Polypeptides having alkaline phosphatase activity for animal feed

Abstract

The invention relates to animal feed additives comprising the polypeptides having alkaline phosphatase activity and which are pH or gastric stable. The invention futher relates to the animal feed additive for preserving or maintaining the health of an animal, typically poultry or swine, including the intestinal health of the animal.

Description

[0001] POLYPEPTIDES HAVING ALKALINE PHOSPHATASE ACTIVITY FOR ANIMAL FEED Reference to a Sequence Listing This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference. FIELD OF THE INVENTION The present invention relates to polypeptides having alkaline phosphatase activity, polynucleotides encoding the polypeptides, nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides. BACKGROUND OF THE INVENTION ALP is an enzyme that removes phosphates from a variety of substrates. ALPs are active in diverse biological processes. ALPs are found in all tissues in the human body but is mostly concentrated in the bones, kidneys, liver, intestines, and placenta. Intestinal alkaline phosphatase (IAP) has been most studied to date. Calf Intestinal Alkaline Phosphatase (CIAP) is a well known and commercially available alkaline phosphatase. WO2022196538 discloses variants of a Calf Intestinal Alkaline Phosphatase (CIAP) with improved thermal stability. However, CIAP has low or no gastric or pepsin stability. CIAP is therefore not suitable for use as an animal feed additive. Accordingly, there is a need in the art for novel alkaline phosphatases. Elanco (US20180326020) describes methods and compositions for reducing the environmental impact of animal waste using an alkaline phosphatase from Paenibacillus lentus. The alkaline phosphatase described in US20180326020 corresponds to SEQ ID NO:50 of the present invention. WO2023 / 102002 describes variants of a Paenibacillus lentus alkaline phosphatase with improved heat tolerance. SEQ ID NO:1 of WO2023 / 102002 corresponds to SEQ ID NO:107 referenced herein. SUMMARY OF THE INVENTION The present invention provides polypeptides having alkaline phosphatase activity and polynucleotides encoding the polypeptides. The present invention also relates to a polypeptide having alkaline phosphatase activity, wherein said polypeptide is of bacterial or fungal origin, or a variant of a polypeptide of bacterial or fungal origin, typically wherein the polypeptide is gastric or pepsin stable. The polypeptides of the invention were selected for their pH and / or gastric stability. The present invention also relates to polypeptide having alkaline phosphatase activity, selected from the group consisting of: (a) a polypeptide having at least 70% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106; (b) a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a); (c) a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a) or (b); (d) a polypeptide derived from a polypeptide of (a) or (c), or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids; (e) a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C- terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and (f) a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity. The present invention also relates to a composition comprising the polypeptide of the invention. The present invention is also directed to an animal feed additive comprising the polypeptide of the invention, preferably pH and / or gastric stable polypeptides with alkaline phosphatase activity. The present invention also relates to an animal feed comprising the polypeptide, the composition, or the animal feed additive of the invention. The present invention also relates to a zootechnical additive comprising the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method for the preparation of an animal feed additive, a zootechnical additive or a feed comprising the addition of the polypeptide of the invention. A further aspect of the invention is directed to a use of the polypeptide of the invention for the preparation of a feed additive, a feed composition or a zootechnical additive. A further aspect of the invention is directed to a method of increasing body weight gain in an animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of improving the food conversion ratio of an animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. An aspect of the invention is directed to a method of preventing weight loss in an infected animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method to prevent low birth weight, such as induced by perinatal undernutrition comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of improving weight gain in animals with below average birth weight comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal comprising feeding said animal the the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method to prevent colitis or the inflammation of the lining of the colon in an animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of preventing antibiotic- associated infections from Salmonella, such as Salmonella entericaserovar Typhimurium (S. Typhimurium) and / or Clostridium, such as Clostridium difficile comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, such reducing the relative amount of E.coli, Salmonella Typhimurium, such as Salmonella Typhimurium, Bacillus fragilis, S thermophilus, or C. difficile comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of reducing the immune response in an animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of reducing inflammation in an animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of reducing interleukin (IL) or tumor necrosis factor (TNF) respsonse in an animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of regulating fat absorption or neutralising acidic digesta entering the small intestine via stimulation of bicarbonate secretions and surface pH comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. A further aspect of the invention is directed to a method of maintaining or restoring (healthy) gut flora in an antibiotic treated animal comprising feeding said animal the polypeptide, the composition, or the animal feed additive of the invention. An aspect of the invention is directed to detoxification of LPS and / or ATP by ALP mediated de-phosphorylation, wherein the ALP is an ALP of the invention. An aspect of the invention is directed to a method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. An aspect of the invention is directed to a method of reducing the immune response in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. An aspect of the invention is directed to a method of reducing inflammation in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. An aspect of the invention is directed to a method of reducing IL or TNF respsonse in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. An aspect of the invention is directed to a method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. An aspect of the invention is directed to a method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. An aspect of the invention is directed to a method of preventing colitis or the inflammation of the lining of the colon, in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. An aspect of the invention is a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 is a polypeptide obtained from Parageobacillus caldoxylosilyticus having alkaline phosphatase activity. SEQ ID NO: 2 is a polypeptide obtained from Geobacillus thermoleovorans having alkaline phosphatase activity. SEQ ID NO: 3 is a polypeptide obtained from Sporolactobacillus sp-63357 having alkaline phosphatase activity. SEQ ID NO: 4 is a polypeptide obtained from Anoxybacillus caldiproteolyticus having alkaline phosphatase activity. SEQ ID NO: 5 is a polypeptide obtained from Geobacillus thermoleovorans having alkaline phosphatase activity. SEQ ID NO: 6 is a polypeptide obtained from Paenibacillus xylanexedens having alkaline phosphatase activity. SEQ ID NO: 7 is a polypeptide obtained from Sporolactobacillus sp-63357 having alkaline phosphatase activity. SEQ ID NO: 8 is a polypeptide obtained from Paenibacillus panacisoli having alkaline phosphatase activity. SEQ ID NO: 9 is a polypeptide obtained from Collimonas pratensis having alkaline phosphatase activity. SEQ ID NO: 10 is a polypeptide obtained from Paenibacillus illinoisensis having alkaline phosphatase activity. SEQ ID NO: 11 is a polypeptide obtained from Neobacillus bataviensis having alkaline phosphatase activity. SEQ ID NO: 12 is a polypeptide obtained from Aeromonas salmonicida subsp. salmonicida having alkaline phosphatase activity. SEQ ID NO: 13 is a polypeptide obtained from Paenibacillus amylolyticus having alkaline phosphatase activity. SEQ ID NO: 14 is a polypeptide obtained from Serratia plymuthica having alkaline phosphatase activity. SEQ ID NO: 15 is a polypeptide obtained from Cytobacillus firmus having alkaline phosphatase activity. SEQ ID NO: 16 is a polypeptide obtained from Priestia megaterium having alkaline phosphatase activity. SEQ ID NO:17 is a polypeptide obtained from Trichoderma citrinoviride having alkaline phosphatase activity. SEQ ID NO: 18 is a polypeptide obtained from Truncatella angustata having alkaline phosphatase activity. SEQ ID NO: 19 is a polypeptide obtained from Morchella semilibera having alkaline phosphatase activity. SEQ ID NO: 20 is a polypeptide obtained from Serratia ficaria having alkaline phosphatase activity. SEQ ID NO: 21 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 22 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 23 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 24 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 25 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 26 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 27 is a polypeptide obtained from Sporormia fimetaria having alkaline phosphatase activity. SEQ ID NO: 28 is a polypeptide obtained from Thermoascus crustaceus having alkaline phosphatase activity. SEQ ID NO: 29 is a polypeptide obtained from Thielavia australiensis having alkaline phosphatase activity. SEQ ID NO: 30 is a polypeptide obtained from Chaetomium thermophilum var. thermophilum having alkaline phosphatase activity. SEQ ID NO: 31 is a polypeptide obtained from Aspergillus sp. XZ2669 having alkaline phosphatase activity. SEQ ID NO: 32 is a polypeptide obtained from Colletotrichum sp-53045having alkaline phosphatase activity. SEQ ID NO: 33 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 34 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 35 is a polypeptide obtained from Caulobacter sp-63731 having alkaline phosphatase activity. SEQ ID NO: 36 is a polypeptide obtained from Caulobacter vibrioides having alkaline phosphatase activity. SEQ ID NO: 37 is a polypeptide obtained from Serratia nematodiphila having alkaline phosphatase activity. SEQ ID NO: 38 is a polypeptide obtained from Loktanella salsilacus having alkaline phosphatase activity. SEQ ID NO: 39 is a polypeptide obtained from Sphingopyxis chilensis having alkaline phosphatase activity. SEQ ID NO: 40 is a polypeptide obtained from Tolypocladium sp. XZ2657 having alkaline phosphatase activity. SEQ ID NO: 41 is a polypeptide obtained from Penicillium vasconiae having alkaline phosphatase activity. SEQ ID NO: 42 is a polypeptide obtained from Cladobotryum sp having alkaline phosphatase activity. SEQ ID NO: 43 is a polypeptide obtained from Taifanglania sp. ZY039 having alkaline phosphatase activity. SEQ ID NO: 44 is a polypeptide obtained from Achaetomium sp. ZY150 having alkaline phosphatase activity. SEQ ID NO: 45 is a polypeptide obtained from Chaetomium sp. ZY474 having alkaline phosphatase activity. SEQ ID NO: 46 is a polypeptide obtained from Fontibacillus aquaticus having alkaline phosphatase activity. SEQ ID NO: 47 is a polypeptide obtained from Paenibacillus sp-19179 having alkaline phosphatase activity. SEQ ID NO: 48 is a polypeptide obtained from Paenibacillus sp-62606 having alkaline phosphatase activity. SEQ ID NO: 49 is a polypeptide obtained from Paenibacillus woosongensis having alkaline phosphatase activity. SEQ ID NO: 50 is a polypeptide obtained from Bacillus lentus / Lederbergia lenta having alkaline phosphatase activity and is the polypeptide described in US20180326020. SEQ ID NO: 51 is a polypeptide obtained from a metagenome having alkaline phosphatase activity. SEQ ID NO: 52 is a polypeptide obtained from Paenibacillus sp-62603 having alkaline phosphatase activity. SEQ ID NO: 53 is a polypeptide obtained from Neobacillus bataviensis having alkaline phosphatase activity. SEQ ID NO: 54 is a polypeptide obtained from Paenibacillus taohuashanense having alkaline phosphatase activity. SEQ ID NO: 55 is a polypeptide obtained from Hyphomonas hirschiana having alkaline phosphatase activity. SEQ ID NO: 56 is a polypeptide obtained from Hyphomonas oceanitis having alkaline phosphatase activity. SEQ ID NO: 57 is a polypeptide obtained from Deinococcus radiodurans having alkaline phosphatase activity. SEQ ID NO: 58 is a polypeptide obtained from Deinococcus gobiensis having alkaline phosphatase activity. SEQ ID NO: 59 is a polypeptide obtained from Deinococcus pimensis having alkaline phosphatase activity. SEQ ID NO: 60 is a polypeptide obtained from Deinococcus sp-17890 having alkaline phosphatase activity. SEQ ID NO: 61 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 62 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 63 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 64 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 65 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 66 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 67 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 68 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 69 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 70 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 71 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 72 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 73 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 74 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 75 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 76 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 77 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 78 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 79 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 80 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 81 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 82 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 83 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 84 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 85 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 86 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 87 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 88 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 89 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 90 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 91 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 92 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 93 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 94 is a variant of SEQ ID NO: 21 having alkaline phosphatase activity. SEQ ID NO: 95 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 96 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 97 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 98 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 99 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 100 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 101 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 102 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 103 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 104 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 105 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 106 is a variant of SEQ ID NO: 11 having alkaline phosphatase activity. SEQ ID NO: 107 is the polypeptide described as SEQ ID NO: 1 in WO2023 / 102002, a variant of SEQ ID NO:50. DETAILED DESCRIPTION OF THE INVENTION In an aspect, the invention relates to an animal feed additive comprising polypeptide having alkaline phosphatase activity, selected from the group consisting of: (a) a polypeptide having at least 70% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106. (b) a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a) (c) a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a) or (b) (d) a polypeptide derived from a polypeptide of (a) or (c), or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids; (e) a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C-terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and (f) a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity activity. In a preferred embodiment, the polypeptide having alkaline phosphatase activity is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, more preferably a polypeptide of bacterial origin or a variant of a polypeptide of bacterial origin, having alkaline phosphatase activity. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 1. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 1 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 2. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 2 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 3. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 3 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 4. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 4 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 5. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 5 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 6. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 6 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 7. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO:7 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 8. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 8 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 9. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 9 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:10. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 10 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 11. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 11 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 12. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 12 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 13. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 13 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 14. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 14 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 15. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 15 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 16. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 16 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 17. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 17 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 18. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 18 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 19. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 19 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 20. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 20 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 21. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 21 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 22. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 22 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 23. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 23 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 24. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 24 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 25. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 25 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to ID NO: 26. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 26 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 27. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 27 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 28. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 28 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 29. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 29 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 30. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 30 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:31. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 31 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 32. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 32 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 33. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 33 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 34. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 34 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:35. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 35 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:36. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 36 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:37. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 37 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:38. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 38 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 39. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 39 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:40. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 40 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 41. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 41 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 42. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 42 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 43. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 43 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 44. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 44 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 45. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 45 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 46. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 46 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:47. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 47 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 48. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 48 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:49. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 49 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 51. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 51 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 52. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 52 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 53. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 53 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 54. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 54 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 55. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 55 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 56. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 56 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 57. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 57 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 58. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 58 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 59. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 59 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 60. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 60 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 61. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 61 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 62. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 62 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 63. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 63 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 64. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 64 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 65. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 65 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 66. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 66 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 67. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 67 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 68. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 68 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 69. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 69 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 70. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 70 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 71. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 71 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 72. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 72 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 73. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 73 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 74. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 74 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 75. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 75 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 76. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 76 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 77. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 77 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 78. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 78 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 79. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 79 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 80. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 80 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 81. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 81 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 82. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 82 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 83. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 83 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 84. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 84 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 85. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 85 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 86. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 86 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 87. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 87 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 88. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 88 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 89. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 89 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 90. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 90 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 91. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 91 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 92. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 92 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 93. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 93 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 94. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 94 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 95. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 95 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 96. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 96 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 97. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 97 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 98. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 98 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 99. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 99 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 100. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 100 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 101. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 101 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 102. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 102 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 103. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 103 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 104. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 104 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 105. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 105 or a mature polypeptide thereof. In an aspect, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 106. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 106 or a mature polypeptide thereof. In another aspect, the polypeptide is derived from a polypetide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106 by substitution, deletion or addition of one or several amino acids. In some embodiments, the polypeptide is a variant of a polypetide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106 comprising a substitution, deletion, and / or insertion at one or more positions, wherein the variant has alkaline phosphatase activity.. In one aspect, the number of amino acid substitutions, deletions and / or insertions introduced into a polypetide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106 is up to 120, such as up to 100, such as up to 80, such as up to 60, such as up to 50, up to 40, such as up to 30, such as up to 20, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, or 20, wherein the variant of the polypeptide has alkaline phosphatase activity.The amino acid changes may be of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; small deletions, typically of 1-30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding module. In a preferred embodiment, the polypeptide is derived from SEQ ID NO: 11 by substitution, deletion or addition of one or several amino acids, wherein the polypeptide has alkaline phosphatase activity. In some embodiments, the polypeptide is a variant of SEQ ID NO: 11 comprising a substitution, deletion, and / or insertion at one or more positions, wherein the variant of the polypeptide has alkaline phosphatase activity. In one aspect, the number of amino acid substitutions, deletions and / or insertions introduced into the polypeptide of SEQ ID NO: 11 is up to 120, such as up to 100, such as up to 80, such as up to 60, such as up to 50, up to 40, such as up to 30, such as up to 20, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17, 18, 19, or 20, wherein the variant of the polypeptide has alkaline phosphatase activity. The amino acid changes may be of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and / or activity of the protein; small deletions, typically of 1- 60 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding module. In a preferred embodiment, the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 11 or is a variant SEQ ID NO: 11 by substitution, deletion or addition of one or several amino acids, wherein the variant has alkaline phosphatase activity, has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to a polypeptide selecteled from the group group consisting of SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106. In an aspect, the invention relates to polypeptides having alkaline phosphatase activity, wherein the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a polypeptide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, and SEQ ID NO: 106. In a preferred embodiment, the polypeptide having alkaline phosphatase activity is a polypeptide having at least 80% sequence identity to a polypeptide selected from the group SEQ ID NO: 11 and variants thereof. Accordingly, the polypeptide is preferably selected from a polypeptide having at least 80% sequence identity, such as at least 85% sequence identity, such as at least 90% sequence identity, such as at least 95% sequence identity, such as at least 96, 97, 98, 99% sequence identity to a polypeptide selected from the group SEQ ID NO: 11, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 68, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105 and SEQ ID NO: 106. In a preferred embodiment, the polypeptide having alkaline phosphatase activity is a polypeptide having at least 80% sequence identity to a polypeptide selected from SEQ ID NO:21 and variants thereof. Accordingly, the polypeptide is preferably selected from a polypeptide having at least 80% sequence identity, such as at least 85% sequence identity, such as at least 90% sequence identity, such as at least 95% sequence identity, such as at least 96, 97, 98, 99% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93 and SEQ ID NO: 94. Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant molecules are tested for alkaline phosphatase activity to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem.271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol.224: 899-904; Wlodaver et al., 1992, FEBS Lett.309: 59-64. The identity of essential amino acids can also be inferred from an alignment with a related polypeptide, and / or be inferred from sequence homology and conserved catalytic machinery with a related polypeptide or within a polypeptide or protein family with polypeptides / proteins descending from a common ancestor, typically having similar three-dimensional structures, functions, and significant sequence similarity. Additionally or alternatively, protein structure prediction tools can be used for protein structure modelling to identify essential amino acids and / or active sites of polypeptides. See, for example, Jumper et al., 2021, “Highly accurate protein structure prediction with AlphaFold”, Nature 596: 583-589. Single or multiple amino acid substitutions, deletions, and / or insertions can be made and tested using known methods of mutagenesis, recombination, and / or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95 / 17413; or WO 95 / 22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; US 5,223,409; WO 92 / 06204), and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127). Mutagenesis / shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide. Definitions In accordance with this detailed description, the following definitions apply. Note that the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Unless defined otherwise or clearly indicated by context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Animal: The term “animal” refers to all animals except humans. Examples of animals are non-ruminants, and ruminants. Ruminant animals include, for example, animals such as sheep, goats, cattle, e.g. beef cattle, cows, and young calves, deer, yank, camel, llama and kangaroo. Non-ruminant animals include mono-gastric animals, e.g. pigs or swine (including, but not limited to, piglets, growing pigs, and sows); poultry such as turkeys, ducks and chicken (including but not limited to broiler chicks, layers); horses (including but not limited to hotbloods, coldbloods and warm bloods), young calves; fish (including but not limited to amberjack, arapaima, barb, bass, bluefish, bocachico, bream, bullhead, cachama, carp, catfish, catla, chanos, char, cichlid, cobia, cod, crappie, dorada, drum, eel, goby, goldfish, gourami, grouper, guapote, halibut, java, labeo, lai, loach, mackerel, milkfish, mojarra, mudfish, mullet, paco, pearlspot, pejerrey, perch, pike, pompano, roach, salmon, sampa, sauger, sea bass, seabream, shiner, sleeper, snakehead, snapper, snook, sole, spinefoot, sturgeon, sunfish, sweetfish, tench, terror, tilapia, trout, tuna, turbot, vendace, walleye and whitefish); and crustaceans (including but not limited to shrimps and prawns). Animal feed: The term “animal feed” refers to any compound, preparation, or mixture suitable for, or intended for intake by an animal. Animal feed for a mono-gastric animal typically comprises concentrates as well as vitamins, minerals, enzymes, direct fed microbial, amino acids and / or other feed ingredients (such as in a premix) whereas animal feed for ruminants generally comprises forage (including roughage and silage) and may further comprise concentrates as well as vitamins, minerals, enzymes direct fed microbial, amino acid and / or other feed ingredients (such as in a premix). Body Weight Gain: The term “body weight gain” means an increase in live weight of an animal during a given period of time e.g. the increase in weight from day 1 to day 21. Composition: The term “composition” refers to a composition comprising a carrier and at least one bacterial strain / enzyme of the present invention. The compositions described herein may be mixed with an animal feed and referred to as a “mash feed.” Concentrates: The term “concentrates” means feed with high protein and energy concentrations, such as fish meal, molasses, oligosaccharides, sorghum, seeds and grains (either whole or prepared by crushing, milling, etc from e.g. corn, oats, rye, barley, wheat), oilseed press cake (e.g. from cottonseed, safflower, sunflower, soybean, rapeseed / canola, peanut or groundnut), palm kernel cake, yeast derived material and distillers grains (such as wet distillers grains (WDS) and dried distillers grains with solubles (DDGS)). Direct Fed Microbial: The term “direct fed microbial” means live micro-organisms including spores which, when administered in adequate amounts, confer a benefit, such as improved digestion or health, on the host. Effective amount / concentration / dosage: The terms “effective amount”, “effective concentration”, or “effective dosage” are defined as the amount, concentration, or dosage of the bacterial strain(s) / enzyme(s) sufficient to improve the digestion or yield of an animal. The actual effective dosage in absolute numbers depends on factors including: the state of health of the animal in question, other ingredients present. The “effective amount”, “effective concentration”, or “effective dosage” of the bacterial strain(s) / enzyme(s) may be determined by routine assays known to those skilled in the art. Feed Conversion Ratio: The term “feed conversion ratio” the amount of feed fed to an animal to increase the weight of the animal by a specified amount. An improved feed conversion ratio means a lower feed conversion ratio. By "lower feed conversion ratio" or "improved feed conversion ratio" it is meant that the use of a feed additive composition in feed results in a lower amount of feed being required to be fed to an animal to increase the weight of the animal by a specified amount compared to the amount of feed required to increase the weight of the animal by the same amount when the feed does not comprise said feed additive composition. Feed efficiency: The term “feed efficiency” means the amount of weight gain per unit of feed when the animal is fed ad-libitum or a specified amount of food during a period of time. By "increased feed efficiency" it is meant that the use of a feed additive composition according the present invention in feed results in an increased weight gain per unit of feed intake compared with an animal fed without said feed additive composition being present. Forage: The term “forage” as defined herein also includes roughage. Forage is fresh plant material such as hay and silage from forage plants, grass and other forage plants, seaweed, sprouted grains and legumes, or any combination thereof. Examples of forage plants are Alfalfa (lucerne), birdsfoot trefoil, brassica (e.g. kale, rapeseed (canola), rutabaga (swede), turnip), clover (e.g. alsike clover, red clover, subterranean clover, white clover), grass (e.g. Bermuda grass, brome, false oat grass, fescue, heath grass, meadow grasses, orchard grass, ryegrass, Timothy-grass), corn (maize), millet, barley, oats, rye, sorghum, soybeans and wheat and vegetables such as beets. Forage further includes crop residues from grain production (such as corn stover; straw from wheat, barley, oat, rye and other grains); residues from vegetables like beet tops; residues from oilseed production like stems and leaves form soy beans, rapeseed and other legumes; and fractions from the refining of grains for animal or human consumption or from fuel production or other industries. Nutrient Digestibility: The term “nutrient digestibility” means the fraction of a nutrient that disappears from the gastro-intestinal tract or a specified segment of the gastro-intestinal tract, e.g. the small intestine. Nutrient digestibility may be measured as the difference between what is administered to the subject and what. comes out in the faeces of the subject, or between what is administered to the subject and what remains in the digesta on a specified segment of the gastro intestinal tract, e.g. the ileum. Nutrient digestibility as used herein may be measured by the difference between the intake of a nutrient and the excreted nutrient by means of the total collection of excreta during a period of time; or with the use of an inert marker that is not absorbed by the animal, and allows the researcher calculating the amount of nutrient that disappeared in the entire gastro-intestinal tract or a segment of the gastro-intestinal tract. Such an inert marker may be titanium dioxide, chromic oxide or acid insoluble ash. Digestibility may be expressed as a percentage of the nutrient in the feed, or as mass units of digestible nutrient per mass units of nutrient in the feed. Nutrient digestibility as used herein encompasses starch digestibility, fat digestibility, protein digestibility, and amino acid digestibility. Energy digestibility as used herein means the gross energy of the feed consumed minus the gross energy of the faeces or the gross energy of the feed consumed minus the gross energy of the remaining digesta on a specified segment of the gastro-intestinal tract of the animal, e.g. the ileum. Metabolizable energy as used herein refers to apparent metabolizable energy and means the gross energy of the feed consumed minus the gross energy contained in the faeces, urine, and gaseous products of digestion. Energy digestibility and metabolizable energy may be measured as the difference between the intake of gross energy and the gross energy excreted in the faeces or the digesta present in specified segment of the gastro-intestinal tract using the same methods to measure the digestibility of nutrients, with appropriate corrections for nitrogen excretion to calculate metabolizable energy of feed. Pellet: The terms “pellet" and / or "pelleting" refer to solid rounded, spherical and / or cylindrical tablets or pellets and the processes for forming such solid shapes, particularly feed pellets and solid extruded animal feed. As used herein, the terms "extrusion" or "extruding" are terms well known in the art and refer to a process of forcing a composition, as described herein, through an orifice under pressure. Poultry: The term “poultry” means domesticated birds kept by humans for the eggs they produce and / or their meat and / or their feathers. Poultry includes broilers and layers. Poultry include members of the superorder Galloanserae (fowl), especially the order Galliformes (which includes chickens, Guineafowls, quails and turkeys) and the family Anatidae, in order Anseriformes, commonly known as "waterfowl" and including domestic ducks and domestic geese. Poultry also includes other birds that are killed for their meat, such as the young of pigeons. Examples of poultry include chickens (including layers, broilers and chicks), ducks, geese, pigeons, turkeys and quail. Roughage: The term “roughage” means dry plant material with high levels of fiber, such as fiber, bran, husks from seeds and grains and crop residues (such as stover, copra, straw, chaff, sugar beet waste). Ruminant: The term “ruminant” means a mammal that digests plant-based food by initially fermenting / degrading it within the animal's first compartment of the stomach, principally through bacterial actions, then regurgitating the semi-digested mass, now known as cud, and chewing it again. The process of re-chewing the cud to further break down plant matter and stimulate digestion is called "ruminating". Examples of ruminants are cattle, cow, beef cattle, young calf, goat, sheep, lamb, deer, yank, camel and llama. Silage: The term “silage” means fermented, high-moisture stored fodder which can be fed to ruminants (cud-chewing animals such as cattle and sheep) or used as a biofuel feedstock for anaerobic digesters. It is fermented and stored in a process called ensilage, ensiling or silaging, and is usually made from grass or cereal crops (e.g. maize, sorghum, oats, rye, timothy etc forage grass plants),) or legume crops like clovers / trefoils, alfalfa, vetches, using the entire green plant (not just the grain). Silage can be made from many field crops, and special terms may be used depending on type (oatlage for oats, haylage for alfalfa). Silage is made either by placing cut green vegetation in a silo, by piling it in a large heap covered with plastic sheet, or by wrapping large bales in plastic film. Spore: The terms “spore” and “endospore” are interchangeable and have their normal meaning which is well known and understood by those of skill in the art. As used herein, the term spore refers to a microorganism in its dormant, protected state. Stable: The term "stable" is a term that is known in the art, and in a preferred aspect, stable is intended to mean the ability of the microorganism to remain in a spore form until it is administered to an animal to improve the health of the animal. Swine: The term “swine” or “pigs” means domesticated pigs kept by humans for food, such as their meat. Swine includes members of the genus Sus, such as Sus scrofa domesticus or Sus domesticus and include piglets, growing pigs, and sows. Vegetable protein: The term “vegetable protein” refers to any compound, preparation or mixture that includes at least one protein derived from or originating from a vegetable, including modified proteins and protein-derivatives. Alkaline phosphatase The term “alkaline phosphatase” means an enzyme having EC number 3.1.3.1 cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA. Coding sequence: The term “coding sequence” means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon, such as ATG, GTG, or TTG, and ends with a stop codon, such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof. Control sequences: The term “control sequences” means nucleic acid sequences involved in regulation of expression of a polynucleotide in a specific organism or in vitro. Each control sequence may be native (i.e., from the same gene) or heterologous (i.e., from a different gene) to the polynucleotide encoding the polypeptide, and native or heterologous to each other. Such control sequences include, but are not limited to leader, polyadenylation, prepropeptide, propeptide, signal peptide, promoter, terminator, enhancer, and transcription or translation initiator and terminator sequences. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide. Expression: The term “expression” means any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion. Expression vector: An "expression vector" refers to a linear or circular DNA construct comprising a DNA sequence encoding a polypeptide, which coding sequence is operably linked to a suitable control sequence capable of effecting expression of the DNA in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome binding sites on the mRNA, enhancers and sequences which control termination of transcription and translation. Extension: The term “extension” means an addition of one or more amino acids to the amino and / or carboxyl terminus of a polypeptide, wherein the “extended” polypeptide has alkaline phosphatase activity. Fragment: The term “fragment” means a polypeptide having one or more amino acids absent from the amino and / or carboxyl terminus of the mature polypeptide, wherein the fragment has alkaline phosphatase activity. Fusion polypeptide: The term “fusion polypeptide” is a polypeptide in which one polypeptide is fused at the N-terminus and / or the C-terminus of a polypeptide of the present invention. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention, or by fusing two or more polynucleotides of the present invention together. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779). A fusion polypeptide can further comprise a cleavage site between the two polypeptides. Upon secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol.3: 568-576; Svetina et al., 2000, J. Biotechnol.76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48. Heterologous: The term "heterologous" means, with respect to a host cell, that a polypeptide or nucleic acid does not naturally occur in the host cell. The term "heterologous" means, with respect to a polypeptide or nucleic acid, that a control sequence, e.g., promoter, of a polypeptide or nucleic acid is not naturally associated with the polypeptide or nucleic acid, i.e., the control sequence is from a gene other than the gene encoding the mature polypeptide. Host Strain or Host Cell: A "host strain" or "host cell" is an organism into which an expression vector, phage, virus, or other DNA construct, including a polynucleotide encoding a polypeptide of interest (e.g., an amylase) has been introduced. Exemplary host strains are microorganism cells (e.g., bacteria, filamentous fungi, and yeast) capable of expressing the polypeptide of interest and / or fermenting saccharides. The term "host cell" includes protoplasts created from cells. Introduced: The term "introduced" in the context of inserting a nucleic acid sequence into a cell, means "transfection", "transformation" or "transduction," as known in the art. Isolated: The term “isolated” means a polypeptide, nucleic acid, cell, or other specified material or component that has been separated from at least one other material or component, including but not limited to, other proteins, nucleic acids, cells, etc. An isolated polypeptide, nucleic acid, cell or other material is thus in a form that does not occur in nature. An isolated polypeptide includes, but is not limited to, a culture broth containing the secreted polypeptide expressed in a host cell. Mature polypeptide: The term “mature polypeptide” means a polypeptide in its mature form following N-terminal and / or C-terminal processing (e.g., removal of signal peptide). Native: The term "native" means a nucleic acid or polypeptide naturally occurring in a host cell. Nucleic acid: The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding a polypeptide. Nucleic acids may be single stranded or double stranded, and may be chemical modifications. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and the present compositions and methods encompass nucleotide sequences that encode a particular amino acid sequence. Unless otherwise indicated, nucleic acid sequences are presented in 5'-to-3' orientation. Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, and which comprises one or more control sequences operably linked to the nucleic acid sequence. Operably linked: The term "operably linked" means that specified components are in a relationship (including but not limited to juxtaposition) permitting them to function in an intended manner. For example, a regulatory sequence is operably linked to a coding sequence such that expression of the coding sequence is under control of the regulatory sequence. Purified: The term “purified” means a nucleic acid, polypeptide or cell that is substantially free from other components as determined by analytical techniques well known in the art (e.g., a purified polypeptide or nucleic acid may form a discrete band in an electrophoretic gel, chromatographic eluate, and / or a media subjected to density gradient centrifugation). A purified nucleic acid or polypeptide is at least about 50% pure, usually at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8% or more pure (e.g., percent by weight or on a molar basis). In a related sense, a composition is enriched for a molecule when there is a substantial increase in the concentration of the molecule after application of a purification or enrichment technique. The term "enriched" refers to a compound, polypeptide, cell, nucleic acid, amino acid, or other specified material or component that is present in a composition at a relative or absolute concentration that is higher than a starting composition. ln one aspect, the term "purified" as used herein refers to the polypeptide or cell being essentially free from components (especially insoluble components) from the production organism. In other aspects. the term "purified" refers to the polypeptide being essentially free of insoluble components (especially insoluble components) from the native organism from which it is obtained. In one aspect, the polypeptide is separated from some of the soluble components of the organism and culture medium from which it is recovered. The polypeptide may be purified (i.e., separated) by one or more of the unit operations filtration, precipitation, or chromatography. Accordingly, the polypeptide may be purified such that only minor amounts of other proteins, in particular, other polypeptides, are present. The term "purified" as used herein may refer to removal of other components, particularly other proteins and most particularly other enzymes present in the cell of origin of the polypeptide. The polypeptide may be "substantially pure", i.e., free from other components from the organism in which it is produced, e.g., a host organism for recombinantly produced polypeptide. In one aspect, the polypeptide is at least 40% pure by weight of the total polypeptide material present in the preparation. In one aspect, the polypeptide is at least 50%, 60%, 70%, 80% or 90% pure by weight of the total polypeptide material present in the preparation. As used herein. a "substantially pure polypeptide" may denote a polypeptide preparation that contains at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% by weight of other polypeptide material with which the polypeptide is natively or recombinantly associated. It is, therefore, preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99% pure, most preferably at least 99.5% pure by weight of the total polypeptide material present in the preparation. The polypeptide of the present invention is preferably in a substantially pure form (i.e., the preparation is essentially free of other polypeptide material with which it is natively or recombinantly associated). This can be accomplished, for example by preparing the polypeptide by well-known recombinant methods or by classical purification methods. Recombinant: The term "recombinant" is used in its conventional meaning to refer to the manipulation, e.g., cutting and rejoining, of nucleic acid sequences to form constellations different from those found in nature. The term recombinant refers to a cell, nucleic acid, polypeptide or vector that has been modified from its native state. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell, or express native genes at different levels or under different conditions than found in nature. The term “recombinant” is synonymous with “genetically modified” and “transgenic”. Recover: The terms "recover" or “recovery” means the removal of a polypeptide from at least one fermentation broth component selected from the list of a cell, a nucleic acid, or other specified material, e.g., recovery of the polypeptide from the whole fermentation broth, or from the cell-free fermentation broth, by polypeptide crystal harvest, by filtration, e.g. depth filtration (by use of filter aids or packed filter medias, cloth filtration in chamber filters, rotary-drum filtration, drum filtration, rotary vacuum-drum filters, candle filters, horizontal leaf filters or similar, using sheed or pad filtration in framed or modular setups) or membrane filtration (using sheet filtration, module filtration, candle filtration, microfiltration, ultrafiltration in either cross flow, dynamic cross flow or dead end operation), or by centrifugation (using decanter centrifuges, disc stack centrifuges, hyrdo cyclones or similar), or by precipitating the polypeptide and using relevant solid-liquid separation methods to harvest the polypeptide from the broth media by use of classification separation by particle sizes. Recovery encompasses isolation and / or purification of the polypeptide. Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter “sequence identity”. For purposes of the present invention, the sequence identity between two amino acid sequences is determined as the output of “longest identity” using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet.16: 276-277), preferably version 6.6.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. In order for the Needle program to report the longest identity, the -nobrief option must be specified in the command line. The output of Needle labeled “longest identity” is calculated as follows: (Identical Residues x 100) / (Length of Alignment – Total Number of Gaps in Alignment) For purposes of the present invention, the sequence identity between two polynucleotide sequences is determined as the output of “longest identity” using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 6.6.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. In order for the Needle program to report the longest identity, the nobrief option must be specified in the command line. The output of Needle labeled “longest identity” is calculated as follows: (Identical Deoxyribonucleotides x 100) / (Length of Alignment – Total Number of Gaps in Alignment) Signal Peptide: A "signal peptide" is a sequence of amino acids attached to the N-terminal portion of a protein, which facilitates the secretion of the protein outside the cell. The mature form of an extracellular protein lacks the signal peptide, which is cleaved off during the secretion process. Subsequence: The term “subsequence” means a polynucleotide having one or more nucleotides absent from the 5' and / or 3' end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having alkaline phosphatase activity. Variant: The term “variant” means a polypeptide having alkaline phosphatase activity comprising a man-made mutation, i.e., a substitution, insertion (including extension), and / or deletion (e.g., truncation), at one or more positions. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding 1-5 amino acids (e.g., 1-3 amino acids, in particular, 1 amino acid) adjacent to and immediately following the amino acid occupying a position. Wild-type: The term "wild-type" in reference to an amino acid sequence or nucleic acid sequence means that the amino acid sequence or nucleic acid sequence is a native or naturally- occurring sequence. As used herein, the term "naturally-occurring" refers to anything (e.g., proteins, amino acids, or nucleic acid sequences) that is found in nature. Conversely, the term "non-naturally occurring" refers to anything that is not found in nature (e.g., recombinant nucleic acids and protein sequences produced in the laboratory or modification of the wild-type sequence). Polypeptides Having Alkaline Phospatase Activity The present invention relates to polypeptides having alkaline phosphatase activity. As can be seen from Table 1, in a preferred embodiment, the polypeptides of the invention have alkaline phosphatase activity, measured as the relative specific activity, which is greater or equal to the activity of the positive control, namely the alkaline phosphatase of US20180326020, which corresponds to SEQ ID NO:50. Accordingly, in one embodiment of the invention, the alkaline phosphatase activity of the polypeptides of the invention is greater or equal to the activity of SEQ ID NO:50. Table 1 SEQ ID NO Relative specific SEQ ID NO Relative specific activity in % activity in % (CIAP = 100%) (CIAP = 100%) SEQ ID NO:50 41.88 SEQ ID NO:50 41.88 SEQ ID NO:11 69.63 SEQ ID NO: 21 170.71 SEQ ID NO: 13 71.19 SEQ ID NO: 37 119.21 SEQ ID NO: 19 84.55 SEQ ID NO: 39 169.18 SEQ ID NO: 20 81.52SEQ ID NO: 82126.64 SEQ ID NO: 29 74.95SEQ ID NO: 83163.70 SEQ ID NO: 36 60.03SEQ ID NO: 84124.41 SEQ ID NO: 61 48.54SEQ ID NO: 85138.35 SEQ ID NO: 63 82.38SEQ ID NO: 86 162.16SEQ ID NO: 65 65.59SEQ ID NO: 95154.69 SEQ ID NO: 82 67.11 SEQ ID NO: 96 152.24 SEQ ID NO: 85 56.06 SEQ ID NO: 97 158.25 SEQ ID NO: 86 46.81 SEQ ID NO: 98 153.45 SEQ ID NO: 99 76.62 SEQ ID NO: 99 143.01 SEQ ID NO: 79 98.69 SEQ ID NO: 100 137.25 SEQ ID NO: 80 61.96 SEQ ID NO: 101 148.96 SEQ ID NO: 82 79.12 SEQ ID NO: 102 122.91 SEQ ID NO: 105 87.32 SEQ ID NO: 103 143.04 SEQ ID NO: 14 121.06SEQ ID NO: 104161.72 SEQ ID NO: 16 101.39SEQ ID NO: 106 138.78In a preferred embodiment, the polypeptide having alkaline phosphatase activity is of bacterial or fungal origin or is a variant of a polypeptide of bacterial or fungal origin, wherein the activity is greater or equal to the activity of SEQ ID NO:50, more preferably a polypeptide of bacterial origin or a variant of a polypeptide of bacterial origin, having alkaline phosphatase activity, wherein the activity is greater or equal to the activity of SEQ ID NO:50. Accordingly, a preferred embodiment of the invention is directed to polypeptides having alkaline phosphatase activity, selected from the group consisting of: (a) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 11; (b) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 13; (c) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 19; (d) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 20; (e) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 29; (f) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 36; (g) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 61; (h) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 63; (i) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 65; (j) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 82; (k) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 85; (l) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 86; (m)a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 99; (n) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 79; (o) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 80; (p) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 116; (q) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 14; (r) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 16; (s) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 21; (t) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 37; (u) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 39; (v) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 82; (w) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 83; (x) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:84; (y) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 85; (z) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 86; (dd) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 96; (ee) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 96; (ff) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 97; (gg) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 98; (hh) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 99; (ii) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 100; (jj) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO:101; (kk) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 102; (ll) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 103; (mm) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 104; and (nn) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 105; and (oo) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 106. In a preferred aspect, the polypeptide has alkaline phosphatase activity wherein the polypeptide is of fungal or bacterial origin and wherein the polypeptide has a greater or equal alkaline phosphatase activity than Calf Intestinal Alkaline Phosphatase (CIAP). Accordingly, within this aspect of the invention, the polypeptides have alkaline phosphatase activity, wherein the polypeptide is of fungal or bacterial origin and wherein the polypeptide is selected from the group consisting of: (a) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 14; (b) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 16; (c) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 21; (d) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 37; (e) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 39; (f) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 82; (g) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 83; (h) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 84; (i) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 85; (j) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 86; (dd) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 95; (ee) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 96; (ff) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 97; (gg) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 98; (hh) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 99; (ii) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 100; (jj) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 101; (kk) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 102; (ll) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 103; (mm) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 104; and (nn) a polypeptide having at at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% to SEQ ID NO: 106. The polypeptide preferably comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85, preferably SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, and SEQ ID NO:106. The polypeptide may have an N-terminal and / or C-terminal extension of one or more amino acids, e.g., 1-5 amino acids. Gastric Stability As stated, an aspect of the invention is directed to polypeptides having alkaline phosphatase activity. In an aspect of the invention, the polypeptides have alkaline phosphatase activity and are gastric stable, that is to say are either stable at low pH or stable at low pH in the presence of pesin (henceforth referred to as pepsin stable). In a preferred embodiment, the polypeptides having alkaline phosphatase activity are both stable at pH below 5 and are pepsin stable. As can be seen from Table 2, neither CIAP nor SEQ ID NO: 50 are pepsin stable. Pepsin stable is intended to mean that the polypeptide retains at least 1% of its activity after treatment to gastric conditions, such as at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, or at least 35% of its activity after a gastric challenge, either at alkaline or acid pH. According, in an aspect of the invention, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, wherein the activity is greater than the activity of SEQ ID NO:50, and wherein the polypeptide is gastric stable or pepsin stable. The activity assay to determine the residual activity of alkaline phosphatase after a gastric challenge involved incubation of a polypeptide of the invention in artificial gastric juice (AGJ) for 15 min at 38 °C to simulate the gastric challenge and is described in detail in Example 8. The residual activity (%) of an ALP after a gastric challenge was determined using Equation 4 Equation 4 is the EC50of an ALP obtained after the 15-minute incubation in AGJ and is the EC50 of an alkaline phosphatase obtained after a 15-minute incubation in assay solution. Table 2 % activity Polypeptide Origin after gastric challenge CIAP Animal 0,0 SEQ ID NO: 50 US20180326020 0,0 SEQ ID NO:18 Fungi 36,7 SEQ ID NO:30 Fungi 47,7 SEQ ID NO:40 Fungi 67,0 SEQ ID NO:42 Fungi 12,4 SEQ ID NO:43 Fungi 5,6 SEQ ID NO:44 Fungi 78,9 SEQ ID NO:45 Fungi 1,1 SEQ ID NO:52 Bacteria 6,0 SEQ ID NO:54 Bacteria 10,4 SEQ ID NO:80 Bacteria 23,8 SEQ ID NO:81 Bacteria 12,8 SEQ ID NO:84 Bacteria 25,6 SEQ ID NO:85 Bacteria 7,1 SEQ ID NO:86 Bacteria 27,6 SEQ ID NO:95 Bacteria 21,4 SEQ ID NO:96 Bacteria 30,9 SEQ ID NO:97 Bacteria 24,1 SEQ ID NO:98 Bacteria 25,8 SEQ ID NO:99 Bacteria 22,2 SEQ ID NO:100 Bacteria 33,1 SEQ ID NO:101 Bacteria 28,9 SEQ ID NO:102 Bacteria 15,4 SEQ ID NO:103 Bacteria 31,4 SEQ ID NO:104 Bacteria 50,2 SEQ ID NO:105 Bacteria 33,5 SEQ ID NO:106 Bacteria 23,2 In a preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, and wherein the polypeptide is pepsin stable such as at least at least 20% of its alkaline phosphatase activity remains after a gastric challenge, more preferably at least 25% activity, such as at least 30% activity, such as at least 40% activity, such as at least 50% activity. In a preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, wherein the polypeptide has at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:80, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105 and SEQ ID NO:106. In a more preferred embodiment, the polypeptide has alkaline phosphatase activity, is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, wherein the polypeptide has at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105 and SEQ ID NO:106. As can be seen from Table 2, variants of SEQ ID NO:11 have high pepsin or gastic stability. That is to say that variants of SEQ ID NO:11 are stable a low pH and stable at low pH in the presence of pepsin. Accordingly, in an embodiment of the invention, the polypeptide having alkaline phospatase actiivty is a variant of SEQ ID NO: 11, having at least 70% sequence identity but less than 100% sequence identity to SEQ ID NO:11. In an embodiment of the invention, the polypeptide has alkaline phosphatase activity and gastric stability and is selected from the group consisting of a) a polypeptide having at least 70% sequence identity but less than 100% sequence identity to SEQ ID NO:11; b) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:61; c) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:62; d) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:63; e) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:64; f) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:65; g) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:79; h) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:80; i) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:81; j) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:82; k) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:83; l) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:84; m) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:85; n) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:86; o) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:95; p) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:96; q) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:97; r) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:98; s) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:99; t) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:100; u) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:101; v) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:102; x) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:103; y) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:104; z) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:105; and aa) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:106. In an embodiment of the invention, the polypeptide has alkaline phosphatase activity and is selected from the group consisting of a) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:61; b) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:62; c) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:63; d) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:64; e) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:65; f) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:79; g) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:80; h) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:81; i) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:82; j) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:83; k) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO 84; l) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:85; m) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:86; n) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:95; o) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:96; p) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:97; q) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:98; r) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:99; s) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:100; t) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:101; u) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:102; v) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO103; x) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:104; y) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:105; and z) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:106. In a most preferred embodiment, the polypeptide has at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:104. In connection to its use in an animal host or body, gastric stability is important and alkaline phosphatase activity at phyiological pH is most relevant for enzymes in animal feed. Accordingly, it is important for the use in animal feed for the polypeptides having alkaline phosphatase activity demonstrate activity at physiological pH, that is to say around pH 7 or 8. In applications other than in animal feed, an activity at pH 7 to 11 is relevant such as in relation to compositions with alkaline ingredients. In one embodiment of the invention, the polypeptides having alkaline phosphatase activity demonstrate an activity at least equal to the activity of CIAP at a pH of 7, 8, 9, 10 or 11, preferably at a pH of 7, 8 or 9, according to the method described in Example 8. The values given for each pH in the range of 7.0 – 11.0 is the absorbance at 405 nm (A405) divided by the phosphatase concentration in ppm (determined by A280 of a purified sample and the calculated Extinction Coefficients of the phosphatase). Table 3- Absorbance at 405 nm (A405) divided by the phosphatase concentration in ppm (determined by A280 of a purified sample and the calculated Extinction Coefficients of the phosphatase). pH7 8 9 10 11CIAP 1,7 1,5 1,7 6,7 7,9 SEQ ID NO: 50 0,4 1,8 6,9 23,8 31,8 SEQ ID NO:11 1,7 4,9 7,2 7,7 18,8 SEQ ID NO:62 0,6 1,2 2,3 4,2 4,7 SEQ ID NO:63 10,3 12,9 25,5 33,7 25,5 SEQ ID NO:64 1,1 3,6 4,4 5,1 11,0 SEQ ID NO:65 1,4 5,5 7,3 12,0 21,8 SEQ ID NO:79 2,5 6,7 11,7 17,1 29,2 SEQ ID NO:80 2,5 5,1 11,4 15,4 18,7 SEQ ID NO:81 2,5 7,0 12,3 15,5 27,9 >40 SEQ ID NO: 82 3,7 8,7 17,8 25,4 SEQ ID NO:83 2,9 8,6 15,3 19,5 31,8 SEQ ID NO:84 3,3 7,4 14,6 18,4 23,1 SEQ ID NO:85 3,0 7,9 14,5 18,0 29,9 >40 SEQ ID NO:86 3,8 11,2 19,2 23,9 >40 SEQ ID NO:95 5,0 16,3 18,6 29,2 SEQ ID NO:96 6,2 17,3 21,4>40>40>40 SEQ ID NO:97 5,0 14,7 19,1 29,4 >40 SEQ ID NO:98 5,1 15,9 20,5 28,1 >40 SEQ ID NO:99 4,9 14,0 17,0 28,6 >40 SEQ ID NO:100 4,8 13,0 17,8 28,8 >40 SEQ ID NO:101 4,8 12,9 19,2 27,6 >40 SEQ ID NO:102 4,4 14,8 18,3 29,1 >40 SEQ ID NO:103 5,0 16,3 20,2 29,4 5,1 SEQ ID NO:35 1,8 3,4 8,3 12,5 5,6 SEQ ID NO:37 0,8 5,1 12,7 9,2 As can bee seen from Table 3, the polypeptides of the invention have significant alkaline phosphatase activity at physiological pH. As can be seen from Example 8, Table 10, Wildtypes SEQ ID NO:50 and SEQ ID NO:11 show no activity after the high gastric stress treatment. However, the prior art variant SEQ ID NO: 107, with a C-terminal histidine or when upconcentrated and HEAL1115_Ct_His) retains part of its activity after gastric stress treatment. SEQ ID NO: 103 shows comparable activity after gastric stress treatment but SEQ ID NO:104 shows both higher activity (73 OD / min / ppm) and higher percent residual activity (12%) compared to SEQ IDNO:107 (21 OD / min / ppm and 6% respectively). As can be seen from Table 10, SEQ ID NO: 11 and the variants of SEQ ID NO:11 have a high activity compared to SEQ ID NO: 50 and SEQ ID NO: 107. Furthermore, the residual activity of this high activity, in percentage, is higher than SEQ ID NO: 50 and SEQ ID NO: 10. This translates that even at comparable residual activity levels, the activity of SEQ ID NO: 11 and the variants of SEQ ID NO:11 after gastric challenge is notably higher. In an embodiment of the invention, the polypeptide has both an activity of at least 250 OD / min / ppm and a percent residual activity of at least 5%, such as at least 7%, such as at least 10% after gastric stress treatment. Thermostability In a preferred aspect of the invention, the polypeptide having alkaline phosphatase activity is thermostable. SEQ ID NO:50 has a Tm at pH 7 of approximately 48°C, as determined by the method according to Example 10. Preferably, the polypeptide having alkaline phosphatase activity has a Tm of at least 50°C at pH of 7, or at a pH of less than 7. More preferably, the polypeptide having alkaline phosphatase activity has a Tm of at least 50°C at pH of 7 and furthermore has a Tm of at least 50°C at pH of 4. In a most preferred embodiment, the polypeptide having alkaline phosphatase activity has a Tm of at least 60°C at pH of 7 and furthermore has a Tm of at least 60°C at pH of 4. In a futher embodiment, the polypeptide having alkaline phosphatase activity has a Tm of at least 70°C at pH of 7. The tables below demonstrates that the polypeptides of the invention have a Tm of at least 70°C at pH of 7, using the nDSF method of Example 10. Table 4 Polypeptide pH 4 pH 5 pH 7 pH 9 SEQ ID NO:3 76,31 79,19 SEQ ID NO:5 66,75 70,88 76,194 SEQ ID NO:11 57,12 62,04 80,34 77,26 SEQ ID NO:14 56,63 66,72 76,367 66,43 SEQ ID NO:16 70,59 77,76 74,85 SEQ ID NO:17 67,83 73,28 79,74 73,20 SEQ ID NO:19 54,92 69,26 76,86 66,31 SEQ ID NO:21 71,32 73,79 75,07 69,18 SEQ ID NO:27 68,11 75,64 78,30 67,23 SEQ ID NO:30 68,54 73,19 71,83 SEQ ID NO:40 76,22 81,51 84,56 78,33 SEQ ID NO:42 77,67 83,58 84,98 81,70 SEQ ID NO:43 68,31 74,03 75,63 69,64 SEQ ID NO:44 67,36 70,57 70,47 63,54 SEQ ID NO:45 62,61 68,39 72,42 67,73 SEQ ID NO:58 52,88 68,05 80,22 68,10 Table 5 Polypeptide / pH 7 Tm SEQ ID NO:61 71,43 SEQ ID NO:63 73,84 SEQ ID NO:64 71,92 SEQ ID NO:65 69,48 SEQ ID NO:79 75,27 SEQ ID NO:80 76,85 SEQ ID NO:81 75,91 SEQ ID NO:82 76,96 SEQ ID NO:83 75,30 SEQ ID NO:84 76,50 SEQ ID NO:85 75,79 SEQ ID NO:86 76,81 SEQ ID NO:95 76,30 SEQ ID NO:96 76,78 SEQ ID NO:97 76,78 SEQ ID NO:98 75,28 SEQ ID NO:99 76,02 SEQ ID NO:100 75,81 SEQ ID NO:103 77,49 SEQ ID NO:104 80,58 SEQ ID NO:105 77,45 SEQ ID NO:106 75,47 As can be seen from Example 11, the polypeptides of the invention have similar or superior thermal stability as the reportedly thermal stability alkaline phosphatase of SEQ ID NO:1 from WO 2023 / 102002, as measured by the thermal shift assay method. Sources of Polypeptides Having Alkaline Phosphatase Activity A polypeptide having alkaline phosphatase activity of the present invention may be obtained from microorganisms of any genus. For purposes of the present invention, the term “obtained from” as used herein in connection with a given source shall mean that the polypeptide encoded by a polynucleotide is produced by the source or by a strain in which the polynucleotide of the invention has been inserted. In one aspect, the polypeptide obtained from a given source is secreted extracellularly. In one aspect, the polypeptide obtained from a genus selected from the group consisting of a Bacillus, a Neobacillus, a Collimonas, an Aeromonas, a Serratia, a Caulobacter, a Loktanella, a Sphingopyxis, a Hyphomonas, and a Deinococcus, typically selected from the group consisting of a Parageobacillus, a Geobacillus, a Sporolactobacillus, an Anoxybacillus, a Paenibacillus, a Collimonas, a Neobacillus, an Aeromonas, a Serratia, a Cytobacillus, a Priestia, a Caulobacter, a Loktanella, a Sphingopyxis, a Fontibacillus, a Bacillus, a Lederbergia, a Hyphomonas, and a Deinococcus, more preferably a Neobacillus, a Bacillus, a Parageobacillus, a Geobacillus, a Sporolactobacillus, an Anoxybacillus, and a Paenibacillus. In a preferred embodiment the polypeptide is obtained from a microorganism selected from the group consisting of Parageobacillus caldoxylosilyticus, Geobacillus thermoleovorans, Sporolactobacillus sp-63357, Anoxybacillus caldiproteolyticus, Geobacillus thermoleovorans, Paenibacillus xylanexedens, Sporolactobacillus sp-63357, Paenibacillus panacisoli, Collimonas pratensis, Paenibacillus illinoisensis, Neobacillus bataviensis, Aeromonas salmonicida subsp. Salmonicida, Paenibacillus amylolyticus, Serratia plymuthica, Cytobacillus firmus, Priestia megaterium, Serratia ficaria, Caulobacter sp-63731, Caulobacter vibrioides, Serratia nematodiphila, Loktanella salsilacus, Sphingopyxis chilensis, Fontibacillus aquaticus, Paenibacillus sp-19179, Paenibacillus sp-62606, Paenibacillus woosongensis, Bacillus lentus (Lederbergia lenta), Paenibacillus sp-62603, Paenibacillus castaneae, Paenibacillus taohuashanense, Hyphomonas hirschiana, Hyphomonas oceanitis, Deinococcus radiodurans, Deinococcus gobiensis, Deinococcus pimensis, and Deinococcus sp-17890. It will be understood that for the aforementioned species, the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamorphs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents. The polypeptides may be identified and obtained from other sources including microorganisms isolated from nature (e.g., soil, composts, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms and DNA directly from natural habitats are well known in the art. A polynucleotide encoding the polypeptide may then be obtained by similarly screening a genomic DNA or cDNA library of another microorganism or mixed DNA sample. Once a polynucleotide encoding a polypeptide has been detected with the probe(s), the polynucleotide can be isolated or cloned by utilizing techniques that are known to those of ordinary skill in the art (see, e.g., Davis et al., 2012, Basic Methods in Molecular Biology, Elsevier). Methods of Production The present invention also relates to methods of producing a polypeptide of the present invention, comprising (a) cultivating a cell, which in its wild-type form produces the polypeptide, under conditions conducive for production of the polypeptide; and optionally, (b) recovering the polypeptide. In one aspect, the cell is a Bacillus cell. In another aspect, the cell is a Bacillus subtilus or a Bacillus clausii cell. In an embodiment of the invention, the method of production is as per Example1, 2, or 3. In an embodiment of the invetion, synthetic fragments were directionally assembled to a Bacillus expression vector as described in WO12 / 025577 by the standard Golden Gate cloning method. In an embodiment, the DNA encoding the mature peptide of the gene was cloned in frame to a Bacillus clausii secretion signal (BcSP; with the following amino acid sequence: MKKPLGKIVASTALLISVAFSSSIASA. In one embodiment, the final expression plasmid (BcSP- His-tag-alkaline phosphatase) was transformed into a Bacillus subtilis expression host. The present invention also relates to methods of producing a polypeptide of the present invention, comprising (a) cultivating a recombinant host cell of the present invention under conditions conducive for production of the polypeptide; and optionally, (b) recovering the polypeptide. The host cell is cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid-state, and / or microcarrier-based fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the polypeptide to be expressed and / or isolated. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates. The polypeptide may be detected using methods known in the art that are specific for the polypeptide, including, but not limited to, the use of specific antibodies, formation of an enzyme product, disappearance of an enzyme substrate, or an assay determining the relative or specific activity of the polypeptide. The polypeptide may be recovered from the medium using methods known in the art, including, but not limited to, collection, centrifugation, filtration, extraction, spray- drying, evaporation, or precipitation. In one aspect, a whole fermentation broth comprising the polypeptide is recovered. In another aspect, a cell-free fermentation broth comprising the polypeptide is recovered. The polypeptide may be purified by a variety of procedures known in the art to obtain substantially pure polypeptides and / or polypeptide fragments (see, e.g., Wingfield, 2015, Current Protocols in Protein Science; 80(1): 6.1.1-6.1.35; Labrou, 2014, Protein Downstream Processing, 1129: 3-10). In an alternative aspect, the polypeptide is not recovered. ALP targets for improving gut health: Lipopolysaccharide (LPS), ATP and Cellular Activity The intestinal activity of alkaline phosphatase is related to intestinal inflammation. ALPs play a in limiting intestinal inflammation by detoxification of MAMPs (Lipopolysaccharide (LPS) and flagellin. IAP exerts its effects through dephosphorylation of proinflammatory molecules including lipopolysaccharide (LPS), flagellin, and adenosine triphosphate (ATP) released from cells during stressful events. ALP dephosphorylates bacterial LPS which leads to LPS detoxification preventing downstream activation of immune cells and subsequent inflammatory responses. Intestinal alkaline phosphatase (IAP) is one of the most abundant human proteins in stools and its activity has been speculated to correlate negatively with type 2 diabetes and intestinal inflammation. IAP has been shown to possess many roles in limiting intestinal inflammation: 1) Detoxification of MAMPs (LPS, flagellin), 2) De-phosphorylation of extracellular ATP, 3) Induction of autophagy 4) bacterial growth inhibition. Without being bound to a particular theory, gut health relies on the microbiome and its co-existence with the host. Introduction of pathogenic bacteria to the microbiome creates a dysbiosis potentially leading to leaking barrier and immune cell activation. Free LPS from the gut bacteria may impose a health risk on the host by activation of immune cells. Especially under already compromized health conditions LPS may more freely enter the tissue and do damage. ATP is produced by some bacteria and has growth inhibitory action on certain other bacteria. Literature indicates that ATP secretion may be more typical for Gram-negative species, whereas growth inhibition is characteristic for Gram-positive bacteria.ATP is produced by immune cells during their activation and by dying cells and functions as an alarm molecule to warn their surroundings to prepare for e.g. infection. This results in the activation of other immune cells adding to the ongoing inflammation. Specifically, ATP activates the inflammasome, which causes release of the pro-inflammatory cytokine IL-1β. During a chronic state of mild intestinal inflammation (which may be the situation in livestock) increased levels of both free LPS and intestinal ATP would add on the inflammatory process and increase risk of disease. An aspect of the invention is directed to detoxification of LPS and / or ATP by ALP mediated de-phosphorylation. This leads to a to decrease in ongoing intestinal inflammation by limiting health risk factors. Potential health benefits include decreased infectious disease, leading to higher survival rates. Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing the immune response in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing inflammation in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of reducing IL or TNF 65esponse in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of preventing colitis or the inflammation of the lining of the colon in an animal, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. Based on cellular data using polypeptides of the invention, an aspect of the invention is directed to a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, said method comprising feeding said animal the polypeptide, the composition, the animal feed additive, or zootechinal additive of the invention. Accordingly, an apect of the invention is directed to the alkaline phosphatases of the invention for use, typically by ATP de-phosphorylation, to maintain gut health including but no limited to maintaining gut barrier function, reducing leaky gut and reducing or preventing intestinal inflammation. Lipopolysaccharides as a target for Alkaline Phosphatase of the invention The intestinal activity of alkaline phosphatase is related to intestinal inflammation. ALPs play a in limiting intestinal inflammation by detoxification of MAMPs (Lipopolysaccharide (LPS), flagellin. IAP exerts its effects through dephosphorylation of proinflammatory molecules including lipopolysaccharide (LPS), flagellin, and adenosine triphosphate (ATP) released from cells during stressful events. Increased LPS stimulation of the intestinal tissue increases inflammation and compromises general health. Lipopolysaccharide (LPS) contains a Lipid A structure, which has two PO4 groups attached. These are essential for binding to TLR4 and MD2 during cell stimulation. In the present invention, LPS de-phosphorylation was measured with the Malachite Green Phosphate Detection kit, which detects free PO4. E. coli LPS was treated with titration of ALP followed by detection of released PO4. Results showed LPS-dephosphorylation by polypeptides having alkaline phosphatase of the invention. One aspect of the invention is directed to an ALP of the invention dephosphorylates bacterial LPS which leads to LPS detoxification thereby preventing downstream activation of immune cells and subsequent inflammatory responses. According, the invention is directed to a method of dephosphorylating bacterial LPS using an ALP of the invention. The invention is also directed to a method of detoxificating LPS by dephosphorylation using using an ALP of the invention. A further aspect of the invention is directed to reducing the activation of immune cells comprising the ingestion of an ALP of the invention. A further aspect of the invention is directed to reducing or preventing an inflammatory response, or reducing or preventing an inflammation in an animal comprising the ingestion of an ALP of the invention. An aspect of the invention is directed to detoxification of LPS through ALP mediated de- phosphorylation. This leads to a to decrease in ongoing intestinal inflammation by limiting health risk factors. Potential health benefits include decreased infectious disease, leading to higher survival rates. Adenosine triphosphate (ATP) as target for Alkaline Phosphatase Cellular Activity as a target for Alkaline Phosphatases of the invention ATP can suppress Gram-positive bacteria growth. ALPS of the invention can eliminate this effect. Suppression of intestinal Gram-positive bacteria favours growth of pathogenic Gram- negatives. Accordingly, ALPs of the invention eliminate the suppressive role of ATP on Gram- positive bacteria. ALP dephosphorylates ATP, thereby promoting commensal bacterial growth. A further aspect of the invention is directed to maintaining or promoting commensal bacterial growth in an animal. A further aspect of the invention is directed to the use of the ALPs of the invention to promote the growth of favourable Gram positive bacteria and / or suppress the growth of pathogenic Gram-negative bacteria. Example 12 shows that Gram-negative and Gram-positive bacteria were grown in presence of ATP, ADP, AMP or adenosine. ALP suppresses ATP-induced LPS activity on IL-1β secretion ATP also plays a role in the activity of LPS in the formation of Pro-IL- 1β. Increased LPS stimulation of the intestinal tissue increases inflammation and compromises general health. In an apect of the invention, an ALP of the invention reduces ATP-induced LPS activity on IL-1β secretion. ALP suppresses ATP induced IL-1β secretion; ALP to suppress inflammation ATP is also involved in activation of the inflammasome, leading to secretion of IL-1β. This is a rapid danger signal that increases inflammation, which is useful during infection but may be harmful under chronic conditions. In Example 14, it is demonstrated that treatment with the ALPs of invention suppresses the ATP induced inflammasome activation. ALP dephosphorylates ATP promoting commensal bacterial growth. Accordingly, an aspect of the invention is directed to supporting or promoting commensal bacterial growth in livestock animals, comprising feeding an animal a polypeptide of the invention. Similarly, a further aspect of the invention is directed a method of suppressing, reducing or preventing inflammation in an animal comprising administering an ALP as defined herein. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation by lowering the levels of IL-1β in an animal comprising administering an ALP as defined herein. A further aspect of the invention is directed to an ALP as defined herein for use in the suppression, reduction or prevention of inflammation in an animal. A further aspect of the invention is directed to ther use of an ALP of the invention for the suppression, prevention or reduction of ALP in an animal. Preferably, the inflammation is chronic or associated with a chronic condition. ALP suppresses TNF-α; ALP to suppress inflammation The inflammasome activating effect of ATP is not a capability held by its de- phosphorylation products ADP, AMP or adenosine. In fact, the inventors have found adenosine possess immunosuppressive potential. The inventors have found that by converting ATP to ADP, AMP or adenosine, ALP suppresses, reduces or prevents inflammation. The inventors have found that the ALPs of the invention suppresses the secretion of IL-8 by means of adenosine suppression of the secretion of IL-8. An increase in the levels of adenosine, the de-phosphorylated product of ATP, led to decreased levels of TNF-α. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation by lowering the levels of TNF-α in an animal comprising administering an ALP as defined herein. Accordingly, an aspect of the invention is directed to a method of suppressing, reducing or preventing inflammation in an animal comprising administering an ALP as defined herein. A further aspect of the invention is directed to an ALP as defined herein for use in the suppression, reduction or prevention of inflammation in an animal. A further aspect of the invention is directed to ther use of an ALP of the invention for the suppression, prevention or reduction of ALP in an animal. Use in Animal Feed A polypeptide having alkaline phosphatase activity of the invention may also be used in animal feed. In an embodiment, the present invention provides a method for preparing an animal feed composition comprising adding one or more polypeptides having alkaline phosphatase activity of the present invention to one or more animal feed ingredients. The polypeptide having alkaline phosphatase activity of the present invention may also be used in animal feed as feed enhancing enzymes that improve feed digestibility to increase the efficiency of its utilization according to WO 00 / 21381 and WO 04 / 026334. In a further embodiment the polypeptides having alkaline phosphatase activity of the present invention may also be used in animal feed as feed enhancing enzymes that improve feed digestibility to increase the efficiency of its utilization according to WO 00 / 21381 and WO 04 / 026334. An aspect of the invention is directed to a use of the polypeptide of the invention for the preparation of a feed additive, a feed composition or a zootechnical additive. In accordance with any methods of the invention, the polypeptide may be administered to an animal, such as a sow, during one or more of the starter phase, the grower phase, and / or the finisher phase. In accordance with any methods of the invention, the polypeptide may be formulated in animal feed, such as a starter feed, a grower feed, or a finisher feed for an animal such as a sow. In accordance with any methods of the invention, the polypeptide may be provided incompositions suitable for oral administration to an animal, comprising an effective amount of an enzyme that reduces the amount of a detrimental compound present in or released from animal waste. The composition may comprise an orally acceptable carrier for the enzyme. In a further embodiment a polypeptide having alkaline phosphatase activity of the present invention may be used as a feed additive, where it may provide a positive effect on the animal’s digestive tract and in this way improve animal performance in accordance to weight gain, feed conversion ratio (FCR), or improved animal health such as decreased mortality rate. FCR is calculated as the feed intake in g / animal relative to the weight gain in g / animal. The one or more polypeptides having alkaline phosphatase activity of the present invention may for example be used to stabilize the healthy microflora of animals, such as ruminants and non-ruminants, in particular livestock such as, but not limited to, sheep, goats, cattle (including, but not limited to, beef cattle, cows, and young calves), deer, pigs or swine (including, but not limited to, piglets, growing pigs, and sows), poultry (including, but not limited to, geese, turkeys, ducks and chicken such as broilers, chicks and layers); horses (including but not limited to hotbloods, coldbloods and warm bloods), moose and rabbits but also in fish (including but not limited to salmon, trout, tilapia, catfish and carps; and crustaceans (including but not limited to shrimps and prawns)) by suppressing growth / intestinal colonization of viral (such as Coronaviridae, Porcine reproductive and respiratory syndrome virus (PRRSV), Persivirus coursing Bovin virus diarre and likewise), parasitic pathogens (coccidian protozoa, Eimeria maxima, Eimeria mitis) or bacterial pathogens such as Clostridium perfringens, Escherichia coli, Campylobacter coli, C. hyointestinalis and C. jejuni, Yersinia ssp., Treponema suis, Brachyspira hyodysenteriae, Lawsonia intracellularis and Salmonella, such as Salmonella enterica, Salmonella Typhimurium and Salmonella Mbandaka. A preferred embodiment is directed to a method of preventing antibiotic-associated infections from Salmonella entericaserovar Typhimurium (S. Typhimurium) and / or Clostridium difficile comprising feeding said animal the polypeptide of the invention, the composition of the invention or the animal feed additive of the invention. In a preferred embodiment a polypeptide having alkaline phosphatase activity is applied to chicken and has activity against Clostridium perfringens. In a further embodiment a polypeptide having alkaline phosphatase activity of the present invention is used as a feed additive, where it may provide a positive effect on the microbial balance of the chicken digestive tract and in this way improve animal performance. The term animal typically refers to livestock, such as swine (e.g., pigs or hogs), sheep, fowl or poultry (e.g., chicken, ducks, turkeys, and geese), cows and other ruminants, buffalo, horses, and aquaculture animals (e.g., fish and shrimp and eels). In accordance with any of methods of the invention, the animal is typically a poultry or swine animal. An aspect of the invention is directed to a method of maintaining or restoring (healthy) gut flora in an antibiotic treated animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of preventing antibiotic-associated infections from E. coli, Salmonella entericaserovar, Typhimurium (S. Typhimurium) and / or Clostridium difficile comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. The polypeptide having alkaline phosphatase activity of the present invention may also be used in animal feed as feed enhancing enzymes that improve feed digestibility to increase the efficiency of its utilization according to WO 00 / 21381 and WO 04 / 026334. In a further embodiment a polypeptide having alkaline phosphatase activity of the present invention may be used as a feed additive, where it may provide a positive effect on the animal’s digestive tract and in this way improve animal performance in accordance to weight gain, feed conversion ratio (FCR), or improved animal health such as decreased mortality rate. FCR is calculated as the feed intake in g / animal relative to the weight gain in g / animal. An aspect of the invention is directed to a method of increasing body weight gain in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. A further aspect of the invention is directed to a method of improving the food conversion ratio (FCR) of an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of preventing weight loss in an infected animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method to prevent low birth weight, such as induced by perinatal undernutrition comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of improving weight gain in animals with below average birth weight comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of regulating fat absorption or neutralising acidic digesta entering the small intestine via stimulation of bicarbonate secretions and surface pH comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An interesting aspect of the invention is directed to a method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method of reducing the immune response in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An interesting aspect of the invention is directed to a method of reducing inflammation in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to reducing IL or TNF respsonse in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. An aspect of the invention is directed to a method to prevent colitis or the inflammation of the lining of the colon in an animal comprising feeding said animal the polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention. In the use or method according to the invention, polypeptide, the composition, the animal feed additive or the zootechnical additive of the invention can be fed to the animal before, after, or simultaneously with the diet. The latter is preferred. For the use in animal feed, however, the polypeptide having alkaline phosphatase activity need not be pure; it may e.g. include other enzymes, in which case it could be termed a polypeptide having alkaline phosphatase activity preparation. The polypeptide having alkaline phosphatase activity composition can be (a) added directly to the feed, or (b) it can be used in the production of one or more intermediate compositions such as feed additives or premixes that is subsequently added to the feed (or used in a treatment process). The degree of purity described above refers to the purity of the original polypeptide having alkaline phosphatase activity preparation, whether used according to (a) or (b) above. The invention further provides methods for reducing the environmental impact of animal waste. In particular, the invention provides methods comprising administering to an animal an enzyme that is effective to reduce the amount of a detrimental compound present in or released from animal waste, and compositions suitable for use in such methods. Also provided is a method for increasing phosphorus digestion in an animal. Animal waste may contain or release one or more compounds that have a detrimental effect, such as a detrimental effect on the animal, on other animals, on humans, or on the environment. One such compound is ammonia (NH 3). Another such compound is phosphorous (P). Atmospheric ammonia can have adverse effects on the environment, as well as on animal production performance, health, and welfare. Ammonia generation and emission in, for example, poultry housing, mostly result from the microbiological decomposition of poultry waste. Ammonia levels as low as 50 ppm can be detrimental to poultry, and such low levels may go unnoticed. Exposure to ammonia at 50 ppm can contribute to 5-10% of birds being runts, and can be associated with a loss of 0.5 pounds of meat per bird and / or a loss of 8 points of feed conversion. There is a need, therefore, for methods of reducing the amount of a detrimental compound present in or released from animal waste, such as for reducing the ammonia and / or the phosphorous content of animal waste. In accordance with some embodiments, there are provided methods for reducing the environmental impact of animal waste, comprising administering to an animal an effective amount of an enzyme that reduces the amount of a detrimental compound present in or released from animal waste. In accordance with some embodiments, there are provided methods for reducing the amount of ammonia in animal waste, comprising administering to an animal an effective amount of an enzyme that reduces the amount of ammonia present in or released from animal waste. In accordance with some embodiments, there are provided methods for reducing the amount of phosphorous in animal waste, comprising administering to an animal an effective amount of an enzyme that reduces the amount of phosphorous present in or released from animal waste. Also provided is a method for increasing phosphorus digestion in an animal, comprising administering an effective amount of alkaline phosphatase to the animal. An aspect of the invention is directed to methods comprising administering to an animal an alkaline phosphatase that is effective to reduce the amount of a detrimental compound present in or released from animal waste, such as ammonia (NH3) or phosphorous (P), and compositions suitable for use in such methods. The methods offer a number of advantages in the context of animal production, including poultry and swine production. In an embodiment, the methods may offer advantages selected from the group consisting of reduced phosphate input into an animal production system, decreased ammonia in animal manure, reduced ventilation air requirements to dilute indoor ammonia concentration in animal housing (and associated energy savings), and reduced need to further treat exhaust air. While not wanting to be bound by any theory, the methods described herein may help animals (such as young broilers) utilize and digest the phosphorus that is present in their diets, which in turn may lead to better growth rate and less nutrient loss through excretion. Additionally, or alternatively, the methods described herein may decrease NH3emission because the enzyme treatments may increase the metabolism and growth of favorable bacterial populations in the intestine, such that more of the excess nitrogen in the diet remains in the manure as bacterial protein instead of uric acid, which is typically degraded and emitted as NH3. Moreover, both the lower pH and lower nitrogen content in manure of treated animals may deter and prevent the formation of gaseous NH 3 in the manure and reduce the NH3 emission. The relationship between pH and degradation of uric acid (the major nitrogen source in poultry manure) has been reported such that a sharp increase in pH may be associated with a decrease in the uric acid content of poultry manure. Elliot & Collins, 1982, Transactions of ASAE 25: 413-24, indicated that high pH in the stored manure would result in the majority of nitrogen loss as NH 3. Additionally, reducing the phosphorus content of animal waste may impact other properties of the manure, such as the bacterial flora. An aspect of the invention is directed to a method of maintaining or protecting intestinal or gut integrity, or reducing intestinal permeability in livestock animals, such as swine and poultry, comprising feeding the animal an animal feed additive comprising a polypeptide of the invention. As discussed, an aspect of the invention is directed to a method of preventing or reducing inflammation of the gastrointestinal tract of an animal. Similarly, an aspect of the invention is directed to a method of preventing or reducing inflammation bowel disease or diarrhea in livestock animals, preferably swine and poultry. A related aspect of the invention is directed to a method of maintaining or improving the intestinal health of livestock animals, such as swine and poultry, comprising feeding the animal an animal feed additive comprising a polypeptide of the invention. A further aspect of the invention is directed to improving the immunity of new born livestock comprising feeding the animal an animal feed additive comprising a polypeptide of the invention. Alkaline phosphatase (ALP) is abundant in raw milk. For livestock being weened away from its mother, feeding the young animal Alkaline phosphatase may be used to improve the immune system of the piglet or other young animals. Accordingly, an aspect of the invention is directed to improving the immunity of new born, weening or post-weening livestock animals comprising feeding the animal an animal feed additive comprising a polypeptide of the invention. Similarly, an aspect of the invention is directed to reducing or preventing allegies immunity of livestock animals comprising feeding the animal an animal feed additive comprising a polypeptide of the invention. Animal Feed and Animal Feed Additives The present invention also relates to animal feed compositions and animal feed additives comprising a polypeptide having alkaline phosphatase activity of the invention. In an embodiment, the animal feed or animal feed additive comprises a formulating agent and a polypeptide of the invention having alkaline phosphatase activity. In a further embodiment, the formulating agent comprises one or more of the following compounds: glycerol, ethylene glycol, 1, 2-propylene glycol or 1, 3-propylene glycol, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate, potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium citrate, dextrin, glucose, sucrose, sorbitol, lactose, starch, kaolin and cellulose. Animal feed compositions or diets have a relatively high content of protein. Poultry and pig diets can be characterised as indicated in Table B of WO 01 / 58275, columns 2-3. Fish diets can be characterised as indicated in column 4 of this Table B. Furthermore, such fish diets usually have a crude fat content of 200-310 g / kg. An animal feed composition according to the invention has a crude protein content of 50-800 g / kg, and furthermore comprises at least one polypeptide having alkaline phosphatase activity as claimed herein. In particular embodiments, the content of metabolisable energy, crude protein, calcium, phosphorus, methionine, methionine plus cysteine, and / or lysine is within any one of ranges 2, 3, 4 or 5 in Table B of WO 01 / 58275 (R.2-5). Crude protein is calculated as nitrogen (N) multiplied by a factor 6.25, i.e. Crude protein (g / kg)= N (g / kg) x 6.25. The nitrogen content is determined by the Kjeldahl method (A.O.A.C., 1984, Official Methods of Analysis 14th ed., Association of Official Analytical Chemists, Washington DC). In a particular embodiment, the animal feed composition of the invention contains at least one vegetable protein as defined above. The animal feed composition of the invention may also contain animal protein, such as Meat and Bone Meal, Feather meal, and / or Fish Meal, typically in an amount of 0-25%. The animal feed composition of the invention may also comprise Dried Distillers Grains with Solubles (DDGS), typically in amounts of 0-30%. In still further particular embodiments, the animal feed composition of the invention contains 0-80% maize; and / or 0-80% sorghum; and / or 0-70% wheat; and / or 0-70% Barley; and / or 0-30% oats; and / or 0-40% soybean meal; and / or 0-25% fish meal; and / or 0-25% meat and bone meal; and / or 0-20% whey. The animal feed may comprise vegetable proteins. In particular embodiments, the protein content of the vegetable proteins is at least 10, 20, 30, 40, 50, 60, 70, 80, or 90% (w / w). Vegetable proteins may be derived from vegetable protein sources, such as legumes and cereals, for example, materials from plants of the families Fabaceae (Leguminosae), Cruciferaceae, Chenopodiaceae, and Poaceae, such as soy bean meal, lupin meal, rapeseed meal, and combinations thereof. In a particular embodiment, the vegetable protein source is material from one or more plants of the family Fabaceae, e.g., soybean, lupine, pea, or bean. In another particular embodiment, the vegetable protein source is material from one or more plants of the family Chenopodiaceae, e.g., beet, sugar beet, spinach or quinoa. Other examples of vegetable protein sources are rapeseed, and cabbage. In another particular embodiment, soybean is a preferred vegetable protein source. Other examples of vegetable protein sources are cereals such as barley, wheat, rye, oat, maize (corn), rice, and sorghum. Animal diets can e.g., be manufactured as mash feed (non-pelleted) or pelleted feed. Typically, the milled feedstuffs are mixed, and sufficient amounts of essential vitamins and minerals are added according to the specifications for the species in question. Enzymes can be added as solid or liquid enzyme formulations. For example, for mash feed a solid or liquid enzyme formulation may be added before or during the ingredient mixing step. For pelleted feed the (liquid or solid) polypeptide having alkaline phosphatase activity / enzyme preparation may also be added before or during the feed ingredient step. Typically, a liquid polypeptide having alkaline phosphatase activity or enzyme preparation comprises the polypeptide having alkaline phosphatase activity of the invention optionally with a polyol, such as glycerol, ethylene glycol or propylene glycol, and is added after the pelleting step, such as by spraying the liquid formulation onto the pellets. The enzyme may also be incorporated in a feed additive or premix. Alternatively, the polypeptide having alkaline phosphatase activity can be prepared by freezing a mixture of liquid enzyme solution with a bulking agent such as ground soybean meal, and then lyophilizing the mixture. In an embodiment, the animal feed or animal feed additive comprises one or more additional enzymes. In an embodiment, the animal feed comprises one or more microbes. In an embodiment, the animal feed comprises one or more vitamins. In an embodiment, the animal feed comprises one or more minerals. In an embodiment, the animal feed comprises one or more amino acids. In an embodiment, the animal feed comprises one or more other feed ingredients. In another embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more additional enzymes. In an embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more microbes. In an embodiment, the animal feed comprises the polypeptide of the invention, one or more formulating agents and one or more vitamins. In an embodiment, the animal feed or animal feed additive comprises one or more minerals. In an embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more amino acids. In an embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more other feed ingredients. In a further embodiment, the animal feed or animal feed additive comprises the polypeptide of the invention, one or more formulating agents and one or more components selected from the list consisting of: one or more additional enzymes; one or more microbes; one or more vitamins; one or more minerals; one or more amino acids; and one or more other feed ingredients. The final enzyme concentration in the diet is within the range of 0.01-200 mg enzyme protein per kg diet, preferably between 0.05-100 mg / kg diet, more preferably 0.1-50 mg, even more preferably 0.2-20 mg enzyme protein per kg animal diet. In a particular embodiment, the animal feed additive of the invention is intended for being included (or prescribed as having to be included) in animal diets or feed at levels of 0.01 to 10.0%; more particularly 0.05 to 5.0%; or 0.2 to 1.0% (% meaning g additive per 100 g feed). This is so in particular for premixes. Alkaline Phosphatase Granules The present invention also relates to enzyme granules / particles comprising a polypeptide of the invention. In an embodiment, the granule comprises a core, and optionally one or more coatings (outer layers) surrounding the core. The core may have a diameter, measured as equivalent spherical diameter (volume based average particle size), of 20-2000 µm, particularly 50-1500 µm, 100-1500 µm or 250-1200 µm. The core diameter, measured as equivalent spherical diameter, can be determined using laser diffraction, such as using a Malvern Mastersizer and / or the method described under ISO13320 (2020). In an embodiment, the core comprises a polypeptide having alkaline phosphatase activity of the present invention. The core may include additional materials such as fillers, fiber materials (cellulose or synthetic fibers), stabilizing agents, solubilizing agents, suspension agents, viscosity regulating agents, light spheres, plasticizers, salts, lubricants and fragrances. The core may include a binder, such as synthetic polymer, wax, fat, or carbohydrate. The core may include a salt of a multivalent cation, a reducing agent, an antioxidant, a peroxide decomposing catalyst and / or an acidic buffer component, typically as a homogenous blend. The core may include an inert particle with the polypeptide absorbed into it, or applied onto the surface, e.g., by fluid bed coating. The core may have a diameter of 20-2000 µm, particularly 50-1500 µm, 100-1500 µm or 250-1200 µm. The core may be surrounded by at least one coating, e.g., to improve the storage stability, to reduce dust formation during handling, or for coloring the granule. The optional coating(s) may include a salt coating, or other suitable coating materials, such as polyethylene glycol (PEG), methyl hydroxy-propyl cellulose (MHPC) and polyvinyl alcohol (PVA). The coating may be applied in an amount of at least 0.1% by weight of the core, e.g., at least 0.5%, at least 1%, at least 5%, at least 10%, or at least 15%. The amount may be at most 100%, 70%, 50%, 40% or 30%. The coating is preferably at least 0.1 µm thick, particularly at least 0.5 µm, at least 1 µm or at least 5 µm. In some embodiments, the thickness of the coating is below 100 µm, such as below 60 µm, or below 40 µm. The coating should encapsulate the core unit by forming a substantially continuous layer. A substantially continuous layer is to be understood as a coating having few or no holes, so that the core unit has few or no uncoated areas. The layer or coating should, in particular, be homogeneous in thickness. The coating can further contain other materials as known in the art, e.g., fillers, antisticking agents, pigments, dyes, plasticizers and / or binders, such as titanium dioxide, kaolin, calcium carbonate or talc. A salt coating may comprise at least 60% by weight of a salt, e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% by weight. To provide acceptable protection, the salt coating is preferably at least 0.1 µm thick, e.g., at least 0.5 µm, at least 1 µm, at least 2 µm, at least 4 µm, at least 5 µm, or at least 8 µm. In a particular embodiment, the thickness of the salt coating is below 100 µm, such as below 60 µm, or below 40 µm. The salt may be added from a salt solution where the salt is completely dissolved or from a salt suspension wherein the fine particles are less than 50 µm, such as less than 10 µm or less than 5 μm. The salt coating may comprise a single salt or a mixture of two or more salts. The salt may be water soluble, in particular, having a solubility at least 0.1 g in 100 g of water at 20°C, preferably at least 0.5 g per 100 g water, e.g., at least 1 g per 100 g water, e.g., at least 5 g per 100 g water. The salt may be an inorganic salt, e.g., salts of sulfate, sulfite, phosphate, phosphonate, nitrate, chloride or carbonate or salts of simple organic acids (less than 10 carbon atoms, e.g., 6 or less carbon atoms) such as citrate, malonate or acetate. Examples of cations in these salts are alkali or earth alkali metal ions, the ammonium ion or metal ions of the first transition series, such as sodium, potassium, magnesium, calcium, zinc or aluminum. Examples of anions include chloride, bromide, iodide, sulfate, sulfite, bisulfite, thiosulfate, phosphate, monobasic phosphate, dibasic phosphate, hypophosphite, dihydrogen pyrophosphate, tetraborate, borate, carbonate, bicarbonate, metasilicate, citrate, malate, maleate, malonate, succinate, lactate, formate, acetate, butyrate, propionate, benzoate, tartrate, ascorbate or gluconate. In particular, alkali- or earth alkali metal salts of sulfate, sulfite, phosphate, phosphonate, nitrate, chloride or carbonate or salts of simple organic acids such as citrate, malonate or acetate may be used. The salt in the coating may have a constant humidity at 20°C above 60%, particularly above 70%, above 80% or above 85%, or it may be another hydrate form of such a salt (e.g., anhydrate). The salt coating may be as described in WO 00 / 01793 or WO 2006 / 034710. Specific examples of suitable salts are NaCl (CH20°C=76%), Na2CO3 (CH20°C=92%), NaNO3 (CH20°C=73%), Na2HPO4 (CH20°C=95%), Na3PO4 (CH25°C=92%), NH4Cl (CH20°C = 79.5%), (NH4)2HPO4 (CH20°C = 93,0%), NH4H2PO4 (CH20°C = 93.1%), (NH4)2SO4 (CH20°C=81.1%), KCl (CH20°C=85%), K2HPO4 (CH20°C=92%), KH2PO4 (CH20°C=96.5%), KNO3 (CH20°C=93.5%), Na2SO4 (CH20°C=93%), K2SO4 (CH20°C=98%), KHSO4 (CH20°C=86%), MgSO4 (CH20°C=90%), ZnSO4 (CH20°C=90%) and sodium citrate (CH25°C=86%). Other examples include NaH2PO4, (NH4)H2PO4, CuSO4, Mg(NO3)2 and magnesium acetate. The salt may be in anhydrous form, or it may be a hydrated salt, i.e., a crystalline salt hydrate with bound water(s) of crystallization, such as described in WO 99 / 32595. Specific examples include anhydrous sodium sulfate (Na2SO4), anhydrous magnesium sulfate (MgSO4), magnesium sulfate heptahydrate (MgSO4.7H2O), zinc sulfate heptahydrate (ZnSO4.7H2O), sodium phosphate dibasic heptahydrate (Na2HPO4.7H2O), magnesium nitrate hexahydrate (Mg(NO3)2(6H2O)), sodium citrate dihydrate and magnesium acetate tetrahydrate. Preferably the salt is applied as a solution of the salt, e.g., using a fluid bed. The coating materials can be waxy coating materials and film-forming coating materials. Examples of waxy coating materials are poly(ethylene oxide) products (polyethyleneglycol, PEG) with mean molar weights of 1000 to 20000; ethoxylated nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluid bed techniques are given in GB 1483591. The granule may optionally have one or more additional coatings. Examples of suitable coating materials are polyethylene glycol (PEG), methyl hydroxy-propyl cellulose (MHPC) and polyvinyl alcohol (PVA). Examples of enzyme granules with multiple coatings are described in WO 93 / 07263 and WO 97 / 23606. The core can be prepared by granulating a blend of the ingredients, e.g., by a method comprising granulation techniques such as crystallization, precipitation, pan-coating, fluid bed coating, fluid bed agglomeration, rotary atomization, extrusion, prilling, spheronization, size reduction methods, drum granulation, and / or high shear granulation. Methods for preparing the core can be found in the Handbook of Powder Technology; Particle size enlargement by C. E. Capes; Vol.1; 1980; Elsevier. Preparation methods include known feed and granule formulation technologies, e.g., (a) Spray dried products, wherein a liquid polypeptide-containing solution is atomized in a spray drying tower to form small droplets which during their way down the drying tower dry to form a polypeptide-containing particulate material. Very small particles can be produced this way (Michael S. Showell (editor); Powdered detergents; Surfactant Science Series; 1998; Vol. 71; pages 140-142; Marcel Dekker). (b) Layered products, wherein the polypeptide is coated as a layer around a pre-formed inert core particle, wherein a polypeptide-containing solution is atomized, typically in a fluid bed apparatus wherein the pre-formed core particles are fluidized, and the polypeptide-containing solution adheres to the core particles and dries up to leave a layer of dry polypeptide on the surface of the core particle. Particles of a desired size can be obtained this way if a useful core particle of the desired size can be found. This type of product is described in, e.g., WO 97 / 23606. (c) Absorbed core particles, wherein rather than coating the polypeptide as a layer around the core, the polypeptide is absorbed onto and / or into the surface of the core. Such a process is described in WO 97 / 39116. (d) Extrusion or pelletized products, wherein a polypeptide-containing paste is pressed to pellets or under pressure is extruded through a small opening and cut into particles which are subsequently dried. Such particles usually have a considerable size because of the material in which the extrusion opening is made (usually a plate with bore holes) sets a limit on the allowable pressure drop over the extrusion opening. Also, very high extrusion pressures when using a small opening increase heat generation in the polypeptide paste, which is harmful to the polypeptide (Michael S. Showell (editor); Powdered detergents; Surfactant Science Series; 1998; Vol. 71; pages 140-142; Marcel Dekker). (e) Prilled products, wherein a polypeptide-containing powder is suspended in molten wax and the suspension is sprayed, e.g., through a rotating disk atomizer, into a cooling chamber where the droplets quickly solidify (Michael S. Showell (editor); Powdered detergents; Surfactant Science Series; 1998; Vol. 71; pages 140-142; Marcel Dekker). The product obtained is one wherein the polypeptide is uniformly distributed throughout an inert material instead of being concentrated on its surface. US 4,016,040 and US 4,713,245 describe this technique. (f) Mixer granulation products, wherein a polypeptide-containing liquid is added to a dry powder composition of conventional granulating components. The liquid and the powder in a suitable proportion are mixed and as the moisture of the liquid is absorbed in the dry powder, the components of the dry powder will start to adhere and agglomerate and particles will build up, forming granulates comprising the polypeptide. Such a process is described in US 4,106,991, EP 170360, EP 304332, EP 304331, WO 90 / 09440 and WO 90 / 09428. In a particular aspect of this process, various high-shear mixers can be used as granulators. Granulates consisting of polypeptide, fillers and binders etc. are mixed with cellulose fibers to reinforce the particles to produce a so-called T-granulate. Reinforced particles, are more robust, and release less enzymatic dust. (g) Size reduction, wherein the cores are produced by milling or crushing of larger particles, pellets, tablets, briquettes etc. containing the polypeptide. The wanted core particle fraction is obtained by sieving the milled or crushed product. Over and undersized particles can be recycled. Size reduction is described in Martin Rhodes (editor); Principles of Powder Technology; 1990; Chapter 10; John Wiley & Sons. (h) Fluid bed granulation. Fluid bed granulation involves suspending particulates in an air stream and spraying a liquid onto the fluidized particles via nozzles. Particles hit by spray droplets get wetted and become tacky. The tacky particles collide with other particles and adhere to them to form a granule. (i) The cores may be subjected to drying, such as in a fluid bed drier. Other known methods for drying granules in the feed or enzyme industry can be used by the skilled person. The drying preferably takes place at a product temperature of from 25 to 90°C. For some polypeptides, it is important the cores comprising the polypeptide contain a low amount of water before coating with the salt. If water sensitive polypeptides are coated with a salt before excessive water is removed, the excessive water will be trapped within the core and may affect the activity of the polypeptide negatively. After drying, the cores preferably contain 0.1-10% w / w water. Non-dusting granulates may be produced, e.g., as disclosed in US 4,106,991 and US 4,661,452 and may optionally be coated by methods known in the art. The granulate may further comprise one or more additional enzymes, e.g., hydrolase, isomerase, ligase, lyase, oxidoreductase, and transferase. The one or more additional enzymes are preferably selected from the group consisting of acetylxylan esterase, acylglycerol lipase, amylase, alpha-amylase, beta-amylase, arabinofuranosidase, cellobiohydrolases, cellulase, feruloyl esterase, galactanase, alpha-galactosidase, beta-galactosidase, beta-glucanase, beta- glucosidase, lysophospholipase, lysozyme, alpha-mannosidase, beta-mannosidase (mannanase), phytase, phospholipase A1, phospholipase A2, phospholipase D, protease, pullulanase, pectin esterase, triacylglycerol lipase, xylanase, beta-xylosidase or any combination thereof. Each enzyme will then be present in more granules securing a more uniform distribution of the enzymes, and also reduces the physical segregation of different enzymes due to different particle sizes. Methods for producing multi-enzyme co-granulates is disclosed in the ip.com disclosure IPCOM000200739D. Another example of formulation of polypeptides by the use of co-granulates is disclosed in WO 2013 / 188331. The present invention also relates to protected polypeptides prepared according to the method disclosed in EP 238216. Liquid Formulations The present invention also relates to liquid compositions comprising a polypeptide of the invention. The composition may comprise an enzyme stabilizer (examples of which include polyols such as propylene glycol or glycerol, sugar or sugar alcohol, lactic acid, reversible protease inhibitor, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid). In some embodiments, filler(s) or carrier material(s) are included to increase the volume of such compositions. Suitable filler or carrier materials include, but are not limited to, various salts of sulfate, carbonate and silicate as well as talc, clay and the like. Suitable filler or carrier materials for liquid compositions include, but are not limited to, water or low molecular weight primary and secondary alcohols including polyols and diols. Examples of such alcohols include, but are not limited to, methanol, ethanol, propanol and isopropanol. In some embodiments, the compositions contain from about 5% to about 90% of such materials. In an aspect, the liquid formulation comprises 20-80% w / w of polyol. In one embodiment, the liquid formulation comprises 0.001-2% w / w preservative. In another embodiment, the invention relates to liquid formulations comprising: (A) 0.001-25% w / w of polypeptide having alkaline phosphatase activity of the present invention; (B) 20-80% w / w of polyol; (C) optionally 0.001-2% w / w preservative; and (D) water. In another embodiment, the invention relates to liquid formulations comprising: (A) 0.001-25% w / w of a polypeptide having alkaline phosphatase activity of the present invention; (B) 0.001-2% w / w preservative; (C) optionally 20-80% w / w of polyol; and (D) water. In another embodiment, the liquid formulation comprises one or more formulating agents, such as a formulating agent selected from the group consisting of polyol, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate, potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium citrate, dextrin, glucose, sucrose, sorbitol, lactose, starch, PVA, acetate and phosphate, preferably selected from the group consisting of sodium sulfate, dextrin, cellulose, sodium thiosulfate, kaolin and calcium carbonate. In one embodiment, the polyols is selected from the group consisting of glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene glycol, 1,2-propylene glycol or 1,3-propylene glycol, dipropylene glycol, polyethylene glycol (PEG) having an average molecular weight below about 600 and polypropylene glycol (PPG) having an average molecular weight below about 600, more preferably selected from the group consisting of glycerol, sorbitol and propylene glycol (MPG) or any combination thereof. In another embodiment, the liquid formulation comprises 20-80% polyol (i.e., total amount of polyol), e.g., 25-75% polyol, 30-70% polyol, 35-65% polyol, or 40-60% polyol. In one embodiment, the liquid formulation comprises 20-80% polyol, e.g., 25-75% polyol, 30-70% polyol, 35-65% polyol, or 40-60% polyol, wherein the polyol is selected from the group consisting of glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene glycol, 1,2-propylene glycol or 1,3-propylene glycol, dipropylene glycol, polyethylene glycol (PEG) having an average molecular weight below about 600 and polypropylene glycol (PPG) having an average molecular weight below about 600. In one embodiment, the liquid formulation comprises 20-80% polyol (i.e., total amount of polyol), e.g., 25-75% polyol, 30-70% polyol, 35-65% polyol, or 40-60% polyol, wherein the polyol is selected from the group consisting of glycerol, sorbitol and propylene glycol (MPG). In another embodiment, the preservative is selected from the group consisting of sodium sorbate, potassium sorbate, sodium benzoate and potassium benzoate or any combination thereof. In one embodiment, the liquid formulation comprises 0.02-1.5% w / w preservative, e.g., 0.05-1% w / w preservative or 0.1-0.5% w / w preservative. In one embodiment, the liquid formulation comprises 0.001-2% w / w preservative (i.e., total amount of preservative), e.g., 0.02- 1.5% w / w preservative, 0.05-1% w / w preservative, or 0.1-0.5% w / w preservative, wherein the preservative is selected from the group consisting of sodium sorbate, potassium sorbate, sodium benzoate and potassium benzoate or any combination thereof. In another embodiment, the liquid formulation further comprises one or more additional enzymes, e.g., hydrolase, isomerase, ligase, lyase, oxidoreductase, and transferase. The one or more additional enzymes are preferably selected from the group consisting of acetylxylan esterase, acylglycerol lipase, amylase, alpha-amylase, beta-amylase, arabinofuranosidase, cellobiohydrolases, cellulase, feruloyl esterase, galactanase, alpha-galactosidase, beta- galactosidase, beta-glucanase, beta-glucosidase, lysophospholipase, lysozyme, alpha- mannosidase, beta-mannosidase (mannanase), phytase, phospholipase A1, phospholipase A2, phospholipase D, protease, pullulanase, pectin esterase, triacylglycerol lipase, xylanase, beta- xylosidase or any combination thereof. Preferred embodiments An animal feed additive comprising a polypeptide, said polypeptide having alkaline phosphatase activity, selected from the group consisting of: (a) a polypeptide having at least 70% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, and SEQ ID NO:106. (b) a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a) (c) a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a) or (b) (d) a polypeptide derived from a polypeptide of (a) or (c), or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids; (e) a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C-terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and (f) a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity activity. 2. The animal feed additive comprising the polypeptide polypeptide according to paragraph 1, having alkaline phosphatase activity, wherein the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a polypeptide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, and SEQ ID NO:106. 3. The animal feed additive according to any of paragraphs 1 or 2, wherein the polypeptide is gastric stable or pepsin stable. 4. The animal feed additive according to any of paragraphs 1 to 3, wherein said polypeptide has a relative activity greater than calf intestinal alkaline phosphatase. 5. The animal feed additive according to any of paragraphs 1 to 4, wherein said polypeptide is thermostable such that the polypeptide has Tm of at least 70°C at pH of 7. 6. The animal feed additive according to any of paragraphs 1 to 5, wherein the polypeptide has an activity at least equal to the activity of calf intestinal alkaline phosphatase at a pH of 7, 8, 9, 10 or 11, preferably at a pH of 7, 8 or 9, more preferably at pH 7. 7. The animal feed additive according to paragraph 1 to 6, as an aqueous solution comprising the polypeptide as defined in any of paragraphs 1 or 2 or is a suspension comprising the polypeptide as defined in any of paragraphs 1 or 2 in suspended form, or is a granule comprising the polypeptide as defined in any of paragraphs 1 or 2 8. The animal feed additive according to paragraph 1 to 6 further comprising at least one fat soluble vitamin, and / or at least one water soluble vitamin, and / or at least one trace mineral. 9. A method of increasing body weight gain in an animal comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 10. A method of improving the food conversion ratio of an animal comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 11. A method of the detoxification of lipopolysaccharide in an animal feeding said animal the animal feed additive of paragraphs 1 to 8. 12. A method of reducing the immune response in an animal comprising feeding said animal the animal feed additive of paragraphs 1 to 8.. 13. A method of reducing inflammation in an animal comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 14. A method of reducing IL or TNF respsonse in an animal comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 15. A method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 16. A method for the maintenance of an effective gut barrier comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 17. A method to prevent colitis or the inflammation of the lining of the colon in an animal comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 18. A method to prevent low birth weight, such as induced by perinatal undernutrition comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 19. A method of improving weight gain in animals with below average birth weight comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 20. A method of regulating fat absorption or neutralising acidic digesta entering the small intestine via stimulation of bicarbonate secretions and surface pH comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 21. A method of preventing antibiotic-associated infections from Salmonella or Clostridium, such as Salmonella entericaserovar Typhimurium (S. Typhimurium) and / or Clostridium difficile comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 22. An aspect of the invention is directed to a method of preventing weight loss in an infected animal comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 23. A method of maintaining or restoring (healthy) gut flora in an antibiotic treated animal comprising feeding said animal the polypeptide as defined in any of paragraphs 1 to 10, the composition according to any of paragraphs 11 to 13, or the animal feed additive of paragraph 24. A method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, comprising feeding said animal the animal feed additive of paragraphs 1 to 8. 25. A granule, which comprises: (a) a core comprising the polypeptide defined by any any of paragraphs 1 to 7 and optionally, (b) a coating consisting of one or more layer(s) surrounding the core. 26. A granule, which comprises: (a) a core, and (b) a coating consisting of one or more layer(s) surrounding the core, wherein the coating comprises the polypeptide defined in any of paragraphs 1 to 7. 27. A liquid composition comprising the polypeptided defined of any of paragraphs 1 to 7 and an enzyme stabilizer, e.g., a polyol such as propylene glycol or glycerol, sugar or sugar alcohol, lactic acid, reversible protease inhibitor, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid). The present invention is further described by the following examples that should not be construed as limiting the scope of the invention. EXAMPLES Example 1: Cloning, expression and fermentation of fungal ALP Materials and Methods Strains Escherichia coli Top-10 strain purchased from TIANGEN (TIANGEN Biotech Co. Ltd., Beijing, China) was used to propagate our expression vector. Aspergillus oryzae strain MT3568 (described in WO2015040159) was used for heterologous expression of the genes described in Table 6. Aspergillus oryzae strain DAU785 (described in WO2018 / 113745) was used for heterologous expression of the genes described in the Table 7. Media Dap4C medium was composed of 11 g MgSO4·7H2O, 1 g KH2PO4, 2.2 g Citric acid·H2O, 20 g glucose, 10 g maltose, 5.2 g K3PO4·H2O, 0.5 g yeast extract, 1.25 g CaCO3, 0.5 ml AMG Trace element solution and deionized water to 1 liter. After autoclave, 3.3 ml of 20% Lactic Acid (autoclaved) and 9.3 ml of 50% (NH4)2HPO4 (sterile filtered) were added to every 400 ml above medium. AMG Trace element solution was composed of 6.8 g ZnCl2, 2.5 g CuSO4.5H2O, 0.24 g NiCl2·5H2O, 13.9 g FeSO4.7H2O, 13.6 g MnSO4.5H2O, 3 g Citric acid·H2O, and deionised water to 1000 ml. LB plates were composed of 10 g of Bacto-tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15g of Bacto-agar, and deionised water to 1000 ml. LB medium was composed of 10g of Bacto- tryptone, 5 g of yeast extract, and 5 g of sodium chloride, and deionised water to 1000 ml. COVE sucrose plates were composed of 342 g of sucrose, 20 g of agar powder, 20 ml of COVE salt solution, and deionized water to 1 liter. The medium was sterilized by autoclaving at 15 psi for 15 minutes. For the transformation of MT3568, 10 mM acetamide was added, when the medium was cooled to 60°C. For the transformation of Dau785, simply add 10ml of 1M NaNO3instead of acetamide. TOP agar was composed of 6g SeaKem GTG agarose, 20ml of COVE salt solution, 342g sucrose in a final volume of 1L with ddH2O. After autoclaving, add 10ml of 1M Acetamide for the transformation selection of MT3568 or add 10ml of 1M NaNO3for the transformation selection of Dau785. COVE-2 plate / tube for isolation: 30 g / L sucrose, 20 ml / L COVE salt solution, 10 mM acetamide (for transformation of MT3568) or 10mM NaNO3 (for transformation of Dau785), 30 g / L noble agar (Difco, Cat#214220). COVE salt solution was composed of 26 g of MgSO4·7H2O, 26g of KCL, 76g of KH2PO4, 50 ml of COVE trace metal solution, and deionised water to 1000 ml. COVE trace metal solution was composed of 0.04g of Na2B4O7·10H2O, 0.4g of CuSO4·5H2O, 0.8g of FeSO4·7H2O, 0.8g of MnSO4·H2O, 0.8g of Na2MoO4·2H2O, 8g of ZnSO4·7H2O, and deionised water to 1000 ml. The alkaline phosphatase (ALP) genes derived from fungal strains isolated from environmental samples by standard microbiological isolation techniques. Strains were identified, and taxonomy was assigned based on DNA sequencing of the ITS (Table 6 and Table 7). Table 6: SEQ ID Donor scientific name Source country SEQ ID NO: 27Sporormia fimetariaChinaSEQ ID NO: 28 United States; California, Thermoascus crustaceus CBS181.67 SEQ ID NO: 29Thermocarpiscus australiensisAustralia, CBS493.74SEQ ID NO: 30Thermochaetoides thermophilaUnited Kingdom, CBS144.50SEQ ID NO: 31Aspergillus sp. XZ2669ChinaSEQ ID NO: 32Colletotrichum sp-53045ChinaTable 7: SEQ ID Donor scientific name Source country SEQ ID NO: 40Tolypocladium sp. XZ2657ChinaSEQ ID NO: 41Penicillium vasconiaeChinaSEQ ID NO: 42Cladobotryum sp.ChinaSEQ ID NO: 43Taifanglania sp. ZY039ChinaSEQ ID NO: 44Achaetomium sp. ZY150ChinaSEQ ID NO: 45Chaetomium sp. ZY474ChinaChromosomal DNA from individual strains (Table 6 and Table 7) was isolated by DNeasy®Plant Maxi Kit (Qiagen, Hilden, Germany).5 µg of chromosomal DNA were sent for full genome sequencing using Illumina technology. Genome sequencing, the subsequent assembly of reads and the gene discovery (i.e. annotation of gene functions) is known to the person skilled in the art and the service can be purchased commercially. The genome sequences were analyzed for putative ALP from the PFAM database families PF00245. This analysis identified genes encoding putative ALP, which were subsequently cloned and recombinantly expressed in Aspergillus oryzae. The ALP genes were amplified by PCR respectively from above isolated genomic DNA. The purified PCR product was cloned into the previously digested pCaHj505 (for the genes listed in Table 1) or pDAU724 (for the genes listed in Example 2) by ligation with an IN-FUSION™ CF Dry-down Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer's instructions. The ligation mixture was used to transform E. coli TOP10 chemically competent cells (described in Strains). Colonies containing the corresponding ALP genes were selected and verified by DNA sequencing (by SinoGenoMax Company Limited, Beijing, China). The correct ALP containing colony was cultivated overnight in 3 ml of LB medium supplemented with 100 µg of ampicillin per ml. Plasmid DNA was purified using a Qiagen Spin Miniprep kit (Cat. 27106) (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions. Protoplasts of Aspergillus oryzae MT3568 were prepared according to WO95 / 002043. Protoplasts of Aspergillus oryzae DAU785 were prepared according to WO2018 / 113745.100 µl of protoplasts were mixed with 2.5-10 µg of the Aspergillus expression vector (above extracted plasmid) comprising the ALP gene and 250 µl of 60% PEG 4000, 10mM CaCl2, and 10mM Tris- HCl pH7.5 and gently mixed. The mixture was incubated at 37°C for 30 minutes and the protoplasts were spread onto COVE sucrose plates for selection. After incubation for 4-7 days at 37°C spores of 4 transformants were inoculated into 3 ml of Dap4C medium. After 3 days cultivation at 30°C, the culture broths were analyzed by SDS-PAGE using Novex® 4-20% Tris-Glycine Gel (Invitrogen Corporation, Carlsbad, CA, USA) to identify the transformants producing the largest amount of recombinant ALP with respective estimated mature peptide size. Spores of the best expressed transformant were spread on COVE-2 plates for re-isolation in order to isolate single colonies. Then a single colony was spread on a COVE-2 tube until sporulation. Spores from the best expressed transformant were cultivated in 1600-2400 ml of Dap4C medium in shake flasks during 3 days at a temperature of 30°C under 80 rpm agitation. Culture broth was harvested by filtration using a 0.22 µm filter device. The filtered fermentation broth was used for enzyme characterization. Example 2: Cloning and expression of bacterial alkaline phosphatase polypeptides Examples of the polypeptide having alkaline phosphatases of bacterial, annotated with the IPR001952 domain as defined in the InterPro database (Blum et al., 2021; Nucleic Acids Research, D344-D354) were identified from either isolated bacterial strains or metagenomes subjected to full genome Next Generation Sequencing or from public databases (Table 9). Table 9: SEQ ID Bacterial donor strain Country of origin SEQ ID NO:1Parageobacillus caldoxylosilyticusUnited KingdomSEQ ID NO:2Geobacillus thermoleovoransItalySEQ ID NO:3Sporolactobacillus sp-63357DenmarkSEQ ID NO:4Anoxybacillus caldiproteolyticusDenmarkSEQ ID NO:5Geobacillus thermoleovoransUnited StatesSEQ ID NO:6Paenibacillus xylanexedensDenmarkSEQ ID NO:7Sporolactobacillus sp-63357SwedenSEQ ID NO:8Paenibacillus panacisoliBermudaSEQ ID NO:9Collimonas pratensisDenmarkSEQ ID NO:10Paenibacillus illinoisensisUnited StatesSEQ ID NO:11Neobacillus bataviensisUnited StatesSEQ ID NO:12Aeromonas salmonicidaIcelandSEQ ID NO:13Paenibacillus amylolyticusRussian FederationSEQ ID NO:14Serratia plymuthicaDenmarkSEQ ID NO:15 Cytobacillus firmus United States SEQ ID NO:15Priestia megateriumDenmarkSEQ ID NO:20Serratia ficariaUnited StatesSEQ ID NO:21metagenomeUnited States SEQ ID NO:22metagenomeDenmarkSEQ ID NO:23metagenomeDenmarkSEQ ID NO:24metagenomeDenmarkSEQ ID NO:25metagenomeGermany SEQ ID NO:26metagenomeGermanySEQ ID NO:33metagenomeDenmarkSEQ ID NO:34metagenomeChinaSEQ ID NO:35Caulobacter sp-63731United StatesSEQ ID NO:36Caulobacter vibrioidesUnited StatesSEQ ID NO:37Serratia nematodiphilaBrazilSEQ ID NO:38Loktanella salsilacusNorwaySEQ ID NO:39Sphingopyxis chilensisDenmarkSEQ ID NO:46Fontibacillus aquaticusDenmarkSEQ ID NO:47Paenibacillus sp-19179DenmarkSEQ ID NO:48Paenibacillus sp-62606SwedenSEQ ID NO:49Paenibacillus woosongensisDenmarkSEQ ID NO:50Lederbergia lenta (public)UnknownSEQ ID NO:51MetagenomeSpainSEQ ID NO:52Paenibacillus sp-62603United StatesSEQ ID NO:53Paenibacillus castaneaeUnited StatesSEQ ID NO:54Paenibacillus taohuashanenseUnited StatesSEQ ID NO:55Hyphomonas hirschiana (public)Unknown isolated 1979SEQ ID NO:56Hyphomonas oceanitis (public)Unknown isolated 1979SEQ ID NO:57Deinococcus radiodurans (public)Unknown isolated before 1990SEQ ID NO:58Deinococcus gobiensis (public)ChinaSEQ ID NO:59Deinococcus pimensis (public)United StatesSEQ ID NO:60Deinococcus sp-17890United StatesThe DNA encoding sequences of the alkaline phosphatase mature peptides were ordered as synthetic genes at Twist Bioscience. The synthetic DNA fragments were directionally assembled to a Bacillus expression vector described in WO12 / 025577 by the standard Golden Gate cloning method using BsaI and T4 DNA ligase enzymes. Briefly, the DNA encoding the mature peptide of the gene was cloned in frame to a Bacillus clausii secretion signal (BcSP; with the following amino acid sequence: MKKPLGKIVASTALLISVAFSSSIASA (SEQ ID NO: E). BcSP replaced the native secretion signal in the gene. Downstream of the BcSP sequence, an affinity tag sequence was introduced to ease the purification process (His-tag; with the following amino acid sequence: HHHHHHPR (SEQ ID NO: F). The gene that was expressed therefore comprised the BcSP sequence followed by the His-tag sequence followed by the mature wild type alkaline phosphatase gene sequence. The final expression plasmid (BcSP-His-tag-alkaline phosphatase) was transformed into a Bacillus subtilis expression host. The alkaline phosphatase BcSP-fusion gene was integrated by homologous recombination into the Bacillus subtilis host cell genome upon transformation. The gene construct was expressed under the control of a triple promoter system (as described in WO 99 / 43835). The gene coding for chloramphenicol acetyltransferase was used as marker (as described in Diderichsen et al., 1993, Plasmid 30: 312-315)). Transformants were selected on LB media agar supplemented with 6 microgram of chloramphenicol per ml. One recombinant Bacillus subtilis clone containing the alkaline phosphatase expression construct was selected and was cultivated on a rotary shaking table in 500 ml baffled Erlenmeyer flasks each containing 100 ml yeast extract-based media. After 3 days cultivation time at 30 °C, the enzyme containing supernatant was harvested by centrifugation and the enzyme was purified by His-tag purification. Example 3: Cloning and expression of fungal ALPs Sequences SEQ ID NO:17 from Trichoderma citrinoviride SEQ ID NO: 18 from Truncatella angustata SEQ ID NO: 19 Morchella semilibera Cloning and expression of SEQ ID NO:17 from Trichoderma citrinoviride Strains Escherichia coli Top-10 strain purchased from Invitrogen (Life Technologies, Carlsbad, CA, USA) was used to propagate our expression vectors encoding for alkaline phosphatase polypeptides. Aspergillus oryzae strain MT3568 was used for heterologous expression of the alkaline phosphatase polypeptide encoding sequences. A. oryzae MT3568 is an amdS (acetamidase) disrupted gene derivative of Aspergillus oryzae JaL355 (WO 2002 / 40694) in which pyrG auxotrophy was restored by disrupting the A. oryzae acetamidase (amdS) gene with the pyrG gene. Media DAP4C-1 medium was composed of 0.5g yeast extract, 15g Maltodextrin, 15g Glucose, 11g magnesium sulphate heptahydrate, 1g dipotassium phosphate, 2g citric acid monohydrate, 5.2g potassium phosphate tribasic monohydrate, 1mL Dowfax 63N10 (antifoaming agent), 2.5g calcium carbonate, supplemented with 1mL KU6 metal solution, and deionised water to 1000mL. KU6 metal solution was composed of 6.8g ZnCl2, 2.5g CuSO4.5H2O, 0.13 g NiCl2, 13.9g FeSO4.7H2O, 8.45g MnSO4.H2O, 3g C6H8O7.H2O, and deionised water to 1000mL. YP 2% glucose medium was composed of 10g yeast extract, 20g Bacto-peptone, 20g glucose, and deionised water to 1000mL. LB plates were composed of 10g of Bacto-tryptone, 5g of yeast extract, 10g of sodium chloride, 15g of Bacto-agar, and deionised water to 1000 mL. LB medium was composed of 10g of Bacto-tryptone, 5g of yeast extract, and 10g of sodium chloride, and deionised water to 1000mL. COVE-Sucrose-T plates were composed of 342g of sucrose, 20g of agar powder, 20mL of COVE salt solution, and deionised water to 1000mL. The medium was sterilized by autoclaving at 15psi for 15 minutes (Bacteriological Analytical Manual, 8th Edition, Revision A, 1998). The medium was cooled to 60°C and 10mM acetamide, Triton X-100 (50µL / 500mL) were added. COVE-N-Agar tubes were composed of 218g Sorbitol, 10g Dextrose, 2.02g KNO3, 25g agar, 50mL Cove salt solution, and deionised water up to 1000mL. COVE salt solution was composed of 26g of MgSO4·7H2O, 26g of KCL, 26g of KH2PO4, 50mL of COVE trace metal solution, and deionised water to 1000mL. COVE trace metal solution was composed of 0.04g of Na2B4O7·10H2O, 0.4g of CuSO4·5H2O, 1.2g of FeSO4·7H2O, 0.7g of MnSO4·H2O, 0.8g of Na2MoO4·2H2O, 10g of ZnSO4·7H2O, and deionised water to 1000mL. The SEQ ID NO:17 polypeptide coding sequence was cloned from Trichoderma citrinoviride DNA by PCR. Trichoderma citrinoviride was cultivated in 100 ml of YP + 2% glucose medium in 1000 ml Erlenmeyer shake flasks for 5 days at 20ºC. Mycelia were harvested from the flasks by filtration of the medium through a Buchner vacuum funnel lined with MIRACLOTH® (EMD Millipore, Billerica, MA, USA). Mycelia were frozen in liquid nitrogen and stored at -80C until further use. Genomic DNA was isolated using a DNEASY® Plant Maxi Kit (QIAGEN GMBH, Hilden Germany) according to the manufacturer’s instructions. Genomic sequence information was generated by Illumina MySeq (Illumina Inc., San Diego, CA).5 µgs of the isolated Trichoderma citrinoviride genomic DNA was used for library preparation and analysis according to the manufacturer’s instructions. A 300 bp, paired end strategy was employed with a library insert size of 200-500 bp. The reads were subsequently fractionated to 25% followed by trimming (extracting longest sub-sequences having Phred- scores of 10 or more). These reads were assembled using Idba version 0.18. Contigs shorter than 200 bp were discarded. Genes were called using GeneMark.hmm ES version 2.3c and identification of the catalytic domain was made using " Alk_Phosphatase PF00245 " Hidden Markov Model provided by Pfam. The polypeptide coding sequence for the entire coding region was cloned from Trichoderma citrinoviride genomic DNA by PCR using the primers (SEQ ID NO: A and SEQ ID NO: B) described below. 5’-ACACAACTGGGGATCCACCATGATTGCCAAGCTCGGA-3’ (SEQ ID NO: A) 5’-AGATCTCGAGAAGCTTACTAGTAGCTCTCCTTGCC-3’ (SEQ ID NO: B) Bold letters represent Trichoderma citrinoviride enzyme coding sequence. Restriction sites are underlined. The sequence to the left of the restriction sites is homologous to the insertion sites of pDau109 (WO 2005 / 042735). In-Fusion™ Advantage PCR Cloning Kit Cat. nr 639620 The amplification reaction (50 µl) was performed according to the manufacturer’s instructions (Thermo Scientific) with the following final concentrations: 1X Phusion HC buffer 200uM dNTP 2.0 mM MgCl2 0.5uM of each primer of SEQ ID NO: 3 + 4 10ng of Trichoderma citrinoviride genomic DNA. The PCR reaction was incubated in a DYAD® Dual-Block Thermal Cycler (BioRad, USA) programmed for 1 cycle at 98°C for 30 seconds; 30 cycles each at 98°C for 10 seconds, 57°C for 20 seconds and 72°C for two minutes followed by 1 cycle at 72°C for 5 minutes. Samples were cooled to 10°C before removal and further processing. Five µl of the PCR reaction were analyzed by 1% agarose gel electrophoresis using 40 mM Tris base, 20 mM sodium acetate, 1 mM disodium EDTA (TAE) buffer. A major band of about 2,3 kb was observed. The remaining PCR reaction was purified directly with an ILLUSTRA™ GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer's instructions. Two µg of plasmid pDau109 was digested with Bam HI and Hind III and the digested plasmid was run on a 1% agarose gel using 50 mM Tris base-50 mM boric acid-1 mM disodium EDTA (TBE) buffer in order to remove the stuffer fragment from the restricted plasmid. The bands were visualized by the addition of SYBR® Safe DNA gel stain (Life Technologies Corporation, Grand Island, NY, USA) and use of a 470 nm wavelength transilluminator. The band corresponding to the restricted plasmid was excised and purified using an ILLUSTRA™ GFX™ PCR DNA and Gel Band Purification Kit. The plasmid was eluted into 10 mM Tris pH 8.0 and its concentration adjusted to 20 ng per µl. An IN-FUSION® PCR Cloning Kit (Clontech Laboratories, Inc., Mountain View, CA, USA) was used to clone the 2.3 kb PCR fragment into pDau109 digested with Bam HI and Hind III (20 ng). The IN-FUSION® total reaction volume was 10 µl. The IN-FUSION® total reaction volume was 10 µl. The IN-FUSION® reaction was transformed into FUSION-BLUE™ E. coli cells (Clontech Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer’s protocol and plated onto LB agar plates supplemented with 50 µg of ampicillin per ml. After incubation overnight at 37°C, transformant colonies were observed growing under selection on the LB plates supplemented with 50 µg of ampicillin per ml. Several colonies were selected for analysis by colony PCR using the pDau222 pDau109 vector primers described below. Four colonies were transferred from the LB plates supplemented with 50 µg of ampicillin per ml with a yellow inoculation pin (Nunc A / S, Denmark) to new LB plates supplemented with 50 µg of ampicillin per ml and incubated overnight at 37°C. Primer 8653: 5’-GCAAGGGATGCCATGCTTGG-3’ (SEQ ID NO: C) Primer 8654: 5’-CATATAACCAATTGCCCTC-3’ (SEQ ID NO: D) Each of the three colonies were transferred directly into 200 µl PCR tubes composed of 5 µl of 2X Thermo Scientific Dream Taq™ PCR Master Mix (Thermo Fisher Scientific, Rockford, IL, USA), 0.5 µl of primer 8653 (10 pm / µl), 0.5 µl of primer 8654 (10 pm / µl), and 4 µl of deionized water. Each colony PCR was incubated in a DYAD® Dual-Block Thermal Cycler programmed for 1 cycle at 94°C for 60 seconds; 30 cycles each at 95°C for 30 seconds, 60°C for 45 seconds, 72ºC for 120 seconds, 68ºC for 10 minutes, and 10°C for 10 minutes. Four µl of each completed PCR reaction were submitted to 1% agarose gel electrophoresis using TAE buffer. All four E. coli transformants showed a PCR band of about 2,3 kb. Plasmid DNA was isolated from each of the four colonies using a QIAprep Spin Miniprep Kit (QIAGEN GMBH, Hilden Germany). The resulting plasmid DNA was sequenced with primers 8653 and 8654 using an Applied Biosystems Model 3730 Automated DNA Sequencer using version 3.1 BIG-DYE™ terminator chemistry (Applied Biosystems, Inc., Foster City, CA, USA). The plasmid was chosen for transforming Aspergillus oryzae MT3568. A. oryzae MT3568 is an amdS (acetamidase) disrupted gene derivative of Aspergillus oryzae JaL355 (WO 2002 / 40694) in which pyrG auxotrophy was restored by inactivating the A. oryzae amdS gene. Protoplasts of A. oryzae MT3568 were prepared according to the method described in European Patent, EP0238023, pages 14-15. E. coli 190 containing the plasmid was grown overnight according to the manufacturer’s instructions (Genomed) and plasmid DNA was isolated using a Plasmid Midi Kit (Genomed JETquick kit, cat.nr.400250, GENOMED GmbH, Germany) according to the manufacturer’s instructions. The purified plasmid DNA was transformed into Aspergillus oryzae MT3568. A. oryzae MT3568 protoplasts were prepared according to the method of Christensen et al., 1988, Bio / Technology 6: 1419-1422. The selection plates consisted of COVE sucrose with +10 mM acetamide +15 mM CsCl + TRITON® X-100 (50µl / 500ml). The plates were incubated at 37°C. Briefly, 8uls of plasmid DNA representing 3ugs of DNA was added to 100uls MT3568 protoplasts.250 ul of 60% PEG solution was added and the tubes were gently mixed and incubate at 37° for 30 minutes. The mix was added to 10 ml of pre- melted Cove top agarose (The top agarose melted and then the temperature equilibrated to 40 C in a warm water bath before being added to the protoplast mixture). The combined mixture was then plated on two Cove-sucrose selection petri plates with 10mM Acetamide.The plates are incubated at 37°C for 4 days. Single Aspergillus transformed colonies were identified by growth on the selection Acetimide as a carbon source. Each of the four A. oryzae transformants were inoculated into 750 µl of YP medium supplemented with 2% glucose and also 750 µl of 2% maltodextrin and also DAP4C in 96 well deep plates and incubated at 37°C stationary for 4 days. At same time the four transformants were restreaked on COVE-2 sucrose agar medium. Culture broth from the Aspergillus oryzae transformants were then analyzed for production of the P63TNK ALP polypeptide by SDS-PAGE using NUPAGE® 10% Bis-Tris SDS gels (Invitrogen, Carlsbad, CA, USA) according to the manufacturer. A single band at approximately 90 kDa was observed for each of the Aspergillus oryzae transformants. The larger than predicted size of 69 kDa is most likely due to glycosylation. One A. oryzae transformant producing the SEQ ID NO:17 was designated A. oryzae EXP08508. A. oryzae EXP13030 was cultivated in 1000 ml Erlenmeyer shake flasks containing 100 ml of DAP4C medium at 30°C for 3 days with agitation at 150 rpm. Cloning and expression of SEQ ID NO:18 from Truncatella angustata and SEQ ID NO:18 from Morchella semilibera were performed exactly in the above description with the following specifics: Primers used for PCR amplification of InFusion inserts: SEQ ID NO:18 ACACAACTGGGGATCCACCATGTTCAGCCGACTAGCC AGATCTCGAGAAGCTTACTATTTCTGGCAAGATCCAC PCR fragment size produced: 2,2 kb Aspergillus recombinant protein size: 70,5 kDA, observed: approx.85 kDa SEQ ID NO:19 ACACAACTGGGGATCCACCATGAACGTCAACAGCCTG AGATCTCGAGAAGCTTATTAGTGATGGAAGTGAGTAAGA PCR fragment size produced: 1,8 kb Aspergillus recombinant protein size: 53,3 kDA, observed: approx.55 kDa. Example 4: Purification of alkaline phosphatase Typically, the purification process for alkaline phosphatase (ALP) from culture broth was firstly applied with hydrophobic interaction chromatography on AKTA Chromatography system (Cytiva), then if needed, ion exchange chromatography was applied. The difference for all the molecules was buffer type, pH, and salt concentration. The conductivity of culture supernatant of recombinant ALP was adjusted to about 190 mS / cm by adding ammonium sulfate, then the culture broth was loaded into Phenyl Sepharose High Performance column (Cytiva, 17108203) equilibrated with 20mM Tris-HCl at pH7.0 containing 2.0M ammonium sulfate. A gradient decrease of ammonium sulfate concentration from 2.0M to 0 was set up as elution condition. The elution fractions and flow-through faction were assayed by SDS-PAGE. ALP activity was determined as described below. Ion exchange chromatography process was applied for further purification. The fractions with ALP activity were pooled together and dialyzed with 20mM Tris-HCl at pH8.0, then loaded into a MonoQ HR16 / 10 (Cytiva, 17050601) or CaptoQ column (Cytiva, 17547003) equilibrated with 20mM Tris-HCl at pH8.0. A gradient increase of NaCl concentration from 0 to 1M with 20mM Tris-HCl at pH8.0 was set up as elution process. The elution fractions and flow-through fraction were assayed for SDS-PAGE and ALP activity. Finally, the fractions with enzyme activity were pooled together and then diafiltrated with 20mM PBS at pH7.0. The protein concentration was determined by QubitTMProtein Assay Kit (Invitrogen, Q33212). Example 5: His tag purification method His-tagged alkaline phosphatases were purified by immobilized metal chromatography (IMAC) using Ni2+as the metal ion on 5 mL HisTrap Excel columns (GE Healthcare Life Sciences). The purification took place at pH 7 and the bound protein was eluted with imidazole. The purity of the purified enzymes was checked by SDS-PAGE and the concentration of the enzyme determined by Absorbance 280 nm after a buffer exchange in 50mM HEPES, 100mM NaCl pH7.0 Ref: “The InterPro protein families and domains database: 20 years on”. Blum M1, Chang HY1, Chuguransky S1, Grego T1, Kandasaamy S1, Mitchell A1, Nuka G1, Paysan-Lafosse T1, Qureshi M1, Raj S1, Richardson L1, Salazar GA1, Williams L1, Bork P2, Bridge A3, Gough J4, Haft DH5, Letunic I6, Marchler-Bauer A5, Mi H7, Natale DA8, Necci M9, Orengo CA10, Pandurangan AP4, Rivoire C3, Sigrist CJA3, Sillitoe I10, Thanki N5, Thomas PD7, Tosatto SCE9, Wu CH8, Bateman A1, Finn RD1. Nucleic Acids Research, 01 Jan 2021, 49(D1):D344- D354 Example 6: Identification of stabilized variants The stabilized variants of SEQ ID 11, SEQ ID NO:61 to SEQ ID NO: 85, were identified by site saturation. Libraries were and screened as described below. After improved substitutions were identified, the improved substitutions were combined using SOE PCR, transformed into bacillus subtilis, and the resulting variants screened in the same assay to identify the stabilized combination variants. Cultivation of variants for assay Variants are inoculated in 2.2mL deep-well plates with 600 µL CAL18 medium and grown for 2 days at 37C, 700 RPM. The cells are spun down and the supernatant is used for the assay. Screening of variants for identification of stabilized variants In this example, variants wered stressed at pH 4.0. This was used to identify the stabilizing substitutions. To identify stabilizing combinations and rank the top hits, pH was lowered to pH 3.4, pH 3.2 and pH 3.0. The supernatant sample is split in two, called “stressed” and “unstressed” sample. The stressed sample is diluted 8 µL into 70 µL of pH 4.0 buffer (660ml 1M Citric acid + 340 ml 1M Na-citrate). The unstressed sample is diluted 8 µL into 255 µL pH 8.0 buffer (200mM Tris pH 8, 0,1 mM CaCl2, 10uM ZnCl2, 5uM MgCl2, 0,01% Tween). Both samples are incubated for 60 minutes at room temperature while shaking. After incubation the stressed sample is diluted by first adding 78 µL of the stressed ample into 185 µL pH 8 buffer, and then from there diluting 35 µL into 175 mL of pH 8 buffer. The unstressed sample is similarly diluted by adding 35 µL into 175 µL pH 8.0 buffer. After mixing reading is done by adding 10 µL diluted sample (stressed or unstressed) to a 385-well reader plate. Then 40 µL pNP-phosphate disodiumsalt hexahydrate, CAS 333338-18-4, 2mg / ml in 100mM Tris pH8,0, 0,01% tween, 0,1mM CaCl2 is added to each well, and the plate is immediately put in the reader for data collection. We used a BioTek Neo2 plate-reader. Absorbanse is measured at 405 nm over 30 minutes, and the activity of each well is determined by the maximal slope of the kinetic curve. Hits are variants showing a higher residual activity (activity of stressed sample divided by activity of unstressed sample) than the reference and an unstressed activity not lower than the reference. Example 7: Activity assay to determine the relative specific activity of alkaline phosphatases Alkaline phosphatase (ALP) (0,4 – 8 µg / ml) candidate was incubated in assay solution (AS) for 15 min at 38 °C. After incubation, the alkaline phosphatase candidate was diluted in a 10-step 2-fold dilution series and the substrate p-Nitrophenyl phosphate added to a final concentration of 50.0 µg / ml. After 60 minutes at 40°C, the absorbance was measured at 405 nm, the wavelength at which the enzymatic p-Nitrophenyl phosphate catalysis into p-Nitrophenol by alkaline phosphatase can be followed. Pepsin was added to the assay solution to ensure an identical background during the absorbance measurement, thereby allowing comparison to the results from the activity assay to determine the residual activity of alkaline phosphatase after a gastric challenge. Data analysis Background corrected absorbance values (Abscorr405Abs405corr) were plotted as a function of the logarithm of the enzyme concentration ([Enz] in %). The data was described by a 4- parametric, logarithmic Hill formula (Equation 1): where a describes the growth rate, IP describes the inflection point, c describes the lower asymptote and d describes the upper asymptote. EC50 (µgEP / ml) values were calculated from the inflection point (IP) obtained from Equation 1 using the following equation: Equation 2 Here, cMax (in µg EP / ml) describes the highest enzyme concentration used in the assay. The relative specific activity (Rel. spec act in %) was calculated from the EC50 value of a given ALP candidate relative to the EC50of the alkaline phosphatase CIAP using Equation 3: Example 8: Activity assay to determine the residual activity of alkaline phosphatase after a gastric challenge (ALP Gastric Conditions Stress Assay) Assay purpose This protocol describes the assay used to determine the stability of Alkaline Phoshatase (ALP) wild type enzymes and variants under gastric stress conditions. Gastric condition stress is defined as: 15 min at pH 3, 40 °C, with exposure to Pepsin protease. Stability of ALP is evaluated by measuring ALP activity before and after exposure to stress. Results are given as percent Residual Activity (%RA) defined as the activity of a given sample after stress relative to the same samples’ unstressed activity, i.e. activity before stress is defined as 100%. Assay protocol Dilute each enzyme sample in Milli-Q water, 0.01vol% TritonX-100 to a concentration of 2.4 ppm. Split each sample in three different aliquots and dilute to 1.2 ppm in Universal Stress Buffer (100 mM acetic acid, 100 mM MES, 100 mM HEPES, 100 mM Glycine, 1 mM MgCl2, 1 mM CaCl2, 1 mM ZnCl2) at both pH 8, and pH 3 + pepsin (550 U / mL) each in a total volume of 100 µL. Heat samples for 15 min at 40 °C in a PCR incubator. After heat exposure, measure activity of all three samples by mixing 30 µL heat-treated sample with 170 µL Activity Assay Solution (1 mM 4-Nitrophenyl phosphate disodium salt hexahydrate (CAS: 333338-18-4) in 100mM acetic acid, 100 mM MES, 100 mM HEPES, 100 mM Glycine, pH8) and immediately start reading change in absorbance at 405 nm for 30 min. Materials Assay Solution (AS, pH 8) 500 U / ml pepsin 1.17 - 1.53 mM HCl 10 mM Tris (5.8 mM base, 4.2 mM acid) 100 mM NaCl 0.01% (w / v) Tween 20 Deionized, microfiltered water Artificial gastric juice (AGJ, pH 3) 550 U / ml pepsin 1.3 - 1.7 mM HCl 100 mM NaCl 0.01% (w / v) Tween 20 Deionized, microfiltered water Neutralizing buffer (pH 8) 100 mM Tris 100 mM NaCl 0.01% (w / v) Tween 20 Deionized, microfiltered water An alkaline phosphatase candidate (0,4 – 8 µg / ml) was incubated in artificial gastric juice (AGJ) for 15 min at 38 °C to simulate the gastric challenge. After incubation, the pH was adjusted to pH8 with neutralizing buffer. The alkaline phosphatase candidate was diluted in a 10-step 2-fold dilution series and the substrate p-Nitrophenyl phosphate added to a final concentration of 50.0 µg / ml. After 60 minutes at 40°C, the absorbance was measured at 405 nm, the wavelength at which the enzymatic p-Nitrophenyl phosphate catalysis into p-Nitrophenol by alkaline phosphatase can be followed. Data analysis Background corrected absorbance values were plotted as a function of the logarithm of the enzyme concentration (in %). The data was described by a 4-parametric, logarithmic Hill formula (see: Equation 1). EC50(µgEP / ml) values were calculated from the inflection point (IP) obtained from Equation 1 using Equation 2. The residual activity (%) of an ALP after a gastric challenge was determined using Equation 4 where ^^ ^^^,^^^ ^^ is the EC50 of an ALP obtained after the 15-minute incubation in AGJ and ^^ ^^^,^^ ^^ is the EC50of an ALP obtained after a 15-minute incubation in AS. Data analysis Determine the initial rate (OD / min) for each sample and calculate percent Residual Activity (%RA) using the initial rate for the sample dissolved at pH 8 as index 100%. Residual Activity of samples after 15 min stress at 40 degC with varying pH and incl / excl pepsin protease. Wildtypes SEQ ID NO:50 and SEQ ID NO:11 show no activity after the high gastric stress treatment. However, the prior art variant SEQ ID NO: 107, with a C-terminal histidine or when upconcentrated and HEAL1115_Ct_His) retains part of its activity after gastric stress treatment. SEQ ID NO: 103 shows comparable activity after gastric stress treatment but SEQ ID NO:104 shows both higher activity (73 OD / min / ppm) and higher percent residual activity (12%) compared to SEQ IDNO:107 (21 OD / min / ppm and 6% respectively). Table 9 Conditions Enzyme SEQ Activity % Residual Activity ID (OD / min / ppm) (%RA) pH8 pH3 + pH8 pH3 + Pepsin Pepsin Wild type SEQ ID NO: 11 389 0 100 0 WT with SEQ ID NO: 11 293 0 100 0 C-terminal Histidine WT with N-terminal SEQ ID NO: 11 289 0 100 0 Histidine WT up-concentrated SEQ ID NO: 11 349 0 100 0 New variant SEQ ID NO: 107 21,5 0 100 0 New variant with C- SEQ ID NO: 107 307,3 21,7 100 6,7 terminal Histidine New variant SEQ ID NO:107 247 20 100 7,5 upconcentrated Fresh Wild type SEQ ID NO: 50 5 0 100 0 Fresh WT with C- SEQ ID NO: 50 237 0 100 0 terminal Histidine Fresh WT up- SEQ ID NO: 50 144 0 100 0 concentrated WT with N-terminal SEQ ID NO: 50 208 0 100 0 Histidine Variant with N-terminal SEQ ID NO: 103 603 48 100 7 Histidine Variant SEQ ID NO: 104 293 10,5 100 3 Variant with C-terminal SEQ ID NO: 104 572,8 73,5 100 12,5 Histidine Variant with N-terminal SEQ ID NO: 104 591,3 141,8 100 23,9 Histidine Variant up- SEQ ID NO: 104 598,2 32,5 100 5 concentrated Example 9: Determination of phosphatase activity at pH 7.0 75 microliter phosphatase-containing enzyme solution (diluted in MQ water with 0.01 % (v / w) Triton X-100) is dispensed in a microtiter plate well, e. g. NUNC 26962096-well plate, and 75 microliter substrate is added (for preparing the substrate, two 5 mg p-nitrophenyl phosphate tablets (Sigma-Aldrich, Cat.No. 20-106) are dissolved in 10 ml 50 mM Hepes, 100 mM NaCl, 1mM CaCl2, 1 mM MgCl2, 1 mM ZnCl2, pH 7.0). The plate is sealed and incubated 15 minutes, shaken with 750 rpm at 37°C. After the incubation time 75 microliter stop-reagent (0.5 M NaOH) is added and the absorbance at 405 nm is measured in a microtiter plate spectrophotometer. A blank (75 microliter 0.01 % (v / w) Triton X-100 + 75 microliter substrate solution (descripted above) is also incubated for 15 minutes, added 75 microliter stop-reagent and absorbance at 405 nm measured. This value is subtracted from the phosphatase readings. One phosphatase unit is defined as the enzyme activity that releases 1 micromol phosphate / min under the given reaction conditions (buffer blind subtracted). The absorbance of 1 micromol p-nitrophenol is determined to be 56 AU (AU= absorbancy units) under assay conditions. Determination of the phosphatase pH profile The pH profile was determined at 37°C in the pH range of 6.0 to 11.0 (in 1.0 pH-unit steps) as described above in the section “Determination of phosphatase activity”, except that a buffer cocktail (100 mM glycine, 100 mM acetic acid, 100 mM MES and 100 mM Hepes, 1mM CaCl2, 1 mM MgCl2, 1 mM ZnCl2, adjusted to relevant pH) was used instead of the Hepes pH 7.0 buffer. The results are summarized in Table 3. The values given for each pH in the range of 6.0 – 11.0 is the absorbance at 405 nm (A405) divide by the phosphatase concentration in ppm (determined by A280 of a purified sample and the calculated Extinction Coefficients of the phosphatase). Example 10: Thermostability (nDSF method) Nano differential scanning fluorimetry (nDSF) was utilized to determine thermal stability of alkaline phosphatases of the invention at different pHs. Purified samples were diluted to 0.4 mg / mL in 250 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), 250 mM Glycine, 250 mM Acetic acid, 250 mM MES (2-(N-morpholino) ethanesulfonic acid), pH 3, pH 4, pH 5, pH 7, pH 9, and pH 11. The instrument utilized for nDSF experiments, was a Prometheus NT-Plex with autosampler from Nanotemper Technologies GmbH, Germany). Samples were loaded in the Prometheus NT.Plex using capillary chips (PR-AC002). The experiments were conducted from 20 to 95 °C with a temperature gradient of 3.3 °C / min. The melting temperatures (Tm-values) were obtained from peak values derived from the first-derivative of the signal trace (350 / 330 nm fluorescence ratio or 330 nm fluorescence) using PR-ThermControl software. Results are listed in Table 4. Example 11: Thermostability (Thermal shift assay method) Protein thermal unfolding analysis (TSA, Thermal shift assay) Protein thermal unfolding of alkaline phosphatase polypeptides was monitored with Sypro Orange (Invitrogen, S-6650) using a real-time PCR instrument (Applied Biosystems; Step-One-Plus). Purified enzyme samples were diluted to 0.8 mg / mL in 100 mM glycine, 100 mM acetic acid, 100 mM MES and 100 mM HEPES, adjusted to pH, 3.0, 4.0, 5.0, 7.0, 8.0, 9.0, 10.0 and 11.0 with and without 1mM CaCl2, 1 mM MgCl2, 1 mM ZnCl2. Next, 15 μl enzyme sample diluted in a buffer solution adjusted to relevant pH, was mixed (1:1) with Sypro Orange (Conc. = 10X; stock solution from supplier = 5000X) in water. The plate was sealed with an optical PCR seal. The PCR instrument was set at a scan- rate of 76°C per hour, starting at 25°C and finishing at 96°C. Fluorescence was monitored every 20 seconds using in-built LED blue light for excitation and ROX-filter (610 nm, emission). Tm-values were calculated as: The temperature causing the maximum value of the first derivative (dF / dK) (Gregory et al., 2009, J. Biomol. Screen.14: 700). Results are listed in Tables 8.1-8.3. As can be seen at pH 7 and all other tested pHs, the polypeptides of the invention are more thermal stable than SEQ ID NO:50. Table 8.1 Tm(D) - TSA - average of 3 replicates pH pH pH pH pH pH pH pH Code Additives 3.0 4.0 5.0 7.0 8.0 9.0 10.0 11.0 CIAP none 61,8 76,1 76,9 72,2 62,8 54,3 52,9 CIAP Zn Ca Mg 46,9 75,7 80,7 78,5 72,2 67,1 65,4 61,7 SEQ ID NO:50 none 36,6 47,1 55,6 54,3 48,5 39,3 38 SEQ ID NO:50 Zn Ca Mg 44,5 42 56,1 67,4 68,1 66,6 62,4 48,3 SEQ ID NO:11 none 42,4 65,3 69 66,4 67,2 52,7 56,9 SEQ ID NO:11 Zn Ca Mg 59,5 71,5 77,9 77,3 75,8 71,5 65 SEQ ID NO:21 none 55,4 74,5 75,4 70,8 64,7 55,5 54,3 SEQ ID NO:21 Zn Ca Mg 71,1 76 76 71,6 67,6 60,6 53 SEQ ID NO:86 none 41,8 55,5 68 68,1 66,5 62,9 58,5 55,2 SEQ ID NO:86 Zn Ca Mg 44,8 66,9 74,2 80 79,6 78,6 75,8 66,9 SEQ ID NO:104 none 44,1 58 71,9 72,8 70,8 67,2 63,6 59,6 SEQ ID NO:104 Zn Ca Mg 48,2 70,2 76,8 82,9 82,2 81,3 78,4 69,9 The experiment was redone after the publication of WO2023 / 102002, with all backbones having a His tag

[0002] Table 8.2 seq ID Tm(D) - TSA - average of 3 replicates Code Additives pH pH pH pH pH pH pH pH 3.0 4.0 5.0 7.0 8.0 9.0 10.0 11.0 SeqID1 Zn Ca Mg 45 70 78 80 67 61 49 . SeqID2 Zn Ca Mg 39 79 88 95 94 90 85 78 SeqID3 Zn Ca Mg 31 80 87 92 93 91 87 82 SeqID5 Zn Ca Mg 35 76 86 92 93 90 83 53 SeqID6 none . . . 49 49 . . . SeqID6 Zn Ca Mg . 41 57 68 73 72 67 54 SeqID8 none 42 55 67 71 66 59 54 48 SeqID8 Zn Ca Mg 47 66 74 79 80 79 77 70 SeqID10 Zn Ca Mg 31 33 54 64 68 67 61 47 SeqID12 none . . . 35 34 31 30 29 SeqID12 Zn Ca Mg . . . 32 35 32 29 28 SeqID13 none . . 37 53 46 37 . . SeqID13 Zn Ca Mg . 43 53 66 69 67 61 49 SeqID14 none . 47 60 68 63 56 55 44 SeqID14 Zn Ca Mg . 72 80 80 74 68 60 58 SeqID16 Zn Ca Mg . 57 71 78 81 81 80 76 SeqID20 none . . 41 46 37 33 33 . SeqID20 Zn Ca Mg . 36 47 59 47 42 34 . SeqID21 none . 58 74 75 72 67 58 51 SeqID21 Zn Ca Mg . 72 77 77 72 69 63 57 SeqID25 Zn Ca Mg 39 . 52 52 44 43 41 39 SeqID33 none . . . 38 36 33 33 . SeqID33 Zn Ca Mg . . . 42 43 40 35 33 SeqID34 Zn Ca Mg 39 . 43 63 72 69 63 51 SeqID35 none . 40 51 62 55 51 48 45 SeqID35 Zn Ca Mg . 55 68 75 75 71 64 60 SeqID36 none . 44 63 65 61 55 55 55 SeqID36 Zn Ca Mg 35 60 63 69 69 65 64 64 SeqID37 none . 48 62 70 63 55 54 31 SeqID37 Zn Ca Mg 35 71 79 79 73 67 60 54 SeqID38 none . 50 71 73 69 66 63 49 SeqID38 Zn Ca Mg . 62 73 86 86 86 85 86 SeqID39 none . 38 60 70 66 59 50 45 SeqID39 Zn Ca Mg 35 63 71 71 65 58 51 46 SeqID46 none . 34 57 60 54 50 41 31 SeqID46 Zn Ca Mg . 52 62 70 71 68 61 51 SeqID47 none 36 39 59 64 59 42 37 29 SeqID47 Zn Ca Mg 35 49 62 72 71 70 65 55 SeqID48 Zn Ca Mg 35 48 58 66 64 61 54 46 SeqID49 Zn Ca Mg . 55 61 70 74 72 68 56 SeqID51 none . 40 60 63 59 55 46 33 SeqID51 Zn Ca Mg 35 55 66 75 73 71 66 56 SeqID52 none . 37 53 53 48 45 . . SeqID52 Zn Ca Mg . 51 57 67 68 66 59 48 SeqID55 none . 59 60 62 58 48 40 39 SeqID55 Zn Ca Mg . 62 66 65 61 57 51 44 SeqID56 none . . 52 65 64 62 60 57 SeqID56 Zn Ca Mg . 63 73 76 75 . 66 61 SeqID57 none . 54 67 81 75 65 61 51 SeqID57 Zn Ca Mg 40 73 80 86 85 85 73 65 SeqID58 none . 57 67 82 79 65 64 62 SeqID58 Zn Ca Mg 44 73 80 86 85 79 74 70 SeqID60 none . 52 66 71 69 65 63 58 SeqID60 Zn Ca Mg 42 68 77 87 87 85 78 66 SeqID61 none . 47 63 69 68 62 58 . SeqID61 Zn Ca Mg 37 63 73 79 79 78 74 67 SeqID63 none . 43 67 70 68 62 54 43 SeqID63 Zn Ca Mg 34 66 75 81 82 80 75 67 SeqID79 none 35 52 67 69 61 56 56 50 SeqID79 Zn Ca Mg . 66 75 81 81 80 76 70 SeqID80 none 45 59 71 72 65 58 55 50 SeqID80 Zn Ca Mg 48 69 75 82 82 81 78 71 SeqID81 none 41 53 69 70 63 58 53 46 SeqID81 Zn Ca Mg 46 68 75 81 82 81 77 69 SeqID82 none 41 56 70 71 65 60 60 55 SeqID82 Zn Ca Mg 47 69 76 82 82 80 78 71 SeqID83 none . 52 64 67 62 53 50 37 SeqID83 Zn Ca Mg 40 64 73 79 80 79 76 69 SeqID84 none 44 58 67 69 63 58 53 48 SeqID84 Zn Ca Mg 48 66 73 79 80 79 76 70 SeqID85 none 42 54 67 68 62 58 51 44 SeqID85 Zn Ca Mg 46 66 74 80 80 78 75 69 SeqID95 none 42 56 67 69 62 57 55 47 SeqID95 Zn Ca Mg 47 66 73 80 79 78 75 69 SeqID96 none 45 57 67 69 62 56 56 46 SeqID96 Zn Ca Mg 47 67 74 80 79 79 76 71 SeqID97 none 45 56 67 69 61 56 56 46 SeqID97 Zn Ca Mg 47 67 74 80 80 79 76 70 SeqID98 none 45 56 66 69 61 56 56 46 SeqID98 Zn Ca Mg 47 66 73 79 79 78 75 70 SeqID99 none 41 56 67 69 61 56 56 46 SeqID99 Zn Ca Mg 47 67 75 81 80 79 77 71 SeqID100 none 45 56 65 65 61 56 56 46 SeqID100 Zn Ca Mg 47 66 73 79 78 77 73 67 SeqID101 none 41 56 65 64 61 56 51 46 SeqID101 Zn Ca Mg 47 66 72 79 78 77 73 67 SeqID102 none 41 52 64 64 61 52 51 44 SeqID102 Zn Ca Mg 46 62 70 76 75 74 72 66 SeqID103 none 45 56 67 69 61 56 56 46 SeqID103 Zn Ca Mg 47 67 74 80 79 79 76 70 SeqID105 none 41 56 69 70 64 56 56 46 SeqID105 Zn Ca Mg 47 69 75 81 81 80 77 71 SeqID106 none 45 56 65 69 61 56 55 46 SeqID106 Zn Ca Mg 47 65 72 78 78 77 73 67 The purified enzymes, including SEQ ID NO: 1 of WO2023 / 102002, were expressed with no His tag and tested at pH 3.0. Accordingly, SEQ ID NO:104 has comparable thermostability to SEQ ID NO:107, which was developed according to WO2023 / 102002 for its thermostability. Table 8.3 SEQ ID Additives pH 3.0 SEQ ID NO: 104 none 40 SEQ ID NO: 104 Zn Ca Mg 41 SEQ ID NO:107 none 36 SEQ ID NO:107 Zn Ca Mg 40 Example 12- Cell Assay ATP Activity Bacteria were inoculated in broth (S. aureus in LB broth and Ls33 in MRS broth) and cultured over-night. Bacteria were re-inoculated in fresh broth and cultured for additional 24 hours to secure high growth capacity. Bacteria were diluted in fresh broth and seeded in plate. Alkaline phosphatase and ATP were mixed at in 100 mM HEPES buffer and incubated with shaking for 1 hour at 40 degrees C before being added to bacteria in plate. Concentrations indicated in table are final concentrations in bacteria plate. OD600 was measured immediately and after 24 hours. Bacterial growth without additions was set to 100%. Table 10a ALP Growth ALP (µg / mL) ATP (mM) Bacterium Time (hours) (%) No ALPLs33 24 100No ALP 20 Ls33 24 43 No ALP 10 Ls33 24 100 CIAP50 20 Ls33 24 105 CIAP50 10 Ls33 24 109 SEQ ID NO:2150 20 Ls33 24 116SEQ ID NO:2150 10 Ls33 24 117SEQ ID NO:1150 20 Ls33 24 112SEQ ID NO:1150 10 Ls33 24 113Table 10b ALP Growth ALP (µg / mL) ATP (mM) Bacterium Time (hours) (%) No ALPS. aureus 24 100 No ALP20 S. aureus 24 21 No ALP 10 S. aureus 24 18 CIAP50 20 S. aureus 24 113 CIAP50 10 S. aureus 24 109 SEQ ID NO:21 50 20 S. aureus 24 31 SEQ ID NO:21 50 10 S. aureus 24 104 SEQ ID NO:1150 20 S. aureus 24 26SEQ ID NO:1150 10 S. aureus 24 101Table 10c ALP ALP (µg / mL) ATP (mM) Bacterium Time (hours) Growth (%) No ALPLs33 24 100No ALP20 Ls33 24 0No ALP10 Ls33 24 100No ALP5 Ls33 24 98CIAP50 20 Ls33 24 115 CIAP50 10 Ls33 24 118 CIAP 50 5 Ls33 24 114 SEQ ID NO:211000 20 Ls33 24 132SEQ ID NO:211000 10 Ls33 24 131SEQ ID NO:211000 5 Ls33 24 140SEQ ID NO:21 250 20 Ls33 24 120 SEQ ID NO:21250 10 Ls33 24 127SEQ ID NO:21250 5 Ls33 24 126SEQ ID NO:2150 20 Ls33 24 120SEQ ID NO:21 50 10 Ls33 24 120 SEQ ID NO:2150 5 Ls33 24 114Table 10d ALP ATP ALP (µg / mL) (mM) Bacterium Time (hours) Growth (%) No ALPS. aureus 24 100 No ALP 20 S. aureus 24 10 No ALP 10 S. aureus 24 10 No ALP5 S. aureus 24 10 CIAP50 20 S. aureus 24 112 CIAP50 10 S. aureus 24 111 CIAP50 5 S. aureus 24 110 SEQ ID NO:211000 20 S. aureus 24 113SEQ ID NO:211000 10 S. aureus 24 117SEQ ID NO:211000 5 S. aureus 24 110SEQ ID NO:21250 20 S. aureus 24 102SEQ ID NO:21250 10 S. aureus 24 106SEQ ID NO:21250 5 S. aureus 24 107SEQ ID NO:2150 20 S. aureus 24 21SEQ ID NO:21 50 10 S. aureus 24 97 SEQ ID NO:2150 5 S. aureus 24 106Example 13 – LPS Activity A titration of alkaline phosphatase was mixed with 300 µg / mL LPS in 50 mM HEPES buffer supplemented with 0.0% Triton X-100. The mixture was incubated shaking for 60 min at 40 degrees C. Free phosphate was detected with Malachite Green Phosphate Detection Kit (R&D Systems) following manufactures protocol. In short, 10 µL of Reagent A (ammonium molybdate in 3 M sulfuric acid) was added to all samples followed by 10 min incubation. Then 10 µL of Reagent B (malachite green oxalate and polyvinyl alcohol) was added and samples were incubated for an additional 20 min. The plate was read at OD620. Background from individual components (alkaline phosphatase, LPS, buffer) was substratcted to reveal OD values from only LPS dephosphorylation. From the measured levels of free phosphate by the alkaline phosphatase titration a non-linear curve fitting was done and EC50 calculated. MAMP – Detoxification Assays LPS de-phosphorylation was measured with the Malachite Green Phosphate Detection kit, which detects free PO4. E. coli LPS was treated with titration of ALP followed by detection of released PO4. LPS, flagellin and bacteria de-toxification was measured in: TLR4 reporter cells, HT-29 epithelial cell line and Primary immune cells ALP-treated LPS was added to cells and luminescence (for reporter cells) or cytokines were measured for evaluation of stimulatory capacity of LPS and flagellin LPS: Malachite green phosphate detection kit – Results 300 µg / mL E. coli O111:B4 LPS is treated with titration of ALPs for 1 hour at 40 °C. Buffer: 50 mM HEPES with 0.01% Triton X-100. Background from LPS, ALP and buffer is subtracted. CIAP is from Sigma and is used as reference Table 10 OD620 at OD620 at SEQ. ID LPS_EC50 EC50 / EC50(CIAP) 1,67 µg / mL 15 µg / mL SEQ ID NO:25,17 111,09 - 0,01SEQ ID NO:55,82 125,07 - 0,04SEQ ID NO:8127,00 2226,90 0,02 0,03SEQ ID NO:1024,77 434,33 0,01 0,02SEQ ID NO:110,50 14,51 0,10 0,14SEQ ID NO:131,66 35,87 0,01 0,03SEQ ID NO:140,14 2,93 0,19 0,20SEQ ID NO:161,32 44,16 0,04 0,06SEQ ID NO:18765,20 21994,83 0,04 0,10SEQ ID NO:191475,00 31713,61 0,04 0,09CIAP0,05 0,22SEQ ID NO:207,79 141,27 0,11 0,20SEQ ID NO:210,33 5,89 0,19 0,24SEQ ID NO:241668816,00 45225365,85 0,03 0,12 SEQ ID NO:250,50 13,67 0,01 0,01SEQ ID NO:26752879,00 20403224,93 0,01 0,06SEQ ID NO:270,38 10,28 0,05 0,07SEQ ID NO:310,25 6,66 0,05 0,06SEQ ID NO:3313,49 334,66 0,02 0,00SEQ ID NO:3461,99 1537,83 0,04 0,07SEQ ID NO:350,52 12,94 0,06 0,08SEQ ID NO:361,22 30,17 0,16 0,22SEQ ID NO:370,57 12,98 0,18 0,23SEQ ID NO:380,61 13,95 0,04 0,03SEQ ID NO:390,23 5,33 0,20 0,24SEQ ID NO:46 1,5 0,017 0,04 SEQ ID NO:47 2,68 0,015 0,04 SEQ ID NO:48 1,03 0,026 0,037 Example 14 - Preventing inflammation by lowering the levels of IL-1β THP-1 cells were cultured in RPMI 1640 medium supplemeted with 10 mM HEPES, 10% FBS and 1% penicillin / streptomycin. THP-1 cells were seeded 2×105 cells / well in flat-bottom plate and stimulated with 10 ng / mL PMA (Phorbol 12-myristate 13-acetate) for 24 hours to induce macrophage phenotype. THP-1 macrophages were washed twice with pre-warmed PBS followed by 6 hours incubation in fresh complete medium to rest. Then cells were stimulated for 18 hours with 1 µg / mL LPS followed by additional washing in pre-warmed PBS. Alkaline phosphatase and ATP were mixed and incubated 1 hour with shaking at 40 degrees C before being added to the LPS stimulated THP-1 macrophages. After 1 hour incubation supernatants were harvested and analyzed for IL-1β by Cytometric Bead Array (CBA) analysis Table 11 ATP IL-1b ALP (mM) (pg / mL) Delta None0 198 100% None5 1946 100% SEQ ID NO: 210 241 122%SEQ ID NO: 215 495 25%SEQ ID NO:110 270 136%SEQ ID NO:115 332 17%SEQ ID NO:400 337 170%SEQ ID NO:405 1765 91%SEQ ID NO:440 256 129%SEQ ID NO:44 5 1994 102% As demonstrated, alkaline phosphates of the invention significantly reduced levels of IL-1β.

Claims

CLAIMS 1. A polypeptide having alkaline phosphatase activity, wherein said polypeptide is of bacterial or fungal origin, or a variant of a polypeptide of bacterial or fungal origin, wherein the polypeptide is gastric or pepsin stable.

2. The polypeptide having alkaline phosphatase activity according to claim 1, the polypeptide retains at least 1% of its activity after treatment to gastric conditions, such as at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, or at least 35% of its activity after a gastric challenge, such as at least 20% activity.

3. The polypeptide having alkaline phosphatase activity according to any of claims 1 or 2, wherein the polypeptide has at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide selected from the group consisting of SEQ ID NO:18, SEQ ID NO:30, SEQ ID NO:40, SEQ ID NO:44, SEQ ID NO:67, SEQ ID NO:71, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:

85.

4. The polypeptide according to any of claims 1 to 3, wherein said polypeptide has a relative activity greater than calf intestinal alkaline phosphatase.

5. A polypeptide having alkaline phosphatase activity, selected from the group consisting of: (a) a polypeptide having at least 70% sequence identity to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ IDNO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:85; (b) a polypeptide having at least 70% sequence identity to a mature polypeptide of polypeptide of (a) (c) a polypeptide encoded by a polynucleotide having at least 70% sequence identity to the mature polypeptide coding sequence of a polypeptide of (a) or (b) (d) a polypeptide derived from a polypeptide of (a) or (c), or a mature polypeptide of (b) by substitution, deletion or addition of 1 to 120 amino acids, such as 1 to 100, 1 to 80, 1 to 60 or 1 to 40 amino acids; (e) a polypeptide derived from the polypeptide of (a), (b), (c), or (d) wherein the N- and / or C- terminal end has been extended by the addition of 1 to 50 amino acids, such as 1 to 40, 1 to 30 or 1 to 20 amino acids; and (f) a fragment of the polypeptide of (a), (b), (c), (d), or (e); wherein the polypeptide of (a), (b), (c), (d), or (e) or the fragment of (f) has alkaline phosphatase activity.

6. The polypeptide according to claim 5 wherein the polypeptide alkaline is of bacterial or fungal origin or a variant of a polypeptide of bacterial or fungal origin, more preferably a polypeptide of bacterial origin or a variant of a polypeptide of bacterial origin, having alkaline phosphatase activity.

7. The polypeptide according to any of claims 1 to 6, having alkaline phosphatase activity, wherein the polypeptide has a sequence identity of at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to a polypeptide selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54,SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84 and SEQ ID NO:

85.

8. The polypeptide according to any of claims 1 to 7, wherein the polypeptide has alkaline phosphatase activity and is selected from the group consisting of a) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:61; b) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:62; c) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:63; d) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:64; e) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:65; f) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:66; g) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:67; h) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:68;i) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:69; j) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:70; k) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:71; l) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:72; m) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:73; n) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:74 o) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:75; p) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:76 q) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:77; r) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:78; s) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:79;t) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:80; u) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:81; v) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:82; x) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:83; y) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:84; and z) a polypeptide having at least 70% sequence identity, such as at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:

85.

9. The polypeptide according to any of claims 5 to 8, wherein said polypeptide has a relative activity greater than calf intestinal alkaline phosphatase.

10. The polypeptide according to any of claims 1 to 9, wherein the polypeptide has an activity at least equal to the activity of calf intestinal alkaline phosphatase at a pH of 7, 8, 9, 10 or 11, preferably at a pH of 7, 8 or 9, preferably pH 7.

11. A composition comprising the polypeptide as defined in any of claims 1 to 10.

12. The composition according to claim 11, wherein the composition is an aqueous solution comprising the polypeptide as defined in any of claims 1 to 10 or is a suspension comprising the polypeptide as defined in any of claims 1 to 10 in suspended form.

13. The composition according to claims 11 or 12 further comprising at least one fat soluble vitamin, and / or at least one water soluble vitamin, and / orat least one trace mineral.

14. An animal feed additive comprising the polypeptide as defined in any of claims 1 to 10.

15. An animal feed comprising the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

16. A zootechnical additive comprising the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

17. A method of preparation of an animal feed additive, a zootechnical additive or a feed comprising the addition of the polypeptide as defined in any of claims 1 to 10.

18. Use of a polypeptide as defined in any of claims 1 to 10 for the preparation of a feed additive, a feed composition or a zootechnical additive.

19. A method of increasing body weight gain in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

20. A method of improving the food conversion ratio of an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

21. A method of the detoxification of lipopolysaccharide in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

22. A method of reducing the immune response in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

23. A method of reducing inflammation in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

24. A method of reducing IL or TNF respsonse in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

25. A method of maintaining or supporting intestinal health, or improving intestinal health promoting growth of commensal bacteria, in an animal comprising feeding said animal the the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

26. A method for the maintenance of an effective gut barrier comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

27. A method to prevent colitis or the inflammation of the lining of the colon in an animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

28. A method to prevent low birth weight, such as induced by perinatal undernutrition comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

29. A method of improving weight gain in animals with below average birth weight comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

30. A method of regulating fat absorption or neutralising acidic digesta entering the small intestine via stimulation of bicarbonate secretions and surface pH comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

31. A method of preventing antibiotic-associated infections from Salmonella entericaserovar Typhimurium (S. Typhimurium) and / or Clostridium difficile comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

32. A method of preventing weight loss in an infected animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any ofclaims 11 to 13, or the animal feed additive of claim 14.

33. A method of maintaining or restoring (healthy) gut flora in an antibiotic treated animal comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

34. A method of preventing or reducing intestinal colonization or systemic translocation of unwanted bacteria, or for “dysbiosis”, namely for changing of the bacterial and / or archaeal balance of the intestinal microbiota, comprising feeding said animal the polypeptide as defined in any of claims 1 to 10, the composition according to any of claims 11 to 13, or the animal feed additive of claim 14.

Images