molecular identification was performed on the cable bacteria enriched in Example 2. Total DNA was extracted from the enriched samples. PCR amplification was performed using 16S rRNA-specific primers designed for the cable bacteria family, and positive amplification products were screened. The positive PCR products were sequenced to obtain the target sequence. The target sequence was submitted to NCBI for BLAST alignment to screen for closely related bacterial sequences. Representative sequences of known cable bacteria genera were downloaded, including... Candidate Electrothrix, Candidate Electrocnema Reference sequences were obtained, and these reference sequences, along with the target sequence and BLAST-related sequences, were imported into MEGA software to construct a phylogenetic tree. The taxonomic position of the target sequence was determined based on its clustering relationship with known *C. cablei* genera within the phylogenetic tree. When the target sequence and... Candidate Electrocnema When bacteria cluster into the same branch and are clearly separated from other known branches of cable bacteria, they can be identified as belonging to [a specific group / organism]. Desulfobulbaceae Family Electrocnema New strains of undetermined species in the taxonomic group.

[0036] Specifically, the following steps are included: (1) DNA extraction Take the enriched system after culture, add DNA extraction reagent, lyse at 95℃ for 10 min, centrifuge at 12000–15000 rpm for 2 min, and take the supernatant as PCR template. (2) PCR amplification Amplification was performed using the specific primers for 16S rRNA of *Bacillus cereus* designed in this invention. The reaction system was a 3-Step PCR, and the conditions were as follows: Pre-denaturation at 98℃ for 2 min; extension at 98℃ for 10 s, 60℃ for 15 s, and 68℃ for 1 min / kb, repeated 30–40 times; amplification was performed using primer pairs 406F1 / 1020R1, 406F2 / 1020R2, 145F / 805R, and wn70F / wn517R, as shown in Table 1 below: Table 1 Primers

[0037] The wn70F / wn517R primer pair is a degenerate primer: where Y represents at least one of C and T, and K represents at least one of G and T.

[0038] SEQ ID NO:2:AGGGACTTCGGTCCCGAGTA SEQ ID NO:3:AGGGACTTCGGTCCTGAGTA SEQ ID NO:4: GAGTTAGCCGGGGCTTCCT SEQ ID NO:5: GAGTTAGCCGGTGCTTCCT (3) Electrophoresis detection The PCR products were analyzed by agarose gel electrophoresis, such as... Figure 2 As shown, lane 6 contains the 2000bp DNA Marker, lane 7 contains the amplification products of the 406F1 and 1020R1 primer pair, lane 8 contains the amplification products of the 406F2 and 1020R2 primer pair, lane 9 contains the amplification products of the 145F and 805R primer pair, and lane 10 contains the amplification products of the wn70F and wn517R primer pair.

[0039] The primer pair wn70F and wn517R amplified product 10 with a clear band, while the amplification results of other primers were weak or absent, indicating that the culture belongs to the cable bacteria group, but is different from known species.

[0040] (4) Sequencing and alignment The target PCR product was sequenced to obtain the 16S rRNA gene sequence (SEQ ID NO:1): TGAGTGAGTTCGGGCGGGGCTTCCTTTTGAGGGTCGTCAACCAAGATCCTAGACGTGCGATGTACGTGCTCAAGCATTTCTTTCCCTCTTGACAGAGGTTTACGACCCGAAGACCTTCATCCCTCACGAGGCGTCGCTGCGTCAGGCTTTCCCCCATTGCGCAATATTCCCCACTGCTGCCTCACGTAGGAGTCTGGCCCGTGTTCCAGTCCCAGGGTGGCGGATCATCCTCTCAGACCAG CTACTCATCGTAGCCTGGGTAGGCCATTACCCTACCAACTTAGATAACGAGACAGCGGACTCACTCTCGCAGTGCAGTAGCTAGCAAGAAGAGGCCACCTTTACCCCATGAAGTTAAAAAGGAAAAATATCCGGCATTAATAACAGCACTTCCCGGCGGGTAATCCCGAACACCAAGGGTAGATAAACCACGCGTTTACTCACCCGTGCGCCTGCTCTACTCAGGACCGAAGGCCCTAACTA (5) Phylogenetic analysis Sequencing sequences were submitted to NCBI for BLAST alignment to screen for similar sequences; closely related sequences and known *Cyclobacteria* genus (such as...) were selected. Candidate Electrothrix and Candidate Electrocnema Reference sequences were imported into MEGA software to construct phylogenetic trees (e.g., ...). Figure 3 (as shown) The results showed that this strain was related to Candidate Electrocnema They clustered into the same branch and were clearly separated from other cable bacteria branches, belonging to... Desulfobulbaceae A new strain of undetermined cable bacteria in the family.

[0041] This invention establishes a systematic identification method for novel strains of cable bacteria derived from sludge. It goes beyond simply "culturing suspected cable bacteria," combining 16S rRNA-specific amplification, sequencing, NCBI BLAST close-related sequence screening, and MEGA phylogenetic tree construction to achieve a systematic determination of the taxonomic position of the target strain. According to this procedure, the target culture and... Candidate Electrocnema They clustered into the same branch and were clearly distinguishable from other known cable bacteria branches, thus confirming that they were... Desulfobulbaceae A novel strain of freshwater cable bacteria, belonging to an undetermined species family, was discovered. The 16S rRNA gene sequence of this novel cable bacteria strain was compared with [the described strain] using NCBI BLAST. Candidate Electrocnema It has the highest similarity, but the sequence differences reach the range for new species determination.

[0042] Example 4: Observation of bacterial morphology in cables The enriched samples were observed using optical microscopy and scanning electron microscopy, and the results are as follows: Figure 4 As shown.

[0043] The cable bacteria exhibit a continuous filamentous structure, reaching millimeter-long lengths, with individual filaments measuring 1–3 μm in diameter. They display distinct longitudinal arrangement and ridge-like structures, but compared to existing known cable bacteria, the strain obtained in this invention has a smoother surface, significantly weakened longitudinal ridge structures, and indistinct cell segmentation interfaces. These morphological differences may stem from variations in electron transport structure expression, adaptive changes to the complex sludge environment, and extracellular polymeric coating. Combining 16S rRNA gene sequence analysis (Example 3) and phylogenetic tree analysis (Example 5), this strain... Candidate Electrocnema They cluster together in the same branch but form independent branches, further demonstrating their genus at both the morphological and molecular levels. Desulfobulbaceae A new type of cable bacteria in the family.

[0044] Example 5: Phylogenetic Analysis and Classification Phylogenetic analysis results show that the target strain obtained in this invention is similar to... Candidate Electrocnema The known strains clustered within the same phylogenetic clade and exhibited significant genetic differences from other reported species, indicating that they are... Desulfobulbaceae A new, unnamed type of cable bacteria in the field.

[0045] Based on its ecological environment characteristics originating from a wastewater treatment system, this strain was named: Candidate Electrocnema cloacensis The term "cloacensis" indicates that the bacterium originated from a wastewater treatment system (cloaca).

[0046] Example 6: Regulatory effect of novel strain on sulfur-iron coupling process in sludge system To verify the results obtained by screening sludge from this invention Desulfobulbaceae The environmental functions of bacterial strains in the sludge system were investigated, and their effects on redox gradients, sulfide migration and transformation, and iron speciation were studied.

[0047] The results are as follows Figure 5As shown, the lines of the same color represent the fitted curves for the concentration changes of different indicators at two random locations within the sludge-cable bacteria culture chamber. In the sludge system inoculated with this cable bacteria strain, a clear redox stratification structure forms along the depth direction. Specifically, the O2 concentration is higher at the sludge surface and gradually decreases with increasing depth, approaching depletion at a depth of approximately 15–20 mm, indicating the formation of a top-to-bottom oxygen concentration gradient within the system. Simultaneously, the pH shows a significant variation trend at different depths, indicating the existence of a stable redox stratification environment within the system.

[0048] The sulfide distribution results showed that the concentration of [S] (OD670) was low in the surface area and gradually increased in the deep area, indicating that sulfides were mainly enriched in the lower reducing zone. Combined with the changes in oxygen gradient, it can be seen that this strain can promote the upward migration of deep sulfides and the oxidation transformation in the surface oxidation zone, thereby reducing the local accumulation of sulfides in the sludge.

[0049] Furthermore, the Fe(II) concentration distribution also exhibited significant depth differences. Fe(II) concentrations were higher in deeper regions and significantly lower in the surface region, indicating the presence of an oxidation process from Fe(II) to Fe(III) in the system. This process is related to long-distance electron transfer mediated by cable bacteria; that is, electrons released from sulfide oxidation in deeper regions are transferred to the surface through the filamentous structure of cable bacteria, coupling with the surface oxygen reduction process, thereby promoting the iron redox cycle and the sulfur-iron coupling reaction.

[0050] As can be seen from the above analysis, the cable bacteria strain obtained by this invention can establish a stable vertical redox gradient in the sludge system and participate in the sulfur and iron cycles through long-distance electron transfer. It has a significant regulatory effect on the migration and transformation of sulfides, the distribution of iron speciation, and the stability of the redox environment in the sludge system, providing a new functional microbial resource for the resource utilization of sludge and the regulation of reducing pollutants.

[0051] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A kind Desulfobulbaceae The bacterial strain of the cable, characterized in that, The 16S rRNA gene sequence of the cable bacteria strain is shown in SEQ ID NO:

1.

2. As described in claim 1 Desulfobulbaceae The bacterial strain of the cable, characterized in that, The bacterial strains found in the cables exhibit a continuous filamentous structure.

3. As described in claim 1 or 2 Desulfobulbaceae Primers for the specific amplification of 16S rRNA from *Cyclophorus* strains, characterized in that... The specific amplification primers are degenerate primers.

4. The specific amplification primers for 16S rRNA as described in claim 3, characterized in that, The forward primers of the degenerate primers are shown in SEQ ID NO:2 and / or SEQ ID NO:3, and the reverse primers are shown in SEQ ID NO:4 and / or SEQ ID NO:

5.

5. As described in claim 1 or 2 Desulfobulbaceae Application of bacterial strains in cable manufacturing in the coupled hydrogen sulfide oxidation and oxygen reduction process in sludge.

6. The application as described in claim 5, characterized in that, The Desulfobulbaceae The application of the KeCable Bacterial strain in forming a stable vertical redox gradient within the sludge system.

7. The application as described in claim 6, characterized in that, The specific application is as follows: Desulfobulbaceae The bacterial strain of KeCable forms an electron transport pathway through a filamentous structure. It oxidizes hydrogen sulfide and releases electrons in the deep reduction zone of sludge. The electrons are transferred along the hyphae to the surface oxidation zone and coupled with the oxygen reduction process, thus achieving spatial coupling of hydrogen sulfide oxidation and oxygen reduction.

8. The application as described in claim 7, characterized in that, The Desulfobulbaceae The bacterial strains of the cable promote the oxidation of Fe(II) in the surface layer and maintain the formation of Fe(II) in the deep layer, forming a stable spatial gradient distribution of Fe(II) / Fe(III).

Images