In VIVO site-specific base editing

Abstract

Compositions and methods for modifying a muscle or muscle precursor cell genome are disclosed. Also provided are methods of treatment using the compositions.

Description

IN VIVO SITE-SPECIFIC BASE EDITINGRELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 660,426, filed on June 14, 2024. The entire teaching of the above application is incorporated herein by reference.BACKGROUND OF THE INVENTION

[0002] Congenital muscular disorders are inherited, progressive disorders associated with mutations in genes which affect the development, function and structure of muscle in afflicted patients. Progression of these disorders can lead to muscle weakness, wasting, ptosis, cardiomyopathy, muscle stiffness, atrial paralysis, atrioventricular block, and early or sudden death. While progress has been made in treating some of these congenital muscular disorders, there is a need for targeted therapies with reduced side-effects that bring enduring amelioration of the symptoms, through correction of the underlying mutation(s) responsible for the disorders.SUMMARY OF THE INVENTION

[0003] In some embodiments disclosed herein is a first composition for modifying a muscle cell genome. The composition comprises one or more vectors that comprise a first nucleotide sequence that comprises a first promoter operably linked to a nucleic acid encoding a site-specific base editor and a second nucleotide sequence that comprises a second promoter operably linked to a nucleic acid encoding a guide RNA (“gRNA”) having a sequence recognized by the site-specific base editor. In some embodiments the first promoter and the second promoter can be the same, and in other embodiments the first promoter and the second promoter can be different.In other embodiments the first nucleotide sequence and the second nucleotide sequence are operably linked to the same promoter. The gRNA can comprise, for example, the sequence of AGAACAGGAGAUAACAGUUGA (SEQ ID NO: 1) or CUGCAGAACAGGAGAUAACAG (SEQ ID NO: 2).

[0004] Also disclosed herein in other embodiments is a second composition for modifying a muscle cell genome. The second composition comprises one or more vectors that comprise a first nucleotide sequence that comprises a first promoter operably linked to a nucleic acid encoding a site-specific RNA-dependent nuclease, and a second nucleotide sequence that comprises a second promoter operably linked to a nucleic acid encoding a gRNA having a sequence recognized by the site- specific RNA-dependent nuclease, and a third nucleotide sequence comprising a homology- directed repair (“HDR”) template targeting a gene mutation of interest. In some embodiments the first promoter and the second promoter can be the same, and in other embodiments the first promoter and the second promoter can be different. In other embodiments the first nucleotide sequence and the second nucleotide sequence are operably linked to the same promoter. In some embodiments the first, second and third promoters can be the same or different. In other embodiments two or more of the first, second and third nucleotide sequences can be operably linked together such that a single promoter drives expression of the linked construct. In other embodiments all three of the first, second and third nucleotide sequences can be operably linked together such that a single promoter drives expression of the linked construct.

[0005] Also provided is a method for treating an individual carrying a mutation, such as a dystrophin mutation, the method comprising administering to the individual a composition described herein, including the above-described compositions.

[0006] Further, in some embodiments disclosed herein are methods for restoring expression of a functional gene, e.g., a functional dystrophin gene, in an individual carrying a mutation, e.g., a dystrophin mutation. The method comprises administering to the individual one of the compositions described herein.

[0007] Finally, methods for modifying cells, e.g., muscle cells, e.g., skeletal muscle precursor cells (“SMP”), are disclosed which are carried out by contacting a population of cells, e.g., SMP, with a composition described above, therebymodifying the cells, e.g., SMP. In some embodiments, the cells, e.g., SMP, carry a mutation that reduces or eliminates expression of a gene, e.g., a dystrophin gene, and the modified cell, e.g., SMP, expresses a functional protein, e.g., a dystrophin protein. In some embodiment, the composition comprises one or more vectors that comprise a first nucleotide sequence that comprises a first promoter operably linked to a nucleic acid encoding a site- specific base editor and a second nucleotide sequence that comprises a second promoter operably linked to a nucleic acid encoding a guide RNA (“gRNA”) having a sequence recognized by the site-specific base editor.

[0008] All references cited herein are hereby incorporated by reference in their entireties.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0010] Fig. 1 shows point mutations detected in genomic DNA isolated from freshly sorted mdx4cv SMP treated with adenine base editor SaABE8e and gRNAl (SEQ ID NO: 1). The mutations are shown in the area surrounding the nonsense mutation in exon 53 of the mdx gene.

[0011] Fig. 2 shows point mutations detected in genomic DNA isolated from freshly sorted mdx4cv SMP treated with SaCas9, HDR template (SEQ ID NO: 3), and gRNA2 (SEQ ID NO: 2).

[0012] Fig. 3 shows the percent distribution in treated SMP of unmodified, therapeutically edited (at the mdx4cv mutation site, TAA to TGG for SaABE8e and TAA to CAA for HDR and HITI) and of non-therapeutically edited for each treatment condition. cDNA and gDNA indicate the type of templates sequenced.

[0013] Fig. 4 is a diagram for an in vivo therapeutic strategy for restoring dystrophin expression in dystrophic animals using SauriCas9, a gRNA, and an HDR template.

[0014] Fig. 5 shows a protocol for intramuscular delivery of MyoAAV2A- mdx-Editing compositions.

[0015] Fig. 6 shows the percentage distribution of HDR, Partial HDR (Therapeutic), Partial HDR (non-therapeutic, in which wobble sequences are replaced by the HDR template but the mdx mutation site is not), Other modifications (mostly NHEJ), and Unmodified sequences detected by cDNA analysis in each condition. Sequencing was performed on both AAV-injected (sample name ends in M) and contralateral (sample name ends in C) tibialis anterior muscle, and results are paired for each experimental animal.

[0016] Fig. 7 shows representative images of sectioned TAs stained for dystrophin. About 20-30% of dystrophin expression is restored in the injected tibialis anterior (TA) of mdx mice injected with MyoAAV2A gRNA+Template3 (-4E13 vg / kg) and MyoAAV2A SauriCas9 (-2E13 vg / kg) intramuscularly (IM) 3 weeks post injection

[0017] Fig. 8 shows representative images of sectioned TAs from wild type (WT) mice, control mice (injected with 4E11 vg (-4E13 vg / kg) AAV-gRNA Template 3 only), and experimental mice (injected with 2E11 vg (-2E13 vg / kg) AAV-SauriCas9 and 4E11 vg (-4E13 vg / kg) AAV-gRNA Template 3) stained with anti-dystrophin antibody (red), anti-laminin antibody (green), and DAPI (blue). Magnification 5X.

[0018] Fig. 9 shows images of enhanced transfection of striated muscles by two integrin-binding variant AAVs (Myo AAV 1A, Myo AAV 2A) compared to AAV9, and provides a histogram demonstrating fold change in mRNA expression in various striatal muscles and organs provided by Myo AAV 1A and MyoAAV 2A compared to AAV9.

[0019] Fig. 10 depicts images of sectioned triceps, TAs, and quadriceps from wild type, control, AAV9-CRISPR and MyoAAV 1A-CRISPR treated mdx mice as well as a boxplot of specific force of muscles from wild type, control, AAV9-CRISPR and MyoAAV 1A-CRISPR treated mdx mice.

[0020] Fig. 11 depicts a precise gene editing strategy for treating DMD.

[0021] Fig. 12 depicts representative images of sectioned skeletal muscles of control and MyoAAv-CRISPR-HDR treated mdx subjects, stained with antidystrophin antibody.

[0022] Fig. 13 shows representative images of sectioned cardiac muscle of control and MyoAAv-CRISPR-HDR treated mdx subjects, stained with antidystrophin antibody.

[0023] Fig. 14 depicts a strategy for treating DMD utilizing site-specific base editing.

[0024] Fig. 15 shows representative images of sectioned tibialis anterior muscle of MyoAav2A-SaABE8e-NT-gRNA and MyoAav2A-SaABE8e-gRNAl injected 4cv mdx mice, stained with anti-dystrophin antibody.

[0025] Fig. 16 shows representative images of sectioned cardiac muscle of MyoAav2A-SaABE8e-NT-gRNA and MyoAav2A-SaABE8e-gRNAl injected 4cv mdx mice, stained with anti-dystrophin antibody.

[0026] Fig. 17 shows bar charts of bulk editing rate of cardiac muscle, tibialis anterior skeletal muscle, and satellite cells in control and treatment groups.

[0027] Fig. 18 provides an overview of Duchenne Muscular Dystrophy and corresponding degeneration of skeletal muscle.DETAILED DESCRIPTION

[0028] Congenital muscular disorders are inherited, progressive disorders associated with mutations in genes which affect the development, function and structure of muscle in afflicted patients. These disorders include, for example, Duchenne Muscular Dystrophy, Becker Muscular Dystrophy, Emery-Freifuss Dystrophy, Facioscapulohumeral Muscular Dystrophy, Lumb-Girdle Dystrophy, Myotonic Dystrophy, Myotonia Congenita, Congenital Myopathies, and Familial Periodic Paralysis. Progression of these disorders can lead to muscle weakness, wasting, ptosis, cardiomyopathy, muscle stiffness, atrial paralysis, atrioventricular block, and early or sudden death. While progress has been made in treating some of these congenital muscular disorders, including through strategies which involve skipping of exons containing a mutation, a substantial number of afflicted patients possess mutations which are not amenable to such a strategy. Thus, there is a need for targeted therapies with reduced side-effects that bring enduring amelioration of the symptoms, through correction of the underlying mutation(s) responsible for thedisorders. Described herein are compositions and methods for treatment of congenital muscle disorders through targeted correction of one or more mutations underlying a congenital muscular disorder.

[0029] In some embodiments, the disorder is caused by one or more single nucleotide variants (SNV). Thus, certain aspects of the invention are directed to compositions and methods which utilize base editing to correct or introduce a SNV into DNA or RNA through use of a site- specific base editor. In some embodiments, the single nucleotide variant is pathogenic, and correction of the SNV prevents, reduces, ameliorates, alleviates, or eliminates symptoms of a disorder associated with the SNV. In other embodiments, the correction of the pathogenic SNV treats or cures the disorder associated with a pathogenic SNV. In some embodiments, a site-specific base editor is utilized to introduce a pathogenic SNV into DNA or RNA of a cell, organ, or tissue, thereby obtaining a genetically modified cell, organ or tissue. In some embodiments, the genetically modified cell, organ or tissue may form part of a test subject or model, e.g., an animal model of disease.

[0030] The DNA and RNA site- specific base editors that may be utilized in this method are not particularly limited and include those described herein, and those known to those of ordinary skill in this field, including commercially available sitespecific base editors. In some embodiments, the site-specific base editors are capable of catalyzing a OG to T«A base pair conversion, an A«T to G*C base pair conversion, a C*G to G*C base pair conversion, a simultaneous C*G to T«A and A«T to G*C base pair conversion, a C’U base conversion, or an A*I base conversion. In some embodiments, the site-specific base editor will comprise a first polypeptide domain capable of selectively binding a DNA or RNA sequence, linked to a second polypeptide domain capable of editing a nucleobase. In some embodiments, the first polypeptide domain capable of selectively binding a DNA or RNA sequence comprises a zinc-finger nuclease, a transcription activator-like effector nuclease (TALEN), or an RNA-dependent nuclease, each of which have been modified or inactivated to reduce or prevent the cleaving of phosphodiester bonds of a target sequence or of a sequence proximal the target sequence. In certain embodiments the RNA-dependent nuclease is a Cas9, Casl2, or Casl3 protein, derived from a Cas protein of a natural organism including Streptococcus pyogenes, Acidaminococcussp., or Staphylococcus aureus, among others. When the base editor is to be packaged in a smaller vector, such as an adeno-associated virus, the Cas protein may be derived from a Cas protein obtained from Staphylococcus aureus.

[0031] The site-specific base editor employed in the compositions and methods disclosed herein can be modified to decrease off-target modification. A decrease in off-target modification can be achieved by engineering of the Cas protein, the cytidine deaminase, or adenosine deaminase, (See Porto et al., Nat Rev Drug Discov. 2020 Dec;19(12):839-859), incorporated herein by reference in its entirety.

[0032] In certain embodiments, a reduction in gRNA-dependent off-target modifications can be achieved by modifying the deactivated or non-catalytic RNA- dependent nuclease used in the base editor to subdue non-specific electrostatic interactions between the RNA-dependent nuclease and its target nucleic acid sequence. For example, the RNA-dependent nuclease may be a non-catalytic Cas protein which contains one or more amino acid modifications selected from the group consisting of D10A, N497A, R661A, Q695A, H698A, K848, Q926A, K1003A, R1060A, and DI 135E. In some embodiments, the Cas protein comprises at least the modifications D10A / N497A / R661A / Q695A / Q926A, D10A / K848A / K1003A / R1060A, D10A / N497A / R661A / Q695A / Q926A / D1135E, or D10A / N694 / Q695 / H698A. In some embodiments, the modified, non-catalytic RNA- dependent nuclease is high-fidelity Cas9 (HiFi Cas9), Sniper-Cas9, enhanced Cas9 (eCas9), further enhanced Cas9 (FeCas9), high-fidelity Cas9 (Cas9-HF), hyper- accurate Cas9 (HypaCas9), or evolved Cas9 (evoCas9). In some embodiments, a non-catalytic Cas protein is selected to broaden the activity window of the sitespecific base editor. In some embodiments, the Cas protein is SaCas9n, SaKKHCas9n, LbdCasl2a, enAsdCasl2a, SpRy-Cas9n, SpG-Cas9n, SpCas9n-NG, dxCas9(3.7), VRER-Cas9n, VQR-Cas9n, or Cas9-NRCH.

[0033] In other aspects, gRNA-independent DNA off-target editing may be reduced by engineering of the cytidine or adenosine deaminase proteins. In one embodiment, the cytidine deaminase has at least one of the amino acid modifications selected from the group consisting of R33A, K34A, W90Y, Y120F, H122L, H122A, D124N, R126E, R128A, Y130F, F130L, R132E, and combinations thereof. In some embodiments, the cytidine deaminase has at least the amino acid modification R33A.In some embodiments, the cytidine deaminase has at least the amino acid modification K34A. In some embodiments, the cytidine deaminase has at least the amino acid modification W90Y. In some embodiments, the cytidine deaminase has at least the amino acid modification Y120F. In some embodiments, the cytidine deaminase has at least the amino acid modification H122L. In some embodiments, the cytidine deaminase has at least the amino acid modification H122A. In some embodiments, the cytidine deaminase has at least the amino acid modification D124N. In some embodiments, the cytidine deaminase has at least the amino acid modification R126E. In some embodiments, the cytidine deaminase has at least the amino acid modification R128A. In some embodiments, the cytidine deaminase has at least the amino acid modification Y130F. In some embodiments, the cytidine deaminase has at least the amino acid modification F130L. In some embodiments, the cytidine deaminase has at least the amino acid modification R130E. In some embodiments, the cytidine deaminase has at least the amino acid modifications W90Y and R126E. In some embodiments, the cytidine deaminase has at least the amino acid modifications R33A and K34A. In some embodiments, the cytidine deaminase has at least the amino acid modifications R126E and R132E. In some embodiments, the cytidine deaminase has at least the amino acid modification W90Y, R126E and R132E. In some embodiments the cytidine deaminase is YE1, YE2, EE, YEE, APOBEC1, APOBEC1 variants, APOBEC3A, SsAPOBEC3B, APOBEC3G, A3A, A3B, A3G, AID, RrA3F, AALN, CDA, or CDA1.

[0034] The adenosine deaminase domains that may be used in the sitespecific adenine base editor is not particularly limited and can be any such adenosine deaminase domains known in the art, or those disclosed herein. In some embodiments, the adenosine deaminase domain has at least one of the amino acid modifications selected from the group consisting of K20A, R21A, R26C, R26G, V69A, V82G, V88A, V106W, A109S, A109T, D108Q, D108N, T111R, D119N, H122N, Y147D, F148A, F149Y, T166I, and D167N. In some embodiments, the amino acid modification comprises V106W. In some embodiments, the amino acid modification comprises K20A. In some embodiments, the amino acid modification comprises R21A. In some embodiments, the amino acid modification comprises R26C. In some embodiments, the amino acid modification comprises R26G. In someembodiments, the amino acid modification comprises V69A. In some embodiments, the amino acid modification comprises V82G. In some embodiments, the amino acid modification comprises V88A. In some embodiments, the amino acid modification comprises A109S. In some embodiments, the amino acid modification comprises A109T. In some embodiments, the amino acid modification comprises D108Q. In some embodiments, the amino acid modification comprises D108N. In some embodiments, the amino acid modification comprises T111R. In some embodiments, the amino acid modification comprises D119N. In some embodiments, the amino acid modification comprises H122N. In some embodiments, the amino acid modification comprises Y147D. In some embodiments, the amino acid modification comprises F148A. In some embodiments, the amino acid modification comprises F149Y. In some embodiments, the amino acid modification comprises T166I. In some embodiments, the amino acid modification comprises D167N. In certain embodiments, the adenosine deaminase domain comprises wild-type TadA, TadA- 7.10, TadA-8a, TadA-8b, TadA-8c, TadA-8d, TadA-8e and combinations thereof (See Richter et al., Nat. Biotechnol. 2020 July; 38(7): 883-891), incorporated herein by reference in its entirety. In some embodiments, the adenosine deaminase domain comprises a dimer that contains the combination of a two TadA proteins, In some embodiments the adenosine deaminase domain comprises the combination of a wildtype TadA and a modified TadA. Exemplary dimers include TadA-TadA-7.1, TadA- TadA-8a, TadA-TadA-8b, TadA-TadA-8c, TadA-TadA-8d, TadA-TadA-8e.

[0035] As summarized above, a first composition for modifying a muscle cell genome is provided that includes, among other sequences, a first promoter operably linked to a nucleic acid that encodes a site-specific base editor . In some embodiments, the site-specific base editor is a site-specific adenine base editor (“ABE”), as discussed above. In one particular example, the ABE is SaABE8e.

[0036] In the first composition, the first promoter can be a constitutive promoter, e.g., CMV, SV40, RSV, PGF, CAG, UBC, EF1A, U6, beta-actin, or TRE, among others. Alternatively, the first promoter can be a muscle- specific promoter, e.g., a Human skeletal alpha-actin promoter (HSA), a Myoglobin promoter (Mb), a muscle creatine kinase promoter (MCK), a Desmin promoter, an alpha-myosin heavy chain promoter, a myosin light-chain promoter, a troponin promoter, and variantsthereof. In some embodiments, the variants comprise one of the above musclespecific promoters in connection with one or more copies of an enhancer associated with the same or different muscle- specific promoter. In certain embodiments, the variants may comprise a muscle- specific promoter operably linked to a constitutive promoter or functionally active portion thereof, optionally in connection with an enhancer associated with the constitutive promoter. In some embodiments, the promoter or enhancer sequence may be shortened by removing poorly conserved sequences to provide a mini promoter that can be more easily packaged into a vector. In certain embodiments, the promoter is CK6, CK8, CK8e, tMCK, dMCK, MHCK7, cTnT, MLC2v, MLC, Des, spc512, HSA, U6, Hl, CAG, SV40, CMV, PGF, Ubiquitin B, EF1A, U6, ACT5C, AUSEx3, and combinations thereof

[0037] As mentioned above, the first composition also includes a second promoter operably linked to a nucleic acid encoding a guide RNA having a sequence recognized by the site-specific base editor. In certain embodiments, the guide RNA directs the site-specific base editor to a single nucleotide variant associated with a muscle disorder . In some embodiments, the single nucleotide variant associated with a muscle disorder is a nonsense mutation. In certain embodiments, the guide RNA has the ribonucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In further embodiments, the composition comprises nucleic acid sequences that encode guide RNAs having distinct sequences. For example, the composition may comprise nucleic acid sequences that encode a total of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50 or more distinct guide RNAs. In certain embodiments, the guide RNA may be single or dual RNA. In some embodiments, the nucleic acid sequence encoding guide RNA may be present in the same vector that comprises a nucleic acid sequence encoding the site-specific base editor. In certain embodiments, the nucleic acid sequence encoding the guide RNA is present in a vector not comprising nucleic acids that encode a site-specific base editor. Where nucleic acid sequences encoding the site-specific base editor and guide RNAs are delivered in separate first and second vectors, respectively, the first and second vectors are present in the composition in a ratio of 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 2:1, 3:1 or 4:1. In certain embodiments the first and second vectors are present in a ratio of 1:1 or 1:2. In some embodiments, the ratio of site-specific base editor to guide RNA is1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, or 1:8. Like the first promoter, the second promoter can be a constitutive promoter, e.g., CMV, SV40, a muscle- specific promoter, e.g., CK8 and MHCK7, and variants thereof.

[0038] Any combinations of the first and second promoters fall within the scope of the invention. In one example, the first promoter is constitutive and the second promoter is muscle specific. In a second example, the first promoter is muscle specific and the second promoter is constitutive. In other examples, both promoters are constitutive or both promoters are muscle specific.

[0039] Turning back to the second composition, it requires a nucleotide sequence having a first promoter operably linked to a nucleic acid encoding a sitespecific RNA-dependent nuclease. The site-specific RNA-dependent nucleases that can be used in the methods disclosed herein are not limited and may be any sitespecific RNA-dependent nucleases disclosed herein. In some embodiments, the sitespecific RNA-dependent nucleases are an RNA-guided nuclease (e.g., a Cas nuclease (e.g., Cas9 nuclease)), or a functional fragment or functional variant thereof.

[0040] The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Type II system is a bacterial adaptive immune system that has been modified for use as an RNA-guided endonuclease technology for genome engineering. The bacterial system comprises two endogenous bacterial RNAs called crRNA and tracrRNA and a CRISPR-associated (Cas) nuclease, e.g., Cas9. The tracrRNA has partial complementarity to the crRNA and forms a complex with it. The Cas protein is guided to the target sequence by the crRNA / tracrRNA complex, which forms a RNA / DNA hybrid between the crRNA sequence and the complementary sequence in the target.

[0041] For use in genome modification, the crRNA and tracrRNA components are often combined into a single chimeric guide RNA (sgRNA or gRNA) in which the targeting specificity of the crRNA and the properties of the tracrRNA are combined into a single transcript that localizes the Cas protein to the target sequence so that the Cas protein can cleave the DNA. The sgRNA often comprises an approximately 20 nucleotide guide sequence complementary or homologous to the desired target sequence followed by about 80 nt of hybrid crRNA / tracrRNA. One of ordinary skill in the art appreciates that the guide RNA need not be perfectlycomplementary or homologous to the target sequence. For example, in some embodiments it may have one or two mismatches. The genomic sequence which the gRNA hybridizes is typically flanked on one side by a Protospacer Adjacent Motif (PAM) sequence although one of ordinary skill in the art appreciates that certain Cas proteins may have a relaxed requirement for a PAM sequence. The PAM sequence is present in the genomic DNA but not in the sgRNA sequence. The Cas protein will be directed to any DNA sequence with the correct target sequence and PAM sequence. The PAM sequence varies depending on the species of bacteria from which the Cas protein was derived. Specific examples of Cas proteins include Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 and Cas 10. In some embodiments, the site specific nuclease comprises a Cas9 protein. For example, Cas9 from Streptococcus pyogenes (Sp), Neisseria meningitides, Staphylococcus aureus, Streptococcus thermophiles, or Treponema denticola may be used. The PAM sequences for these Cas9 proteins are NGG, NNNNGATT, NNAGAA, NAAAAC, respectively. In some embodiments, the Cas9 is from Staphylococcus aureus (saCas9).

[0042] A number of engineered variants of the site- specific nucleases have been developed and may be used in certain embodiments. For example, engineered variants of Cas9 and Fokl are known in the art. Furthermore, it will be understood that a biologically active fragment or variant can be used. Other variations include the use of hybrid site specific nucleases. For example, in CRISPR RNA-guided Fokl nucleases (RFNs) the Fokl nuclease domain is fused to the amino-terminal end of a catalytically inactive Cas9 protein (dCas9) protein. RFNs act as dimers and utilize two guide RNAs (Tsai, QS, et al., Nat Biotechnol. 2014; 32(6): 569- 576). Site-specific nucleases that produce a single- stranded DNA break are also of use for genome editing. Such nucleases, sometimes termed “nickases” can be generated by introducing a mutation (e.g., an alanine substitution) at key catalytic residues in one of the two nuclease domains of a site specific nuclease that comprises two nuclease domains (such as ZFNs, TALENs, and Cas proteins). Examples of such mutations include D10A, N863A, and H840A in SpCas9 or at homologous positions in other Cas9 proteins. A nick can stimulate HDR at low efficiency in some cell types. Two nickases, targeted to a pair of sequences that are near each other and on opposite strands can create a single-stranded break on each strand (“double nicking”),effectively generating a DSB, which can optionally be repaired by HDR using a donor DNA template (Ran, F. A. et al. Cell 154, 1380-1389 (2013). In some embodiments, the Cas protein is a SpCas9 variant. In some embodiments, the SpCas9 variant is a R661A / Q695A / Q926A triple variant or a N497A / R661A / Q695A / Q926A quadruple variant. See Kleinstiver et al., “High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects,” Nature, Vol. 529, pp. 490-495 (and supplementary materials)(2016); incorporated herein by reference in its entirety. In some embodiments, the Cas protein is C2cl, a class 2 type V-B CRISPR-Cas protein. See Yang et al., “P AM-Dependent Target DNA Recognition and Cleavage by C2cl CRISPR-Cas Endonuclease,” Cell, Vol. 167, pp. 1814-1828 (2016); incorporated herein by reference in its entirety. In some embodiments, the Cas protein is one described in US 20160319260 “Engineered CRISPR-Cas9 nucleases with Altered PAM Specificity” incorporated herein by reference.

[0043] The nucleic acid encoding the sequence-targeting nuclease should be sufficiently short to be included in the virus (e.g., AAV). In some embodiments, the sequence-targeting nuclease is Cas9 from Staphylococcus aureus (saCas9) or Staphylococcus auricularis Cas9 (SauriCas9).

[0044] In some embodiments, the second composition comprises a third nucleotide sequence comprising a homology-directed repair (“HDR”) template targeting a gene mutation of interest. The HDR template will comprise a sequence that corrects a mutation, which is flanked on each side by homology arms to facilitate homology directed repair of the gene mutation of interest. It will be appreciated that varying lengths of homology arms may be used, such as about 25 bp, about 30 bp, about 40 bp, about 50 bp, about 60 bp, about 70 bp, about 80 bp, about 90 bp, about 100 bp, about 150 bp, about 200 bp, about 300 bp, about 400 bp, about 500 bp, about 600 bp, about 700 bp, about 800 bp, about 900 bp, or about 1,000 bp. In some embodiments, the HDR template may comprise wobble sequences substituted for PAM sequences recognized by the site-specific RNA-dependent nuclease, to thereby prevent cleavage of integrated template DNA by the site- specific RNA-dependent nuclease. In a specific composition, the HDR template comprises the sequence: CAATGAGTAGCATCAGGACGTGGATCCAGCAGTCAGAAAGCAAACTCTCT GTACCTTATCTTAGTGTTACTGAATATGAAATAATGGAGGAGAGACTCGGGAAATTACAGGTCTGTGGACATTTGAATATCATAAATAACAAAGAACATGTCTTATCAGTCAAGAGATCATATTGATATATTAAACTTAAGGTAATAATGAAAAAGTAAAGATAATAATGAAAAATCATAGATTATGAGTTGGAAAAATAAACAGAACAATTTGACCAAAAACATGACTTTTTCTTATTTTTTTCTATATATTATTTTATAAATATACAGACATAAATAGATATATATTTTTAAATTAAAAGTACTGTATTAAAGGAAAGGTATAATTTCATTTCATATTTAGTGACATAAGATATGAAGTATGATTATTAAAATTAAATCACATTATTTTATTATAATTACTTTATTTTTAATTCCTAATTTCTTTAAGCTTAGGTAAAATCAATGGATTTATATAATTAGTTAGAATTTAAATATTAACAAACTATAACACTATGATTAAATGCTTGATATTGAGTAGTTATTTTAATAGCCTAAGTCTGGAAATTAAATACTAGTAAGAGAAACTTCTGTGATGTGAGGACATATAAAGACTAATTTTTTTGTTGATTCTAAAAATCCCATGTTGTATACTTATTCTTTTTAAATCTGAAAATATATTAATCATATATTGCCTAAATGTCTTAATAATGTTTCACTGTAGGTAAGTTAAAATGTATCACATATATAATAAACATAGTTATTAATGCATAGATATTCAGTAAAATTATGACTTCTAAATTTCTGTCTAAATATAATATGCCCTGTAATATAATAGAAATTATTCATAAGAATACATATATATTGCTTTATCAGATATTCTACTTTGTTTAGATCTCTAAATTACATAAACTTTTATTTACCTTCTTCTTGATATGAATGAAACTCATCAAATATGCGTGTTAGTGTAAATGAACTTCTATTTAATTTTGAGGCTCTGCAAAGTTCTTTGAAAGAACAGCAGAACGGCTTCAACTATCTGAGTGACACTGTGAAGGAGATGGCCAAGAAAGCACCTTCAGAAATATGCCAGAAATATCTGTCAGAATTTGAAGAGATTGAGGGGCACTGGAAGAAACTTTCCTCCCAGTTGGTGGAAAGCTGCCAAAAGCTAGAAGAACATATGAATAAACTTCGAAAATTTCAGGTAAGCCGAGGTTTGGCCTTTAAACTATATTTTTTCACATAGCAATTAATTGGAAAATGTGATGGGAAACAGATATTTTACCCAGAGTCCTTCAAAGATATTGATGATATCAAAAGCCAAATCTATTTCAAAGGATTGCAACTTGCCTATTTTTCCTATGAAAACAGTAATGTGTCATACCTTCTTGGATTGTCTGTATAAATGAATTGATTTTTTTTCACCAACTCCAAGTATACTTAACATTTTAACATAATAATTTAAAATATCCTTATTCCATTATGTTCATTTTTTAAGTTGTAGATATGATTTAGCTCACAGCATACATATATACACATGTATTACATATGCATATATTATATATATGGCAGACATATGTTTTCACTACCATATTTCACTTTTGAATTATGAATATATGTTTAATTTCTGCCATATTTCCTTCCCTACATTGACTTCTATTAATTTAGTATTTCAGTAGTTCTAACACATTAATAATAACCTAGACTCAATACAGTAATCTAACAATTATATTTGTGCCTGTAATTCTAAGTTAGTTAAATTCATAGGTTGTGTTTCTCATAGTTGGCCATTTGTGAAATATAATAATATCCGAAAAGAAAGTTCAAAAATGTCATGACTTCATATAGAGTTATTGAAACAGTGCCCTTACTTTCATTCTGGCCATGCTAGTGACTTGATCATTCTTGTATTTTACAGCTAAAACACTACCAAAAGTGTCAAATCCATGATCTACATGTTTGACTGAGGCTAGCAGCACTTATTCCACCCTTATATGAAGCCTTTAAGAG (SEQ ID NO: 3).

[0045] In another specific example, the HDR template comprises the sequence:AATGTCTCGTCTTATTTGTTCTCATTTGACCATGAAGGCCAGAGCACAACCGTTGGAGTCAGTCCTCAGGTGTTTTCCACCATTTCTTTGAGACAATGTCCCTCTTTGAAACCTCACTAAGTAAGAGAGACTAGATACCCAATGAGCTCATCTGGGCCTGTCTCTGCTTCCCATCTTGACTCTGGTTTTGGAACATCCAAACACAGATCCTTATGCCCACAAGTAAGTGCTGAGGTAATAGAGCCAAGCCCTCTAGTACCTTTCTAATAAATAATTGTTATTTAGTGTCAGAGTCTAAAGTTGAATTTATATTTCTAAACATGGCACCAATATTGTAGTTTATTTCAATGCAAGTAATTTAATAGAAAGTCAAATTTGTCACCTGAAGAAATGATTTTGTTAATTATTTTACCTATATCACTCATAGCACCTTGGATATATTTAATGAGAAATATACATGTGCAATGACGTTTAGATTCTAAATTTCCACTGTCTTCTCTTGAGTAATAATTACTGTTCTTTATTCTTATTTTTATTCCAGTTGAAAGAATTCAGATTCAGTGGGATGAGGTTCAAGAACAACTGCAAAATAGACGACAGCAACTGAACGAAATGTTAAAGGATAGTACCCAATGGCTGGAAGCTAAGGAAGAAGCCGAACAGGTCATAGGACAGGTCAGAGGCAAGCTTGACTCATGGAAAGAAGGTCCTCACACAGTAGATGCAATCCAAAAGAAGATCACAGAAACCAAGGTTAGTGTCAAGCATATCTTTAAAAAAATATTTTGTATAGCAAATGAAAGCATGCCATAAATTAAAATTTAATGTTTTCTTAGTGAAAATTACATTTAGGAAGTGAAAAGTGGAATTCTTGCTTGTTTTTGATTGGTTGGTTTGTTGGTTGGTTGGTTGGTTGGCTGGCTGGTTGGTTGGTTGGCTGGTTGGTTGGTTGGTTGGTTTTGAGACAAAAATCTAAACTCAAAATACTCAAGACTACAGATGAGTGCCACTACATCTACATGATTTAAAATTTTGAGACACAGTATAGGTTATAGGAAAACTGATAACTGATAGCACATTGCAACATTAAAGTTAATTTTCATCTTGTATTATGCACAGAGTTTAGTTTGCTTTTGTTTTGTTAATATAGGGTCTTCCATAGCC TGTTCTTGCCTTCACTTCTGACTTTCCTGCATACACC (SEQ ID NO: 4).

[0046] The second composition, as set forth, supra, includes a nucleotide sequence having a second promoter operably linked to a nucleic acid encoding a gRNA having a sequence recognized by the site-specific RNA-dependent nuclease. The gRNA sequence can be selected by means known in the art to target a gene of interest. In particular examples, the gRNA encoded by the nucleic acid comprises the sequence of CUGCAGAACAGGAGAUAACAG (SEQ ID NO: 2) or GUUCUUUGAAAGAGCAAUAAA (SEQ ID NO: 5).

[0047] In exemplary second compositions, the nucleotide sequences comprise a sequence encoding gRNA SEQ ID NO: 2 and comprise HDR template SEQ ID NO: 3. In another example, the sequence encodes gRNA SEQ ID NO: 5 and comprises HDR template SEQ ID NO: 4.

[0048] Both the first composition and the second composition feature one or more vectors to carry the nucleotide sequences set forth above. The one or more vectors can each be an adeno-associated virus (“AAV”) vector. The AAV vector can be modified to contain a non-naturally occurring capsid protein. Examples of modified AAV capsid proteins that can be used are described in W02021050974, W02021077000, and W02022020616. The content of these three applications is hereby incorporated by reference in its entirety.

[0049] The AAV vector may contain a full-length AAV 5' inverted terminal repeat (ITR) and a full-length 3 ' ITR. A shortened version of the 5' ITR, termed AITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted. The abbreviation "sc" refers to self-complementary. "Self-complementary AAV" refers a construct in which a coding region carried by a recombinant AAV nucleic acid sequence has been designed to form an intra-molecular double-stranded DNA template. Upon infection, rather than waiting for cell mediated synthesis of the second strand, the two complementary halves of scAAV will associate to form one double stranded DNA (dsDNA) unit that is ready for immediate replication and transcription. See, e.g., D M McCarty et al, "Self- complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis", Gene Therapy, (August 2001), Vol 8, Number 16, Pages 1248- 1254. Self-complementary AAVs are described in, e.g., U.S. Patent Nos. 6,596,535; 7, 125,717; and 7,456,683, each of which is incorporated herein by reference in its entirety.

[0050] Where a pseudotyped AAV is to be produced, the ITRs are selected from a source which differs from the AAV source of the capsid. For example, AAV2 ITRs may be selected for use with an AAV capsid having a particular efficiency for a selected cellular receptor, target tissue or viral target. In one embodiment, the ITR sequences from AAV2, or the deleted version thereof (AITR), are used for convenience and to accelerate regulatory approval. However, ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped. However, other sources of AAV ITRs may be utilized.

[0051] A single-stranded AAV viral vector may be used. Methods for generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art. See, e.g., US Patent 7790449; US Patent 7282199; WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; and US 7588772 B2. In one system, a producer cell line is transiently transfected with a construct that encodes the transgene flanked by ITRs and a construct(s) that encodes rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transfected (transiently or stably) with a construct encoding the transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with helper adenovirus or herpesvirus, requiring the separation of the rAAVs from contaminating virus. More recently, systems have been developed that do not require infection with helper virus to recover the AAV - the required helper functions (i.e., adenovirus El, E2a, VA, and E4 or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied, in trans, by the system. In these newer systems, the helper functions can be supplied by transient transfection of the cells with constructs that encode the required helper functions, or the cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or posttranscriptional level. In yet another system, the transgene flanked by ITRs and rep / cap genes are introduced into insect cells by infection with baculovirus-based vectors. For reviews on these production systems, see generally, e.g., Zhang et al, 2009, "Adenovirus- adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production," Human Gene Therapy 20:922-929, the contents of each of which is incorporated herein by reference in its entirety. Methods of making and using these and other AAV production systems are also described in the following U.S. patents, the contents of which is incorporated herein by reference in its entirety: 5,139,941; 5,741,683; 6,057,152; 6,204,059; 6,268,213; 6,491,907; 6,660,514; 6,951,753; 7,094,604; 7,172,893; 7,201,898; 7,229,823; and 7,439,065.

[0052] In specific first and second compositions, the AAV vector comprises a non-naturally occurring AAV capsid protein comprising an RGD insertion into anaturally occurring AAV capsid. This modified AAV vector can be myotropic, i.e., it can be a MyoAAV vector carrying a MyoAAV capsid protein.

[0053] The MyoAAV capsid protein can be, but is not limited to, MyoAAV 1A, MyoAAV IB, MyoAAV 1C, MyoAAV ID, MyoAAV IE, MyoAAV IF, MyoAAV 1G, MyoAAV 1H, MyoAAV 2A, MyoAAV 3A, MyoAAV 3B, MyoAAV 3C, MyoAAV 3E, MyoAAV 4A, MyoAAV 4B, MyoAAV 4C, MyoAAV 4D, and MyoAAV 4E.

[0054] These MyoAAV capsid proteins are described in Tabebordbar et al., 2021, Cell 184, 4919-4938 and are summarized in Table 1 below.

[0055] Table 1. AAV9 capsid variants (see Tabebordbar et al., 2021)

[0056] As discussed above, delivery of the nucleic acids of the invention via an AAV comprising an AAV capsid protein engineered to target muscle cells and muscle precursor cells will result in a population of genomically modified cells enriched in genomically modified muscle and / or muscle precursor cells. Consequently, such an outcome reduces unwanted side effects by reducing off-target modification of genomic DNA of cell types distinct from muscle or muscle precursor cells, such as liver cells or brains cells. In some embodiments, the transduction of muscle cells or muscle precursor cells by the a set dose of AAV is increased 1.5-fold, 2 fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 75-fold, 100-fold, 125-fold, 150-fold or more compared to the same dose of an AAV (e.g. AAV9) lacking the engineered capsid protein as disclosed herein.

[0057] When targeting correction of a mutation of genomic DNA associated with a muscle disease or disorder, a lower dose of the disclosed AAVs may be administered to achieve similar results obtained with higher doses of AAVs lacking the engineered AAV capsid protein. For example, an effective dose of AAVs engineered as disclosed herein may equate to an at least 1 log reduction in AAVs compared to an effective dose of AAVs not modified according to the invention. In certain embodiments, the effective dose falls within the range of 1 x 107viral genomes (vg) / kg to 1.0 x 1015vg / kg. In some embodiments, the effective dose is approximately 1.0 x 107vg / kg, 5.0 x 107vg / kg, 1.0 x 108vg / kg, 5.0 x 108vg / kg, 1.0 x 109vg / kg, 5.0 x 109vg / kg, 1.0 x 1010vg / kg, 5.0 x 1010vg / kg, 1.0 x 1011vg / kg, 2.5 x1011vg / kg, 5.0 x 1011vg / kg, 7.5 x 1011vg / kg, 1.0 x 1012vg / kg, 2.5 x 1012vg / kg, 5.0 x1012vg / kg, 7.5 x 1012vg / kg, 1.0 x 1013vg / kg, 2.5 x 1013vg / kg, 5.0 x 1013vg / kg, 7.5 x1013vg / kg, 1.0 x 1014vg / kg, or 1.0 x 1015vg / kg. In some embodiments, the effective does is approximately 1.0 x 107vg / kg to approximately 1.0 x 108vg / kg, approximately 5.0 x 107vg / kg to approximately 5.0 x 108vg / kg, approximately 1.0 x 109vg / kg to approximately 1.0 x 1010vg / kg approximately 5.0 x 109vg / kg to approximately 5.0 x 1010vg / kg, approximately 1.0 x 1011vg / kg to approximately 1.0 x 1012vg / kg, approximately 2.5 x 1011vg / kg to approximately 2.5 x 1012vg / kg, approximately 5.0 x 1011vg / kg to approximately 5.0 x 1012vg / kg, approximately 7.5 x1011vg / kg to approximately 7.5 x 1012vg / kg, approximately 1.0 x 107vg / kg to approximately 5.0 x 109vg / kg, approximately 1.0 x 1010vg / kg to approximately 5.0 x1012vg / kg, approximately 5.0 x 107vg / kg to approximately 2.5 x 1013vg / kg, approximately 1.0 x 108vg / kg to approximately 1.0 x 1014vg / kg, approximately 5.0 x 108vg / kg to approximately 7.5 x 1012vg / kg, or approximately 1.0 x 109vg / kg to approximately 1.0 x 1015vg / kg. In some embodiments, the composition is in the form of a unit dose.

[0058] In some embodiments, the targeted muscle cells are skeletal muscle cells and / or skeletal muscle precursor cells. In some embodiments, the targeted muscle cells are myocytes, myoblasts, and / or satellite cells. In some embodiments, the targeted muscle is cardiac muscle cell or cardiac muscle precursor cell. In some embodiments the targeted muscle cells are cardiomyocytes, cardiac progenitor cells, and / or cardiac stem cells. In some embodiments, the targeted cells are c-Kit+, Mdr-1+, and Sca-1+. In some embodiment the cardiac progenitor cells are Isll+, Nkx2.5+, Flkl+, HCN4+, Wnt2+and / or cKit+.

[0059] Any of the above-described compositions can be used in the method for treating an individual afflicted with Duchenne Muscular Dystrophy, Becker Muscular Dystrophy, Emery-Freifuss Dystrophy, Facioscapulohumeral Muscular Dystrophy, Lumb-Girdle Dystrophy, Myotonic Dystrophy, Myotonia Congenita, Congenital Myopathies, and Familial Periodic Paralysis. In some embodiments, the composition is used in a method of treating an individual carrying a dystrophin mutation set out in the SUMMARY section. In some embodiments, the composition is used in a method of treating an individual carrying a single nucleotide variant. In some embodiments, the single nucleotide variant is a nonsense mutation.

[0060] In the method, the compositions can be administered systemically or locally. In some embodiments, the composition is administered intraperitoneally, subcutaneously, intramuscularly, retro orbitally, intranasally, via inhalation, intravascularly, intrathecally, or intravenously. In an exemplary method, the administering is by intramuscular injection. In some embodiments, the administering is by intravenous injection or retro orbital sinus injection.

[0061] Similarly, any of the compositions mentioned above can be administered in the method for restoring expression of functional dystrophin in anindividual carrying a dystrophin mutation. The compositions can be administered by injection, e.g., intravenous or intramuscular. In a particular method the administering is by intramuscular injection. This method can be advantageously used in an individual carrying a nonsense mutation in the dystrophin gene.

[0062] Carrying out the method set forth in the preceding paragraph can result in expression of functional dystrophin being restored to at least 5%, at least 8%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60% or more of wild-type levels.

[0063] In some embodiments, the method comprises administration of a second composition to a subject in need thereof comprising one or more AAVs tropic for muscle comprising nucleic acids encoding a site-specific RNA dependent nuclease, at least one gRNA, and a HDR template. In some embodiments, the method comprises administration to a subject in need thereof of a second composition comprising a first AAV tropic for muscle comprising a nucleic acid encoding a sitespecific RNA dependent nuclease, and a second AAV tropic for muscle comprising nucleic acids encoding at least one gRNA and a HDR template. In some embodiments, the method comprises administration of a first AAV tropic for muscle comprising nucleic acids encoding a site-specific RNA dependent nuclease and at least one gRNA, and a second AAV tropic for muscle comprising a nucleic acid encoding a HDR template. In certain embodiments, the administration of the second composition results in restoration of functional dystrophin expression in skeletal muscle to levels at least about 25%, at least about 27.5%, at least about 30%, at least about 35%, or at least about 37.5% or more compared to wild-type levels. In certain embodiments, the administration of the second composition results in restoration of functional dystrophin expression in cardiac muscle to levels at least about 35%, at least about 37.5%, at least about 40%, at least about 42.5%, at least about 45%, at least about 47.5%, at least about 50%, at least about 52.5%, or at least about 55% or more compared to wild-type levels.

[0064] To repeat, another method is disclosed for modifying SMP by contacting the SMP with the first composition described above. The SMP carry a mutation that reduces or eliminates expression of a dystrophin gene and the modifiedSMP expresses a functional dystrophin protein. The SMP, for example, have a cell surface phenotype of CD45", Seal", Mad", CXCR4+, and CD29+.

[0065] The compositions comprising viral vectors as disclosed herein may be formulated as a liquid, a suspension, a suspoemulsion, a gel, a solid, a powder, granules, oil-in-water emulsion, and a water-in-oil emulsion. In some embodiments the viral vectors are formulated for injection by combining the viral vectors with a liquid diluent recognized as safe for injection. Exemplary liquid diluents may include distilled or ultra-purified water, Ringer’s solution, lactated Ringer’s solution, a saline solution, such as phosphate-buffered saline (PBS), a dilute glucose solution, such as a 5% glucose aqueous solution, or a dilute alcohol or polyol aqueous solution, among others. In certain embodiments, the diluent is Water for Injection. In some embodiments, the diluent is PBS. In some embodiments, the diluent is an isotonic saline solution.

[0066] The composition may further comprise pharmaceutically acceptable excipients, such as those listed in the Handbook of Pharmaceutical Excipients (Handbook of Pharmaceutical Excipients, (2006) United Kingdom: Pharmaceutical Press). In some embodiments, selection of pharmaceutically acceptable excipients will be done with the goal to increase stability and effectiveness of the viral vectors included in the composition. For example, if the composition is to be frozen or lyophilized to enhance storage stability, the composition may include cryoprotectants. These cryoprotectants may include polyols, sugars, and salts, at a concentration between 0.5-55wt% of the composition. Additionally, buffers or pH adjusting agents may be selected to adjust the pH to less than 9, 8.5, 8, 7.8, 7.5. In some embodiments, the buffer is selected to increase the pH to greater than 3, 3.5, 4, 4.5, 4.8, 5, 5.5, 5.8, or 6.0. In some embodiments, the buffer and / or pH adjusting agent may be present at a concentration of 100 mM, 200 mM, 300 mM, 400 mM, 500 mM, 600 mM, 700 mM, 800 mM, 900 mM, or more. Buffers and pH adjusting agents include those which are commercially available and those disclosed herein. In some embodiments, the buffer and / or pH adjusting agent may comprise one or more of PBS, potassium phosphate, mono- or dibasic potassium phosphate, potassium chloride, potassium gluconate, potassium acetate, phosphoric acid or mixtures thereof, calcium chloride, calcium gluconate, calcium citrate, calcium carbonate, calcium lactate, calciumlevulinate, calcium lactobionate, sodium acetate, sodium bicarbonate, sodium citrate, sodium lactate, sodium chloride, mono- or dibasic sodium phosphate, and mixtures thereof, HEPES, alkali earth hydroxides, alkali hydroxides, aluminum hydroxide, citric acid, and acetic acid. In some embodiments, the concentration of buffers and / or pH adjusting agents is selected to prevent aggregation of the viral vectors in solution. In some embodiments, a mixture of two, three, four, five or six of the above buffers are selected. In some embodiments, the composition comprises PBS in combination with magnesium chloride in a concentration of at least 300 mM, at least 400 mM, at least 500 mM, or at least 600 mM. In some embodiments, specific buffers and their concentrations will be selected to reduce pH shift during freezing, and / or will be combined with excipients which reduce the crystallization of the buffer on cooling / freezing. Such excipients include sucrose, fibrous disaccharides, seaweed sugar, cellobiose, mannitol or ionic cryoprotectants (e.g., TMAC1).

[0067] In some embodiments, the composition comprises one or more surface active agents and / or emulsifiers to enhance efficacy and reduce adsorption of the viral vectors onto surfaces used to prepare and administer the composition. In some embodiments, the surfactants are included in a concentration of 0.00001 VI / N% to 3.0 w / v%., 0.0001 w / % to 1 w / v%, or 0.001 w / v% to 0.5 w / v%. The surface active agents are not particularly limited and include non-ionic, cationic, anionic and amphiphilic surfactants which are commercially available and those described herein. In some embodiments, the surface active agent may be sorbitan fatty acid esters, polyoxyethylene esters, sucrose fatty acid esters, polyethylene glycol fatty acid esters, polyoxyethylene ethers, nonionic triblock copolymers, such as poloxamers (e.g. Pl 88) or pluronic copolymers, carbomers, high molecular weight alcohols, colloidal clays, natural emulsifiers (e.g. lecithin, cholesterol), diethylene glycol monolaurate, potassium oleate, sodium lauryl sulfate, benzalkonium chloride, cetylpyridinium chloride, among others. In some embodiments, the surface-active agent is combined with a buffer.

[0068] It will be appreciated by the ordinarily skilled artisan that the composition may comprise other pharmaceutically acceptable excipients to aid in formulating, preserving and administering the composition. For example, if the composition is to be frozen or lyophilized, cryoprotectants may be used to protect thestability and efficacy of the composition. The cryoprotectants utilized are not particularly limited and include those which are commercially available and those described herein. In some embodiments, the cryoprotectant is one or more of sucrose, lactose, glucose, mannitol, sorbitol, alginate, polyvinylpyrrolidone, ethylene glycol, propylene glycol, glycerol, hydroxyethyl starch, and one or more salts. In addition, preservatives may be added to inhibit microbial growth and prevent oxidation of contents of the composition. Pharmaceutically acceptable excipients may also comprise osmolarity adjusting agents, solvents, vehicles, dispersion aids, suspension aids, as well as other excipients listed in Remington: the science and practice of pharmacy (Remington, Joseph Price, Vol. 1. Lippincott Williams & Wilkins, 2006).

Claims

CLAIMSWhat is claimed is:

1. A composition for modifying a muscle cell genome, the composition comprising one or more vectors that comprise a first nucleotide sequence that comprises a first promoter operably linked to a nucleic acid encoding a site-specific base editor and a second nucleotide sequence that comprises a second promoter operably linked to a nucleic acid encoding a guide RNA having a sequence recognized by the site-specific base editor and which directs the site-specific base editor to a single nucleotide variant associated with a muscle disorder for correction.

2. The composition of claim 1, wherein the single nucleotide variant is a non-sense mutation.

3. The composition of claim 2, wherein the single nucleotide variant is found in the DMD gene, and the muscle disorder is Duchenne Muscle Dystrophy or Becker Muscular Dystropy.

4. The composition of any one of claims 1-3, wherein the guide RNA comprises the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

5. The composition of any one of claims 1-4, wherein the site-specific base editor is an adenine base editor.

6. The composition of any one of claims 1-4, wherein the site-specific base editor is a cytosine base editor.

7. The composition of claim 5, wherein the site-specific adenine base editor is SaABE8e.

8. The composition of any one of claims 1-7, wherein the first promoter is a muscle-specific promoter.

9. The composition of any one of claims 1-8, wherein the second promoter is a muscle- specific promoter.

10. The composition of claim 8 or 9, wherein the muscle- specific promoter is selected from the group consisting of CK6, CK8, CK8e, tMCK, dMCK, MHCK7, cTnT, MLC2v, MLC, Des, and spc512.

11. The composition of any one of claims 1-7 or 9, wherein the first promoter is a constitutive promoter.

12. The composition of any one of claims 1-8 or 11, wherein the second promoter is a constitutive promoter.

13. The composition of any one of claims 1-12, wherein the one or more vectors are adeno-associated viruses (AAVs).

14. The composition of claim 13, wherein the one or more AAVs comprise an engineered capsid protein comprising an inserted moiety which targets muscle or muscle precursor cells, wherein at least a portion of the inserted moiety is oriented externally of the engineered capsid protein.

15. The composition of claim 14, wherein the engineered AAV capsid protein comprises an engineered AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV rh.74 or AAV rh.10 capsid protein.

16. The composition of claim 14, wherein the inserted moiety which targets muscle or muscle precursor cells comprises an n-mer motif.

17. The composition of any one of claims 14-16, wherein the inserted moiety comprises an amino acid sequence that includes the tripeptide RGD.

18. The composition of any one of claims 14-17, wherein the engineered AAV capsid protein is a MyoAAV capsid protein.

19. The composition of claim 18, wherein the MyoAAV capsid protein is selected from the group consisting of MyoAAV 1A, MyoAAV IB, MyoAAV 1C, MyoAAV ID, MyoAAV IE, MyoAAV IF, MyoAAV 1G, MyoAAV 1H, MyoAAV 2A, MyoAAV 3 A, MyoAAV 3B, MyoAAV 3C, MyoAAV 3E, MyoAAV 4A, MyoAAV 4B, MyoAAV 4C, MyoAAV 4D, and MyoAAV 4E.

20. A composition for modifying a muscle cell genome, the composition comprising one or more adeno-associated viruses (AAVs) that comprise a first nucleotide sequence that comprises a first promoter operably linked to a nucleic acid encoding a site- specific RNA-dependent nuclease, and a second nucleotide sequence that comprises a second promoter operably linked to a nucleic acid encoding a guide RNA (gRNA) having a sequence recognized by the site- specific RNA-dependent nuclease and which directs the site-specific RNA-dependent nuclease to a gene mutation associated with a muscle disorder for correction, and a third nucleotide sequence comprising a homology-directed repair (HDR) template for use by the HDR machinery of the muscle cell for correcting the gene mutation associated with a muscle disorder, wherein the one or more AAVs comprise an engineered capsid protein comprising an inserted moiety which targets muscle or muscle precursor cells, wherein at least a portion of the inserted moiety is oriented externally to a viral capsid into which the engineered capsid protein is integrated .

21. The composition of claim 20, wherein the site-specific RNA- dependent nuclease is Staphylococcus auricularis Cas9 (SauriCas9) or Staphylococcus aureus (SaCas9).

22. The composition of claim 20, wherein the homology-directed repair template comprises the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4.

23. The composition of claim 20, wherein the gRNA comprises the sequence of SEQ ID NO: 2.

24. The composition of any one of claims 20-23, wherein the engineered AAV capsid protein comprises an engineered AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV rh.74 or AAV rh.10 capsid protein.

25. The composition of any one of claims 20-24, wherein the inserted moiety which targets muscle or muscle precursor cells comprises an n-mer motif .

26. The composition of claim 20, wherein the inserted moiety comprises an amino acid sequence that includes the tripeptide RGD.

27. The composition of any one of claims 20-26, wherein the engineered AAV capsid protein is a MyoAAV capsid protein.

28. The composition of claim 27, wherein the MyoAAV capsid protein is selected from the group consisting of MyoAAV 1A, MyoAAV IB, MyoAAV 1C, MyoAAV ID, MyoAAV IE, MyoAAV IF, MyoAAV 1G, MyoAAV 1H, MyoAAV 2A, MyoAAV 3 A, MyoAAV 3B, MyoAAV 3C, MyoAAV 3E, MyoAAV 4A, MyoAAV 4B, MyoAAV 4C, MyoAAV 4D, and MyoAAV 4E.

29. A method for treating an individual carrying a dystrophin mutation, the method comprising administering to the individual the composition of any one of claims 1 to 28.

30. The method of claim 29, wherein the administering is by intramuscular or intravenous injection.

31. The method of claim 30, wherein the administering is by intramuscular injection.

32. A method for restoring expression of functional dystrophin in an individual carrying a dystrophin mutation, the method comprising administering to the individual the composition of any one of claims 1-28.

33. The method of claim 32, wherein the administering is by injection.

34. The method of claim 33, wherein the injection is intramuscular.

35. The method of any one of claims 32 to 34, wherein the dystrophin mutation is a nonsense mutation.

36. The method of any one of claims 32 to 35, wherein expression of functional dystrophin is restored to at least 20% of wild-type levels.

37. A method for modifying skeletal muscle precursor cells, the method comprising contacting skeletal muscle precursor cells (SMP) with the composition of claim 1 or 20, thereby modifying the SMP, wherein the SMP carry a mutation that reduces or eliminates expression of a dystrophin gene and the modified SMP expresses a functional dystrophin protein.

38. The method of claim 37, wherein a cell surface phenotype of the SMP is CD45’, Seal’, Macl’, CXCR4+, and CD29+.

Images