A rapid evaluation method of salt and alkali tolerance related genes based on transgenic callus of hordeum brevisubulatum

Abstract

The application discloses a kind of short awn barley grass transgenic callus-based salt-tolerant related gene rapid evaluation method.The method includes: by Agrobacterium-mediated method, the plant expression vector containing target gene is transformed short awn barley grass callus, and transgenic callus is obtained by resistance screening;Transgenic callus is inoculated in the saline-alkali stress medium containing NaHCO3 and is cultured, and the proliferation of callus under salt-alkali stress and fresh weight change are detected, and the salt-tolerant function of target gene is evaluated.The application establishes the rapid function identification system based on short awn barley grass transgenic callus, and the in-vivo function verification of candidate salt-tolerant gene can be completed without obtaining complete transgenic plant, with the advantages of short cycle, simple operation, high repeatability, high screening efficiency, etc., and can be used for the rapid screening and function identification of plant salt-tolerant related gene, to provide new technical means for salt-tolerant crop molecular breeding and saline-alkali land agricultural development.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and plant genetic engineering, specifically relating to a rapid evaluation method for salt-alkali tolerance-related genes based on transgenic barley grass callus. Background Technology

[0002] Soil salinization has become a global ecological and environmental problem. In the Songnen Plain of Northeast China, salinization, primarily due to NaHCO3, severely inhibits plant growth and development, leading to reduced crop yields or even crop failure, and severely restricting local agricultural development. Major cultivated crops such as rice, wheat, and barley generally have weak salt tolerance and are ill-suited to such complex adverse conditions. Short-awned barley grass (Hordeum brevisubulatum) is a perennial plant of the wheat tribe, possessing both outstanding salt tolerance and high forage value. This species is widely distributed across Eurasia and is an important dominant species in saline-alkali meadow steppes in northern my country. Studies have shown that its salt tolerance is comparable to that of small-flowered alkali grass (Puccinellia tenuiflora), and it can still grow well under conditions of total salt content below 0.3% and pH above 8.0. In the establishment of artificial grasslands, its salt tolerance and weed resistance are superior to those of Leymus chinensis; it also possesses strong cold resistance (safely overwintering at -40℃), drought and poor soil tolerance (it can grow normally under conditions of 420 mm annual rainfall and a frost-free period of 140 days, and can even adapt to water-scarce environments such as dry roadsides and sandy mountainous areas), and better water and waterlogging tolerance than Leymus chinensis (it can grow well in low-humidity meadow black soil with temporary water accumulation). With these comprehensive advantages in stress resistance, short-awned barley grass is not only an ideal material for studying the mechanisms of plant salt and alkali adaptation, but also an important genetic resource for crop genetic improvement.

[0003] However, this species currently lacks an efficient and rapid in vivo gene function evaluation system, making it difficult to rapidly verify the function of its abundant stress-resistance gene resources. This severely restricts the discovery and application of superior salt-alkali tolerance genes. To date, no publicly available technical reports have described a rapid evaluation method for salt-alkali tolerance-related genes based on transgenic callus tissue of *Barley grass*. In existing technologies, the functional identification of plant salt-alkali tolerance genes mainly relies on the construction of stable genetically transformed plants, which suffers from problems such as lengthy cycles, low transformation efficiency, complex procedures, and high screening costs, making it difficult to meet the demand for rapid in vivo functional verification of a large number of candidate stress-resistance genes. Therefore, there is an urgent need to establish an efficient, stable, and easy-to-operate rapid evaluation system for salt-alkali tolerance genes in *Barley grass* to achieve rapid screening and functional identification of stress-resistance-related genes and provide key technical support for molecular breeding of salt-alkali tolerant crops. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a rapid evaluation method for salt-alkali tolerance-related genes based on transgenic barley grass callus. This method can rapidly identify the in vivo function of candidate salt-alkali tolerance genes at the callus level, thereby improving the efficiency of salt-alkali tolerance gene screening and shortening the functional verification cycle.

[0005] The objective of this invention is achieved through the following technical solution: a rapid evaluation method for salt tolerance-related genes based on transgenic barley grass callus, comprising the following steps:

[0006] (1) Construct a plant expression vector containing the target gene and infect barley grass callus tissue with Agrobacterium tumefaciens-mediated transformation.

[0007] (2) Resistance screening was performed on the infected callus tissue to obtain transgenic callus tissue;

[0008] (3) The transgenic callus was inoculated into a salt-alkali stress medium and cultured.

[0009] (4) The growth status of the transgenic callus under salt and alkali stress was detected and compared with the control group to evaluate the salt and alkali tolerance function of the target gene.

[0010] Furthermore, the concentration of NaHCO3 in the salt-alkali stress culture medium is 50 mM.

[0011] Furthermore, the growth status includes callus proliferation and fresh weight.

[0012] Furthermore, the target gene is a transcription factor, ion transporter, or signal transduction-related gene associated with plant salt and alkali tolerance.

[0013] This invention also provides the application of the rapid evaluation method in the functional identification of salt-alkali tolerance-related genes in plants.

[0014] Furthermore, the plant in question is short-awned barley grass.

[0015] The beneficial effects of this invention are as follows: This invention establishes a rapid evaluation system for salt-alkali tolerance-related genes based on transgenic callus tissue of short-awned barley grass. The in vivo functional verification of candidate genes can be completed without obtaining complete transgenic plants. It has the advantages of short detection cycle, simple operation, high repeatability and high screening efficiency. It can be used for rapid screening and functional identification of salt-alkali tolerance-related genes in plants, providing a new technical means for molecular breeding of salt-alkali tolerant crops. Attached Figure Description

[0016] Figure 1 This is the genetic transformation process of short-awned barley grass callus mediated by Agrobacterium;

[0017] Figure 2 Identification of positive callus tissue of short-awned barley grass with overexpression of salt tolerance gene;

[0018] Figure 3 This is the growth state of short-awned barley grass callus with overexpression of salt-alkali tolerance genes under salt-alkali stress. Detailed Implementation

[0019] The present invention will now be described in detail with reference to the accompanying drawings.

[0020] Example 1: Agrobacterium-mediated genetic transformation of short-awned barley grass callus

[0021] Seeds of short-awned barley grass were collected at the Anda Field Experiment Base (located at Zhangjiadian Andong Second Road, Wolitun Town, Anda City, Suihua City, Heilongjiang Province). In vitro disinfection and callus induction were performed in a sterile ultra-clean workbench in the laboratory. The specific steps are as follows: (1) Take about 30 short-awned barley grass seeds and carefully remove the lemma with tweezers. (2) Wash once with sterile deionized water. (3) Wash with 5 mL of 75% anhydrous ethanol for 5 min and discard the 75% anhydrous ethanol. (4) Immediately rinse once with 5 mL of sterile water, and then wash twice with 5 mL of sterile water. (5) Wash with 20 mL of 2% sodium hypochlorite for 20 min, shaking continuously during the process, and discard the sodium hypochlorite. (6) Immediately rinse once with 5 mL of sterile water, and then wash 7-8 times with 5 mL of sterile water. (7) Pour the seeds onto sterile filter paper, keeping the seeds moist during the process. (8) Gently pick up the seeds with pointed tweezers, keeping the growing point against the surface of the culture medium, and place them on the induction medium (see Table 1-1 for the culture medium formula). Seal the plate with 3M tape. (9) Place the plate with the seeds on it at 4℃ in the dark for 3 days for vernalization. (10) After vernalization, transfer the plate to a culture rack and culture for one week. (11) After one week, place it in the dark at 25℃. After about 4-8 weeks, white callus will appear. Carefully peel off the seeds and buds from the germinating callus and transfer them to ordinary subculture medium (see Table 1-2 for the culture medium formula). Subculture every 14 days. After the second subculture, peel off some of the secondary metabolites, leaving the granular solid tissue, and subculture for another week. The size of the seed is about the size of a mung bean and can be used for genetic transformation.

[0022] Agrobacterium strain containing the target plasmid was streaked onto YEP solid plates and incubated at 28°C for 2–3 days. Single colonies were picked and inoculated into 20 mL of YEP liquid medium containing rifampicin and kanamycin, and cultured overnight at 28°C with shaking at 200–220 rpm. The next day, the OD600 value of the bacterial culture was measured to be 0.8–0.9. 500 μL of the bacterial culture was transferred to 10 mL of antibiotic-free YEP medium and cultured at 28°C with shaking at 200–220 rpm until OD600≈1.0.

[0023] Select high-quality callus (pale yellow, plump, and vigorously growing, or light yellow to yellow in good tissue condition). In a clean bench, remove secondary metabolites from the pre-cultured callus tissue and place it on fresh induction medium. Take 30 μL of bacterial suspension and add it dropwise to the center of each callus, covering the entire callus. After approximately 5 seconds, aspirate excess suspension, place the callus in a clean bench to dry, and then replace with fresh callus induction medium.

[0024] Infected callus was cultured in the dark for 3 days, during which the growth of Agrobacterium was observed and the culture medium was replaced as needed. After 3 days of dark culture, the co-cultured callus tissue was placed in an empty petri dish, and 50 mL of 200 mg / L Timentin aqueous solution was added. The dish was gently shaken for 2 minutes to remove bacteria. The cephalosporin solution was then aspirated, and the callus was washed with sterile water three times. The callus was then gently removed with forceps, placed on filter paper to remove any adhering liquid, and placed on a new subculture medium containing 200 mg / L Timentin and 50 mg / L plant-resistant callus. The culture medium was incubated in the dark at 28°C for 2-3 days. The subculture medium was based on the medium formulations in Table 1-2, with the addition of appropriate plant screening antibiotics. Results are as follows: Figure 1 As shown, mature seeds with the lemma removed were inoculated onto callus induction medium ( Figure 1 A), after 4-8 weeks of culture, pale yellow, granular embryogenic callus is obtained. At this time, the callus is in good condition and suitable for infection ( Figure 1 B). Subsequently, the pre-cultured callus tissue was immersed in Agrobacterium bacterial solution containing the salt-tolerance gene to be tested (B). Figure 1 C). After co-culture, the culture was transferred to a subculture medium containing plant resistance for resistance screening. Figure 1 D).

[0025] Table 1-1 Callus induction culture medium

[0026] MS medium 4.74 g sucrose 30 g 2,4-D (10 mg / ml) 500 μL 6-BA (10 mg / ml) 100 μL Plant gel 5g <![CDATA[ddH2O]]> Up to 1 L total 1 L

[0027] Table 1-2 Callus Subculture Culture Media

[0028] MS medium 4.74 g sucrose 30g Inositol 0.5g CH 0.5 g 2,4-D (10 mg / ml) 200 μL KT (10 mg / ml) 10 μL Plant gel 5 g <![CDATA[ddH2O]]> Up to 1 L total 1 L

[0029] Example 2 Identification of positive callus tissue from short-awned barley grass overexpressing salt tolerance gene

[0030] Callus tissue that did not brown and grew normally on subculture medium supplemented with the corresponding plant resistance selection material was selected. DNA was extracted from a portion of the tissue, and PCR was used to detect the integration of DNA into the genome of *Barley Budgrass* callus tissue. Uninfected wild-type callus was used as a control. Primers are shown in Tables 1-3, reaction systems in Tables 1-4, and reaction procedures in Tables 1-5. If the overexpression vector contains a GFP tag, *Agrobacterium*-infected callus tissue can be observed under a fluorescence microscope to further clarify its fluorescence signal, serving as material for subsequent testing under salt-alkali stress conditions. Results are as follows: Figure 2 As shown, DNA identification was performed on 19 short-awned barley grass resistant calluses obtained through resistance screening. Genomic DNA was extracted from resistant and wild-type calluses, and PCR amplification was performed using universal primers for the vector promoter and specific primers for the salt-tolerant gene at approximately 600 bp. The recombinant vector plasmid for the salt-tolerant gene served as a positive control, and wild-type callus tissue served as a negative control. Agarose gel electrophoresis results showed that some callus tissues exhibited a clear target band at the expected size (approximately 700 bp), confirming them as transgenic calluses; while some callus tissues showed no band or a very weak band, which may be non-transformed calluses or false positives. Figure 2 A). Fluorescence detection of transgenic callus revealed a green fluorescent signal emitted by the GFP tag under a fluorescence microscope. Figure 2 B). Select transgenic callus tissue with clear target bands for subculture propagation to obtain sufficient callus tissue for subsequent salt-alkali stress treatment experiments.

[0031] Table 1-3 Primers for DNA molecular detection in transgenic rice

[0032] 35sf ATGACGCACAATCCCACTATC WRKY73-600bp-primer-R GGTGATCCTCGGGGTCTTT

[0033] Table 1-4 PCR Reaction System

[0034] Callus DNA 1 μL 35sf 1 μL WRKY73-600bp-primer-R 1 μL 2×Ex-Taq 5 μL <![CDATA[ddH2O]]> 2 μL

[0035] Table 1-5 Bacterial PCR Reaction Procedure

[0036]

[0037] Example 3: Growth status of short-awned barley grass callus overexpressing salt tolerance gene under salt stress

[0038] Callus tissues with correct DNA-level PCR bands were placed on callus subculture medium for propagation. After propagation, secondary metabolic tissues were removed, and callus tissues of uniform condition were selected and cut into 3 mm pieces. These pieces, along with callus tissues from the empty vector control group, were placed on ordinary callus subculture medium and subculture medium containing 50 mM NaHCO3 (the subculture medium was based on the medium formula in Table 1-2, with an additional 50 mM NaHCO3). The medium was incubated in the dark at 28°C. On day 15, callus proliferation was observed and images were taken, and the fresh weight of each callus was weighed using an electronic scale. Results are as follows: Figure 3 As shown, after 15 days of treatment, both the callus overexpressing the target gene and the callus transfected with empty vector grew well on ordinary subculture medium, with no significant difference in size and fresh weight, indicating that the callus materials grew in a consistent manner. On saline-alkali stress medium containing 50 mM NaHCO3, both the callus overexpressing the target gene and the callus transfected with empty vector showed varying degrees of browning, and their growth was significantly inhibited. However, compared with the control group transfected with empty vector, the callus overexpressing the target gene showed greater growth after saline-alkali treatment, with significantly higher volume and fresh weight. Figure 3 The above results indicate that overexpression of the salt-tolerant gene to be detected can effectively enhance the tolerance of short-awned barley grass callus to salt-alkali stress, further confirming the positive regulatory function of the gene at the tissue level.

Claims

1. A rapid evaluation method for salt tolerance-related genes based on transgenic barley grass callus, characterized in that, Includes the following steps: (1) Construct a plant expression vector containing the target gene and infect barley grass callus tissue with Agrobacterium tumefaciens-mediated transformation. (2) The infected callus tissue was subjected to resistance screening and transgenic callus tissue was obtained; (3) The transgenic callus was inoculated into a salt-alkali stress medium and cultured. (4) The growth status and fresh weight of the transgenic callus under salt and alkali stress were detected and compared with the control group to evaluate the salt and alkali tolerance function of the target gene.

2. The method according to claim 1, characterized in that, The concentration of NaHCO3 in the salt-alkali stress culture medium is 50 mM.

3. The method according to claim 1, characterized in that, The growth status includes callus proliferation and fresh weight.

4. The application according to claim 1, characterized in that: The plant in question is wild short-awned barley grass from the Songnen saline-alkali land.

5. The method according to claim 1, characterized in that, The target gene is a transcription factor, ion transporter, or signal transduction-related gene that is associated with plant salt and alkali tolerance.

Images