A genome editing platform removable by induction
Patent Information
- Application Number
- AU2025214162
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-29
- Filing Date
- 2025-01-28
- Publication Date
- 2026-08-27
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
FIELD OF THE INVENTION The present disclosure is generally directed to genome editing systems. Specifically, the invention relates to an inducibly removable genome editing platform. BACKGROUND OF THE INVENTION Developing crops with desired traits, especially complex traits such as resistance to pests, viruses, and other biotic stresses, is a labor-intensive process requiring multiple rounds of crossbreeding and / or gene-editing events. This is particularly challenging in tuber plants, which are typically propagated from tubers rather than seeds. Introducing new traits into tuber plants demands extensive selection and backcrossing, often taking years to achieve the desired outcomes. The tetrapioid nature of the potato genome further complicates the breeding process, as it increases the complexity of genetic inheritance and trait selection. These challenges are exacerbated by the need for adaptability to rapidly changing environmental conditions, such as those driven by climate change. Gene editing has emerged as a powerful tool for making precise and targeted changes in plant genomes. Tools such as CRISPR / Cas and zinc finger proteins (ZFPs) have been widely adopted for targeted modifications. However, these techniques face significant limitations, including unintended off-target events that compromise accuracy. Solutions to this problem include transient expression systems which do not integrate into the genome (such as by delivery by ribonucleoprotein, mRNA, or nanoparticles), site-specific systems in which the editing cassette integrates into the genome and is excised using a site-specific recombinase, and self-extracting cassettes which include an inducible recombinase or are extracted by a secondary CRISPR system. However, currently used systems still leave small traces in the genome, typical of the type of system used. Therefore, there is still a need for an advanced gene-editing platform that offers precise control, enhanced efficiency, and improved accuracy, while allowing for scar-free gene editing to address current challenges in tuber plants and other crops, enabling faster development of robust and adaptable agricultural solutions. SUMMARY OF THE INVENTION The following embodiments are described and illustrated in conjunction with compositions and methods which are meant to be exemplary and illustrative, not limiting in scope. In various embodiments, one or more of the above-described problems have been reduced or eliminated, while other embodiments are directed to other advantages or improvements. According to some embodiments, there is provided an inducibly removable genome editing nucleic acid construct for clean editing of sequences in a genome, the genome editing construct including: a left flanking (LF) sequence and a right flanking (RF) sequence defining the 5’ and 3’ ends of the construct, respectively, each including a target site for an excision gRNA; a sequence encoding a genome editing enzyme; a sequence encoding at least one inducible excision gRNA located downstream from a general promoter and designed to target the target sites in the LF and RF sequences; and a sequence encoding an exonuclease designed to be transcribed together with the at least one excision gRNA, wherein expression of the at least one excision gRNA leads to excision of the genome editing construct from the genome by the genome editing enzyme and the exonuclease, leaving minimal or no sequence of the genome editing construct in the genome after the excision. In some embodiments, the genome editing construct further includes: a sequence encoding an inducible site-specific recombinase; a first and a second recombination (REC) sites, which are recognizable by the site-specific recombinase and are positioned between the general promoter and the sequences encoding the at least one excision gRNA and the exonuclease; and at least one transcription termination signal positioned between the first and the second REC sites, wherein cleavage at the first and second REC sites by the inducible site-specific recombinase results in removal of the at least one transcription termination signal, thereby facilitating expression of the at least one excision gRNA and the exonuclease. In some embodiments, the site-specific recombinase is selected from Cre, Hin, Tre, FLP, FRT, KDRT, B3RT. In some embodiments, the site-specific recombinase is Cre and the first and second REC sites are LoxP sequences. In some embodiments, the inducible recombinase is under the control of an inducible promoter such as a heat shock promoter or a Tet inducible promoter. In some embodiments, the inducible recombinase is controlled by an inducible exon skipping system. In some embodiments, the general promoter is a constitutive promoter. In some embodiments, the excision gRNA target sites in the LF sequence and the RF sequence are essentially identical to each other and are positioned in a reverse orientation with respect to one another. In some embodiments, the LF sequence and RF sequence include sequences of a desired genomic sequence. In some embodiments, the LF sequence and RF sequence include or are included in a left border (LB) and a right border (RB), respectively, of a T-DNA of a Ti plasmid-based vector. In some embodiments, the genome editing enzyme is selected from a clustered regularly interspaced short palindromic repeats (CRISPR) system enzyme such as Cas9 or Cas 12, a meganuclease, a zinc finger nuclease (ZFN), a transcription-activator like effector nuclease (TALEN), and a prime editing system, or any other enzyme known in the art for gene editing. In some embodiments, the genome editing enzyme is under the control of a constitutive promoter, such as cauliflower mosaic virus (CaMV) 35S or a duplicated CaMV 35S. In some embodiments, the genome editing enzyme is under the control of an inducible promoter. In some embodiments, the exonuclease is a DPD1 or a TREX family exonuclease. In some embodiments, the at least one excision gRNA and the exonuclease are located in a single transcription unit. In some embodiments, the sequence between the at least one excision gRNA and the exonuclease includes at least one sequence encoding a self-cleaving element, such as a selfcleaving tRNA. In some embodiments, the genome editing construct further includes a positive selection gene. In some embodiments, the positive selection gene is selected from an antibiotic gene, such as kanamycin / neomycin resistance, hygromycin, or BASTA. In some embodiments, the genome editing construct further includes a sequence encoding a negative selection gene, which is capable of ablation of cells carrying the gene. In some embodiments, the negative selection gene is selected from CodA and DT-A. In some embodiments, the genome editing construct further includes gene targeting gRNA designed to target a sequence of a desired gene. In some embodiments, there if provided a vector including the genome editing construct described herein. In some embodiments, the vector is a Ti plasmid-based vector. In some embodiments, there if provided a genome editing platform cell including the genome editing construct described herein, integrated into the cell genome. In some embodiments, the cell is a plant cell, a mammalian cell, an algal cells, or a fungal cell. In some embodiments, the plant is selected from a potato, a sweet potato, or a tomato. In some embodiments, the cell is in cell culture. In some embodiments, the cell is in an organism, an organ, or a tissue. In some embodiments, the cell further includes a nucleic acid molecule including a gene targeting gRNA or a sequence encoding a gene targeting gRNA, the gene targeting gRNA being designed to target a desired sequence. In some embodiments, there is provided a method for genome editing of a desired gene in a genome, the method including: a) providing a population of the genome editing platform cells described herein; b) contacting the genome editing platform cells with a nucleic acid molecule including a gene targeting gRNA or a sequence encoding a gene targeting gRNA, the gRNA being designed to target a sequence of the desired gene; c) isolating genome editing platform cells in which the desired gene has been edited; and d) inducing expression of the excision gRNA, thereby leading to excision of the genome editing construct from the genome, leaving minimal or no sequence of the genome editing construct in the genome. In some embodiments, the genome editing platform cells are obtained by the following steps: i. providing a population of cells in which genome editing is desired; and ii. contacting the cells with a nucleic acid molecule including the genome editing construct described herein or the vector described herein, and causing the genome editing construct to integrate into the genome, thereby generating genome editing platform cells. In some embodiments, step (ii) of contacting the cells with the genome editing construct and causing the genome editing construct to integrate into the genome is conducted by agrobacterium-mediated T-DNA transformation of plant cells. In some embodiments, steps (b) and (c) are repeated more than once, each time by using a different gene targeting gRNA. In some embodiments, contacting the genome editing platform cells in step (b) is conducted by using a viral, a lentiviral, or a retroviral expression vector including the gene targeting gRNA, or the sequence encoding the gene targeting gRNA. In some embodiments, there if provided a modified organism prepared by the method described herein. In some embodiments, the modified organism is a plant. In some embodiments, there if provided a method for testing development of a desired trait, the method including: a) providing a population of the genome editing platform cells described herein; b) contacting the genome editing platform cells with a nucleic acid molecule including a gene targeting gRNA, or a sequence encoding a gene targeting gRNA, the gRNA being designed to target a sequence of the desired gene; c) isolating genome editing platform cells in which the desired gene has been edited; d) testing characteristics of the isolated cells; and e) repeating steps (b)-(d), each time using a different targeting gRNA, until the testing provides a desired outcome. In addition to the exemplary embodiments described above, further embodiments will become apparent by reference to the figures and by study of the following detailed descriptions. BRIEF DESCRIPTION OF DRAWINGS The invention will now be described in relation to certain examples and embodiments with reference to the following illustrative figures. Figs. 1A-1B show a schematic diagram of a genome editing construct of the invention inserted into genomic DNA, and its excision method, according to some embodiments. Fig. 1A shows the construct, including: a sequence encoding a positive selection gene preceded by its promoter and a first site-specific recombinase recognition sequence (REC) between the promoter and the gene, a second REC site following the terminator of the positive selection gene, a sequence encoding an excision gRNA following the second REC site, followed by a sequence encoding an exonuclease (such as TREX1), a sequence encoding a recombinase (which recognizes the REC sites, such as a Cre enzyme) + regulatory elements (RE), a sequence encoding a negative selection gene, and a sequence encoding a genome editing gene (GE enzyme) such as a Cas9 or a Cas 12 gene. The above elements are flanked by a left flanking (LF) sequence and a right flanking (RF) sequence, each including an excision gRNA recognition sequence, and further including a T-DNA left border (LB) and, and right border (RB), respectively. As shown by arrows indicated as (1), the recombinase, when expressed, cleaves the REC sites, eliminating the positive selection gene with its terminator and facilitating expression of the excision gRNA and the endonuclease. As shown by the arrows indicated as (2), the excision gRNA directs the GE enzyme to the gRNA targets in the LF and RF sequences, which results in extraction of the construct. P: promoter; T: terminator. Fig. IB shows step (2) in the excision of the construct. After the REC sites have been cleaved by the recombinase in step (1), the positive selection promoter drives expression of the excision gRNA and the exonuclease. The excision gRNA directs the GE enzyme to the construct LF and RF sequences, causing excision of the construct and further digestion of the breakpoints by the exonuclease, resulting only in genomic sequence remaining. Fig. 2 shows the gRNA recognition sequences within exon 1 of the GBSS gene. The gene editing abolishes a diagnostic Bsrl restriction enzyme site spanning the SpCas9 cleavage site, located 3 bp upstream of the Protospacer Adjacent Motif (PAM). Figs. 3A-3B show gene editing of the GBSS gene by the constructs. Fig. 3A. Gene editing efficiency of the different constructs, confirmed by PCR across the Bsrl restriction site. The bar graph displays the percentage of edited independent lines generated from each construct (N(56) = 46 lines, N(61) = 20 lines, N(62) = 40 lines). Fig. 3B. Proportion of fully (editing of all 4 alleles) and partially edited (editing of fewer than 4 alleles) independent lines among the different constructs (N(56) = 46 lines, N(61) = 20 lines, N(62) = 40 lines). Figs. 4A-4B shows excision of the 61 construct from genomic DNA of two lines following induction (but prior to negative selection), as confirmed by qPCR. Fig. 4A. shows NPTII (positive selection marker) removal from the genome serving as an indicator of successful induction. Fig. 4B. shows removal of the Cas9, also indicating excision of the construct. Induced samples were normalized against uninduced controls (N = 3 for each line). Figs. 5A-5E shows complete construct excision in a fully edited construct 62 line following negative selection. Fig. 5A. Primers 155 and 156 flanking the left border of the construct were used. The induced (Ind) line did not display a band corresponding to this region of the construct (same as the wild-type (WT); Fig. 5B. Primers 147 and 330 flanking the middle of the construct (encompassing a sequence between the recombinase and its terminator) were used. The induced line did not display a band corresponding to this region of the construct; Fig. 5C. Primers 249 and 288 flanking the right border of the construct were used. The induced line did not display a band corresponding to this region of the construct; Fig. 5D. Editing of the GBSS gene in the same line: the gene editing abolishes a diagnostic Bsrl restriction enzyme site spanning the SpCas9 cleavage site, located 3 bp upstream of the Protospacer Adjacent Motif (PAM). Digestion with Bsrl confirmed the absence of cleavage in the induced line, indicating complete editing. Fig. 5E. shows sequencing of knockout GBSS alleles. PCR products were ligated into the Clone Jet plasmid, transformed into DH5a cells, and analyzed by Sanger sequencing, revealing four distinct knockout alleles. Fig. 6. Confirmation of the phenotypic effect of GBSS knockout in construct 62 cell line. Left: WT tuber granules stained with Lugol's solution that binds to amylose, turning the amyloplast blue. Right: amylose-free tubers (amylopectin only) exhibited a red-brownish color, showing successful GBSS knockout. DETAILED DESCRIPTION OF THE INVENTION In the following description, various aspects of the disclosure will be described. For the purpose of explanation, specific configurations and details are set forth in order to provide a thorough understanding of the different aspects of the disclosure. However, it will also be apparent to one skilled in the art that the disclosure may be practiced without specific details being presented herein. Furthermore, well-known features may be omitted or simplified in order not to obscure the disclosure. The initial goal of the present inventors was developing a platform for genome editing that may be used for multiple events of genome editing, and once a desired trait (or combination of traits) has been obtained, the gene editing machinery may be ejected from the genome, so as not to leave external DNA in the genome. To that end, the inventors have developed an inducibly removable genome editing construct (an example of which is presented in Fig. 1A) which integrates into a genome, such as a plant cell genome, and includes a genome editing enzyme, such as a clustered regularly interspaced short palindromic repeats (CRISPR) system Cas9 or Cas 12 enzyme. Editing of desired genes is carried out by adding guide RNAs (gRNA)s, e.g., by transient expression vectors, designed to target desired genes, or by including such gRNAs to the construct. This editing step may be repeated multiple times with different gRNAs, facilitating generating combinations of edited genes to achieve desired traits. To eject the construct without leaving external DNA, the inventors have developed an innovative ejection system. The ejection system includes an inducible gRNA designed to target the left and right terminal regions of the construct (herein referred to as an “excision gRNA”, as shown in Fig. 1A), such that when induced, the excision gRNA guides the genome editing enzyme to cause extraction of the construct from the genome (see in Fig. IB). To ensure that no external sequences are left after ejection of the construct, the gRNA is transcribed together with an exonuclease, which trims any remaining external nucleotides at the breakpoints generated by the genome editing enzyme, so that no traces of the construct are left in the genome. To control expression of the excision gRNA, according to some embodiments of the invention, expression of the excision gRNA and of the exonuclease is controlled by an inducible site-specific recombinase system (such as Cre / Lox, FLT / FRT, etc., also shown in Fig. 1A). According to the invention, the gRNA-exonuclease transcription unit is preceded by a cassette including a transcription termination signal flanked by recombinase target sites (REC). Induction of the recombinase causes removal of the transcription termination signal, thereby enabling expression of the excision gRNA and the exonuclease (as shown in Fig. IB), which in turn excise the whole construct from the genome. As a result, the construct may be promptly and reliably removed from the plant genome at a desired time, e.g., after the desired trait has been obtained, without leaving external nucleotides in the plant genome. The invention may be used for editing various genes and combinations thereof, as well as extracting additional sequences (e.g. other constructs) from the genome by providing appropriate guide RNAs. Advantages of the gene editing system of the invention include the ability for rapid development of enhanced crop seeds, eliminating the need for crossing or single-cell assays, expedites response to change, such as climate change, allowing complete control and extraction of the gene-editing machinery from the plant genome following editing thus reducing the risk of off-target incidents, facilitating adding multiple traits, allowing flexibility in controlling gene expression, and application to a wide range of crops. An inducibly removable genome editing construct In some embodiments, the present invention provides an inducibly removable genome editing nucleic acid construct for clean editing of sequences in a genome, the genome editing construct including: - a left flanking (LF) sequence and a right flanking (RF) sequence defining the 5’ and 3’ ends of the construct, respectively, each including a target site for an excision gRNA; - a sequence encoding a genome editing enzyme; - a sequence encoding at least one inducible excision gRNA located downstream from a general promoter and designed to target the target sites in the LF and RF sequences; and - a sequence encoding an exonuclease designed to be transcribed together with the at least one excision gRNA, wherein expression of the at least one excision gRNA leads to excision of the genome editing construct from the genome by the genome editing enzyme and the exonuclease, leaving minimal or no sequence of the genome editing construct in the genome after the excision. The term “minimal or no sequence” means less than about 100, 90, 80, 70, 60, 50, 40, 30, 20, 15, 10, 5, 4, 3, 2, or 1 bp. In some embodiments, expression of the at least one excision gRNA leads to a deletion of genomic sequence relative to the genomic sequence before integration of the construct. In some embodiments, the deletion is at most about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, or 1000 bp. In some embodiments, the genome is a plant genome. In some embodiments, the genome is a genome of tuber plant, such as a potato, sweet potato, or a yam. In some embodiments, the genome is a potato genome. The reference to “clean” editing is made to emphasize that sequences of the construct are further cleaned, or digested, by the exonuclease, following cleavage by the genome editing enzyme, so as not to leave external sequences in the genome following excision of the construct. Reference is made to Fig. 1, which shows a genome editing construct, according to some embodiments. As shown in Fig. 1, the genome editing construct includes several elements which are important to the function of the construct, as explained below. As seen in Fig. 1, the 5’ and 3’ ends of the construct include a left and right flanking (LF and RF, respectively) sequences. The main function of the LF and RF sequences is to be targeted by the at least one excision gRNA, thereby causing excision of the construct by the genome editing enzyme. It is appreciated that reference to 5’ and 3’ directions or ends throughout the application are with reference to the directions which appear in Fig. 1, where the 5’ side represents the left side of the construct and the 3’ side represents the right side. In some embodiments, the LF and RF sequences are random sequences. In some embodiments, the LF and RF sequences are genomic sequences of a cell into which the genome editing construct is integrated. In some embodiments, the LF and RF sequences include (as shown in Fig. 1), or are included in, the left border (LB) and the right border (RB), respectively, of T-DNA of a Ti plasmid or a Ti plasmid-based vector. In some embodiments, the LF and RF sequences lie internally to a left border (LB) and a right border (RB), respectively, of a Ti plasmid or a Ti plasmid-based vector. In some embodiments, the LF lies downstream (i.e., 3’, or more internally in the construct) from the LB, and the RF lies upstream (i.e., 5’, or more internally in the construct) of the RB. In some embodiments, the LF is flanked on the left side (5’) by the LB and the RF is flanked on the right side (3’) by the RB. In some embodiments, the LF and RF sequences are essential to, or participate in, directing integration of the construct into a cell. In some embodiments, the LF and RF sequences are essential to, or participate in, directing integration of the construct into a plant cell. In some embodiments, the LF and RF sequences are essentially identical to each other. In the embodiments, the LF and RF sequences are essentially identical to each other and lie in an opposite orientation with respect to each other. In some embodiments, the excision gRNA target sites in the LF and RF sequences are essentially identical to each other. In the embodiments, the excision gRNA target sites in the LF and RF sequences are essentially identical to each other and lie in an opposite orientation with respect to each other. The expression “excision gRNA target sites(s)”, as used herein, refers to the sequences recognized by the excision gRNA, leading to the extraction of the construct from genomic DNA by the genome editing enzyme. In other words, the excision gRNA target sites are gRNA recognition sequences. In some embodiments, the LF and RF sequences include a sequence that is essentially identical to the sequence TTAAACTATCAGTGTTTGACAGG (SEQ ID NO: 1), either in the same orientation or in a reverse orientation. The term “essentially identical”, as used herein, means at least about 85%, 90%, 95%, or 99%, sequence identity between the respective sequences. In some embodiments, the excision gRNA target sites in the LF and RF sequences are sufficiently identical to facilitate binding of the same excision gRNA to both sequences, thereby allowing excision of the genome editing construct. In some embodiments, the excision gRNA target sites in the LF and RF sequences are essentially identical to each other (but may lie in an opposite orientation). In some embodiments, the excision gRNA target sites have a length of at least about 10 bp. In some embodiments, the excision gRNA target sites have a length of about 10-30 bp. In some embodiments, the LF and RF sequences have a length of at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 bp. In order for the genome editing construct to function as a platform for genome editing, the construct includes a genome editing enzyme, which is stably integrated into the genome of a desired cell as part of the genome editing construct. In some embodiments, the genome editing enzyme is selected from a clustered regularly interspaced short palindromic repeats (CRISPR) system enzyme such as Cas9 or Cas 12, a meganuclease, a zinc finger nuclease (ZFN), a transcription-activator like effector nuclease (TALEN), and a prime editing system, or any other enzyme known in the art for gene editing. In some embodiments, the genome editing enzyme is Cas9. In some embodiments, the genome editing enzyme is Cas 12. In some embodiments, the sequence encoding the genome editing enzyme further includes a promoter sequence, which lies upstream from the genome editing enzyme, driving expression thereof. In some embodiments, the promoter driving expression of the genome editing enzyme is a constitutive promoter. The constitutive promoter may be any constitutive promoter suitable for expression in the desired cell. In some embodiments, the constitutive promoter is selected from a cauliflower mosaic virus (CaMV) 35S promoter, a duplicated CaMV 35S promoter, a ubiquitin 10 (UBQ10) promoter, a Mannopine synthase promoter, and a PCL1 promoter. In some embodiments, the constitutive promoter is a cauliflower mosaic virus (CaMV) 35S promoter or a duplicated CaMV 35S promoter. In some embodiments, expression of the genome editing enzyme is inducible. In some embodiments, the promoter driving expression of the genome editing enzyme is an inducible promoter. The term “inducible”, as used herein with respect to a gene expression, encompasses both direct and indirect induction. Direct induction relates to the inducible gene being expressed by an inducible promoter. Indirect induction relates to induction of expression by a different mechanism, such as removal of a silencing element or a transcription terminator, or skipping an exon including a premature stop codon, which are described in more detail below, to allow transcription of the inducible gene. Nonlimiting examples for an inducible promoter include (some inducers in parentheses) a heat-inducible promoter such as pHvHSP17 or HSP18.2, PR-1 (pathogens / salicylic acid), GST1 (oxidative stress), HSP70 (heat), RD29A (drought / salt / abscisic acid), WRKY6 (pathogens / abiotic stress), PDF1.2 (jasmonic acid / ethylene), EREBP (ethylene), CHS (light / UV-B), pOp / LhG4 (dexamethasone), XVE (estradiol), TGV (glucocorticoid), AlcR / AlcA (ethanol), LexA-operatorbased systems (dextran), beta-galactose promoter, Tet promoter, and 3 5S-enhancer-based inducible promoters. In some embodiments, the sequence encoding the genome editing enzyme includes a terminator. Non-limiting examples for a terminator include a CaMV 35s terminator, an octopine synthase (OCS) plant terminator, and a nopaline synthase (NOS) terminator. In some embodiments, the terminator is a CaMV 35s terminator. As stated above, the at least one excision gRNA is designed to target the LF and RF sequences in order to extract the construct. In other words, the LF and RF sequences both include gRNA recognition sequences for the excision gRNA. When the LF and RF sequence are essentially identical to each other (regardless of whether they are in the same orientation or in reverse orientation with respect to each other), a single gRNA is designed to target both LF and RF sequences. However, when the LF and RF sequences are not identical, two excision RNAs are required in order to extract the construct, one for each flanking sequence. In some embodiments, the at least one excision gRNA is a single excision gRNA. In some embodiments, the at least one excision gRNA is two excision gRNAs. In some embodiments, the at least one excision gRNA is more than one excision gRNA. In some embodiments, the sequence encoding the at least one excision gRNA includes a sequence essentially identical to the sequence TTAAACTATCAGTGTTTGAC (SEQ ID NO: 2). In some embodiments, the sequence encoding the at least one excision gRNA includes a sequence essentially identical to a reverse complementary sequence of SEQ ID NO: 2. A reverse complementary sequence is a nucleotide sequence that is both reversed and has its bases replaced with their complementary counterparts (A T or U, G C). The exonuclease functions to clean up the ends of the genomic sequence breakpoints generated by the genome editing enzyme, so as to minimize the exogenous construct sequence remaining in the genome following the excision. Accordingly, the exonuclease is designed to be transcribed together with the excision gRNA. The expression “designed to be”, as used herein, means that the exonuclease and the at least one excision gRNA are expressed together, i.e., at the same time or following a single induction event. In some embodiments, the exonuclease is a DPD1 or a TREX family exonuclease, such as TREX1. In some embodiments, the exonuclease and the at least one excision gRNA are part of a single transcription unit. In some embodiments, the sequence between the sequence encoding the at least one excision gRNA and the sequence encoding the exonuclease does not include a promoter or a transcription terminator, such that both the excision gRNA and the exonuclease are transcribed from the same promoter (the general promoter). The expression of the at least one excision gRNA and of the exonuclease may be induced by direct induction, or by indirect induction. It is also conceivable that the at least one excision gRNA and the exonuclease are induced by a combination of a direct induction and an indirect induction, as further detailed below. In some embodiments, transcription of the exonuclease and the at least one excision gRNA is controlled by the same regulatory elements, so that when expression of the at least one excision gRNA is induced, the expression of the exonuclease is also induced. In some embodiments, the sequences encoding the excision gRNA and the exonuclease are preceded by the same inducible promoter or inducible elements driving transcription thereof. In some embodiments, at least one excision gRNA is 5’ from the exonuclease. In some embodiments, at least one excision gRNA is 3’ to the exonuclease. In some embodiments, the sequence between the sequence encoding the excision gRNA and the sequence encoding the exonuclease includes at least one sequence encoding a self-cleaving element. In some embodiments, the self-cleaving element is a self-cleaving tRNA. This facilitates expression of the gRNA and the exonuclease on a single transcript, which is subsequently cleaved to release the gRNA and the RNA encoding the exonuclease. In some embodiments, the sequence encoding the excision gRNA is flanked on both sides by a self-cleaving element, such as a selfcleaving tRNA. In some embodiments, the sequence encoding the exonuclease is preceded by an internal ribosome entry site (IRES). In some embodiments, the sequence encoding the exonuclease includes a terminator. Nonlimiting examples for a terminator include a CaMV 35s terminator, an octopine synthase (OCS) plant terminator, and a nopaline synthase (NOS) terminator. In some embodiments, the exonuclease terminator is a CaMV 35s terminator. In some embodiments the general promoter is a constitutive promoter. In some embodiments the general promoter is an inducible promoter. Examples for inducible and constitutive promoters are provided hereinabove. In some embodiments the general promoter is a UBQ10 promoter. As explained above, expression of the at least one excision gRNA may be facilitated by indirect induction such as by removal of a transcription terminator. This is exemplified by the embodiment shown in Fig. IB. As shown, the inducible excision gRNA is positioned downstream from a transcription terminator which is flanked by recombinase target sites (e.g. Lox or FRT sites) for a site-specific recombinase (e.g. a Cre or FLT enzyme). This setting prevents the excision gRNA from inadvertently expressing and prematurely extracting the genome editing cassette, allowing this to happen only after the transcription termination site is removed upon induction of the inducible recombinase. Accordingly, in some embodiments, the genome editing construct further includes: - a sequence encoding an inducible site-specific recombinase; - a first and a second recombination (REC) sites, which are recognizable by the site-specific recombinase and are positioned between the general promoter and the sequences encoding the at least one excision gRNA and the exonuclease; and - at least one transcription termination signal positioned between the first and the second REC sites, wherein cleavage at the first and second REC sites by the inducible site-specific recombinase results in removal of the at least one transcription termination signal, thereby facilitating expression of the at least one excision gRNA and the exonuclease. Non-limiting examples for the transcription termination signal include a CaMV 35s terminator, an octopine synthase (OCS) plant terminator, and a nopaline synthase (NOS) terminator. In some embodiments, the transcription termination signal is an OCS terminator. In some embodiments, the inducible site-specific recombinase is selected from Cre, Hin, Tre, FLP, FRT, KDRT, B3RT. In some embodiments, the site-specific recombinase is Cre and the first and second REC sites are LoxP sequences. In some embodiments, the site-specific recombinase is FLT and the first and second REC sites are FRT sequences. In some embodiments, the LoxP sequences are essentially identical to the sequence ATAACTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 3). In some embodiments, the inducible recombinase is under the control of an inducible promoter. In some embodiments, the inducible recombinase is transcribed from a constitutive promoter. Nonlimiting examples for constitutive and inducible promoters are provided herein. In some embodiments, the inducible recombinase is under the control of an NADH dehydrogenase ubiquinone 1 beta subcomplex subunit promoter (e.g. TAIR acc. AT1G76200), an F-box and associated interaction domains-containing protein promoter (e.g. TAIR acc. AT2G27520), a membrane anchored MYB promoter (e.g. TAIR acc. AT5G45420), or a PCL1 promoter. In some embodiments, expression of the inducible recombinase is regulated by an inducible exon skipping system. The expression “inducible exon skipping system” relates to systems such as those disclosed in WO2020141528, or systems of a similar function. Briefly, a gene encoding the desired regulated transcript includes a premature stop codon in an alternatively-spliced exon, and at least one regulatory element activated by an inducer. Without induction, the alternatively-spliced exon is spliced into the transcript and causes premature termination and degradation of the RNA transcript. However, upon induction, the alternatively-spliced exon is skipped, and transcription proceeds until the natural stop codon. In some embodiments, the sequence encoding the site-specific recombinase is modified to include an alternatively-spliced exon including a premature stop codon. In some embodiments, the sequence encoding the site-specific recombinase includes at least one regulatory element. In some embodiments, the sequence encoding the site-specific recombinase further includes, or is preceded by, at least one polyamine responsive sequence. In some embodiments, expression of the site-specific recombinase is induced by a polyamine or a polyamine analog. In some embodiments, expression of the site-specific recombinase is induced by a stress-inducing factor, such as heat stress, cold stress, high / low pH stress, and / or physical stress, which elevate cellular polyamine levels. In some embodiments, the at least one polyamine responsive sequence is derived from a gene encoding a spermidine / spermine N '-acetyl transferase (SSAT). In some embodiments, the at least one regulatory element is positioned between the sequence encoding the site-specific recombinase and the promoter thereof. In some embodiments, the inducible recombinase is followed by a transcription terminator. Non-limiting examples for a terminator are provided above. In some embodiments, the transcription terminator of the recombinase is a nopaline synthase (NOS) terminator. In the above system, if the general promoter, which drives expression of the excision gRNA and of the exonuclease, is a constitutive promoter, removal of the transcription termination signal will directly result in expression thereof. However, if the general promoter is an inducible promoter, then expression of the excision gRNA and the exonuclease also requires induction of the inducible promoter. This is a combination of a direct and indirect induction, which provides an additional layer of control. Additionally demonstrated in the embodiment exemplified in Fig. 1A are positive and negative selection genes. In the embodiments demonstrated in Fig. 1A, the general promoter is separated from the sequence encoding the at least one excision gRNA and the exonuclease by a positive selection gene, which includes a transcription terminator. The positive selection gene and the transcription terminator are flanked by the REC sites (as explained above). In this setting the general promoter drives transcription of the positive selection gene, which is terminated upstream of the sequence encoding the at least one excision gRNA and the exonuclease. At this stage, the positive selection serves to identify cells in which the construct has integrated. Upon induction of the site-specific recombinase by providing an appropriate inducing signal, the recombinase cleaves the two REC sites thereby excising both the terminator and the positive selection gene, as shown in Fig. IB, and allowing transcription of the at least one excision gRNA and the exonuclease, leading to excision of the construct by the genome editing enzyme. Accordingly, in some embodiments, the genome editing construct further includes a sequence encoding a positive selection gene, in order to select for cells which have integrated the construct into the genome. Examples for such positive selection genes include antibiotic-resistance genes, such as kanamycin / neomycin resistance, hygromycin, or BASTA. In some embodiments, the antibiotic-resistance gene is nptll. In some embodiments, the positive selection gene is positioned between the general promoter and the sequences encoding the at least one gRNA and the exonuclease. In some embodiments, the positive selection gene includes a transcription termination signal. In some embodiments, the positive selection gene and the transcription termination signal are flanked by REC sites. Nonlimiting examples for transcription termination signals (transcription terminators) are provided above. In some embodiments, the transcription termination signal is an OCS terminator. In some embodiments, the genome editing construct further includes a sequence encoding a negative selection gene, in order to eliminate cells in which the genome editing construct was not excised. The negative selection gene is capable of ablation of cells carrying it. In some embodiments, the negative selection gene is selected from CodA and DT-A. In some embodiments, the negative selection gene includes a constitutive promoter. In some embodiments, the negative selection gene includes an inducible promoter. Nonlimiting examples for constitutive and inducible promoters are provided above. In some embodiments, the promoter of the negative selection gene is a Mannopine synthase promoter. In some embodiments, the negative selection gene includes a transcription terminators. Nonlimiting examples for transcription terminators are provided above. In some embodiments, the transcription terminators of the negative selection gene is a CaMV 35s terminator. As explained above, the genome editing construct is integrated into a genome and serves as a platform for gene editing of desired genes or other sequences, which may be conducted by adding a gene targeting gRNA (which is designed to target the gene or sequence to be edited) at an appropriate time. Gene editing will be driven by the gene targeting gRNA and the genome editing enzyme of the construct. In some embodiments, the genome editing enzyme is driven by an inducible promoter, and the gene targeting gRNA is added together with a suitable inducer for the inducible promoter. This may further prevent leakiness and possible action of the genome editing enzyme when a gene targeting gRNA is not present in the cell. In some embodiments, the genome editing construct further includes at least one sequence encoding a gene targeting gRNA, which is designed to target a sequence of a desired gene or sequence for editing. In some embodiments, the at least one sequence encoding a gene targeting gRNA is operably linked to a promoter for driving expression of the gene targeting gRNA. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is an RNA polymerase III promoter. Nonlimiting examples for an RNA polymerase III promoter include a potato US promoter (e.g., StU6-l-4). A nonlimiting example for a gene desired for editing is the granule-bound starch synthase (GBSS) gene, which is essential for amylose synthesis in potato tubers. In the lack of the GBSS enzyme, amyloplasts in the tubers include amylopectin and not amylose. High-amylopectin potatoes offer significant industrial value due to their unique functional properties. Their starch easily gelatinizes into a clear, stable paste, making them ideal for food processing as thickeners, stabilizers, and emulsifiers. Their superior freeze-thaw stability prevents syneresis, ensuring better performance in frozen products. Additionally, their high amylopectin content enhances ethanol production efficiency, making them a valuable raw material for biofuel and alcoholic beverage industries. Accordingly, in some embodiments, the gene targeting gRNA is designed to target the granule-bound starch synthase (GBSS) gene. In some embodiments, the gene targeting gRNA includes a sequence essentially identical to GGTCCTTGGAGCAAAACTGG (SEQ ID NO: 4). In some embodiments, the genome editing construct further includes a sequence encoding at least one additional excision gRNA designed to target flanking sequences of another genome editing construct that is present in the same genome. It is appreciated that the at least one additional excision gRNA, when expressed, directs the genome editing enzyme of the construct, or another genome editing enzyme present in the other genome editing construct, to the flanking sequences of the other genome editing construct, thereby causing excision thereof. In some embodiments, the at least one additional excision gRNA is positioned in the same transcription unit together with the excision gRNA and the exonuclease, so that upon expression of the additional excision gRNA, the exonuclease also removes any leftover sequences remaining following extraction of the additional genome editing cassette. Alternatively, in some embodiments, the at least one additional excision gRNA is positioned in the same transcription unit with an additional exonuclease, so that upon expression of the additional excision gRNA, the additional exonuclease is also expressed. The term “designed to target” as used herein with reference to the various gRNAs described, means that the gRNA is designed to direct cleavage by the genome editing enzyme to the gRNA recognition sequence targeted by the gRNA. In some embodiments, the gRNA includes a sequence that is essentially identical to the gRNA recognition sequence. In some embodiments, the gRNA includes a sequence that is essentially identical to the reverse complement of the gRNA recognition sequence. In some embodiments, the nucleic acid is DNA. In some embodiments, the nucleic acid is double stranded DNA. It is appreciated that the elements of the construct, described herein, may appear at any order or position in the construct, unless defined otherwise herein. For example, the sequence encoding the genome editing enzyme maybe positioned 5’ or 3’ which respect to the sequence encoding the recombinase or to the sequence encoding the excision gRNA, and the sequence encoding the excision gRNA may be positioned 5’ or 3’ to the sequence encoding the recombinase. In some embodiments, the present invention provides a vector including the genome editing construct disclosed herein. In some embodiments, the vector further includes elements required for integration of the construct into genomic DNA, such as genes responsible for processing, transferring, and integrating the construct into a genome. In some embodiments, the vector includes elements required for integration of the construct into plant genomic DNA. In some embodiments, the vector is a Ti plasmid or a Ti-plasmid-based vector. A genome editing platform cell In some embodiments, the present invention provides a genome editing platform cell including any embodiment, or combination of embodiments, of the genome editing construct disclosed herein, integrated into the cell genome. In general, definitions and embodiments mentioned above, and which may be relevant to the genome editing platform cells, also apply here, and vice versa. Some particularly relevant embodiments may be pointed out or explicitly repeated. For terms used herein, unless stated otherwise, their definition and embodiments are intended to be the same as above (mutatis mutandis). The genome editing platform cell is intended to be used as a platform for gene editing and developing complex traits as described above, allowing for multiple gene editing sessions until a desired trait is obtained, and for ejecting the genome editing construct leaving minimal or no external construct sequences in the genome when done. In some embodiments, the genome editing construct is integrated into a random place in the genome of the cell. In some embodiments, the genome editing construct is integrated into a specific site in the cell. In some embodiments, the LF and RF sequences include or are included in T-DNA LB and RB sequences and the construct is integrated in a Ti plasmid preferred integration site. In some embodiments, the LF and RF sequences are essentially identical to a specific genomic sequence and the construct is integrated into the specific genomic sequence. The cell may be any type of cell, including a plant cell, a mammalian cell, a fish cell, a fungal cell, or an algal cell. In some embodiments, the cell is a plant cell, an algal cell, or a fungal cell. In some embodiments, the cell is a plant cell. In some embodiments, the plant is selected from a potato, soybean, rice, wheat, tomato, yam, beet, oat, and a sweet potato. In some embodiments, the plant is a tuber plant. In some embodiments, the plant is a potato. In some embodiments, the cell is a cell of a plant part, such as root, tuber, meristem, stem, leaf, flower, seed, or fruit. In some embodiments, the cell is a cell of a plant tuber. In some embodiments, the cell is a cell in a tissue culture. In some embodiments, the cell is a cell in an organism, an organ , a tissue, or a part of an organism, organ, or tissue. In some embodiments, the cell further includes a nucleic acid molecule including a gene targeting gRNA, or a sequence encoding a gene targeting gRNA. In some embodiments, the cell further includes a vector transiently expressing a gene targeting gRNA. In some embodiments, gene targeting gRNA is encoded by a sequence that is operably linked to a promoter for driving expression of the gene targeting gRNA. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is an RNA polymerase III promoter. Nonlimiting examples for an RNA polymerase III promoter include a potato US promoter (e.g., StU6-l-4). In some embodiments, the gene targeting gRNA is designed to target the granule-bound starch synthase (GBSS) gene. In some embodiments, the gene targeting gRNA includes a sequence essentially identical to GGTCCTTGGAGCAAAACTGG (SEQ ID NO: 4). In some embodiments, the cell further includes an additional genome editing construct. In some embodiments, the cell further includes at least one gene different from a corresponding native cell, the gene having been edited by the genome editing enzyme of the construct. Methods for genome editing by the platform of the invention In some embodiments, the present invention provides a method for genome editing of a desired gene in a genome, the method including: a) providing a population of the genome editing platform cells disclosed herein including the genome editing construct disclosed herein; b) contacting the genome editing platform cells with a nucleic acid molecule including a gene targeting gRNA or a sequence encoding a gene targeting gRNA, the gRNA designed to target a sequence of the desired gene; c) isolating genome editing platform cells in which the desired gene has been edited; and d) inducing expression of the excision gRNA, thereby leading to excision of the genome editing construct from the genome, leaving minimal or no sequence of the genome editing construct in the genome. It is appreciated that when the genome editing construct already includes a sequence encoding a gene targeting gRNA, editing of a desired gene may also be accomplished by the above method, when steps (a) and (b) are replaced by providing the genome editing platform cells disclosed herein including the genome editing construct disclosed herein which includes a sequence encoding a gene targeting gRNA which is designed to target a sequence of the desired gene. In some embodiments, the genome editing platform cells are obtained by the following steps: i. providing a population of cells in which genome editing is desired; and ii. contacting the cells with a nucleic acid molecule including the genome editing construct disclosed herein or the vector disclosed herein (according to any embodiment or combinations thereof), and causing the genome editing construct to integrate into the genome, thereby generating genome editing platform cells. In general, definitions and embodiments mentioned above, and which may be relevant to the methods, also apply here, and vice versa. Some particularly relevant embodiments may be pointed out or explicitly repeated. For terms used herein, unless stated otherwise, their definition and embodiments are intended to be the same as above (mutatis mutandis). The population of cells may be cells in a tissue culture or in a medium, or cells in an organism, or an organ, tissue, or part thereof. The cells may belong to any tissue, organ, or organism as described above. The contacting and integrating of step (ii) may be conducted by any suitable means, depending on the vector and the cells. In some embodiments, the contacting and integrating of step (ii) are conducted by agrobacterium-mediated T-DNA transformation of plant cells. In some embodiments, the contacting and integrating of step (ii) are conducted by genome editing methods. In some embodiments, the method further includes, after step (ii), a step of selecting for the presence of the positive selection gene, to enrich for cells in which the construct has integrated. Such selection depends on the positive selection gene. Non-limiting examples for positive selection genes include antibiotic-resistance genes, such as kanamycin / neomycin resistance (e.g. nptll), hygromycin, and BASTA. For neomycin resistance, this step includes growing the cells in the presence of G418. In some embodiments, steps (b) and (c) are repeated, each time with a different gene targeting gRNA. In some embodiments, steps (b) and (c) are repeated, each time with a gene targeting gRNA designed to target a different gene or a different sequence in the same gene. This is done in order to generate cells with multiple edited genes, or for trying different editing schemes. In some embodiments, the different gene targeting gRNAs each have a different sequence. In some embodiments, at least two different gene targeting gRNAs are designed to target different genes. In some embodiments, at least two different gene targeting gRNAs are designed to target different sequences in the same gene. In some embodiments, at least two different gene targeting gRNAs are designed to target the same sequence. This facilitates easily studying combinations of changes to determine which combinations are more successful for a certain purpose. If the genome editing construct already includes a sequence encoding a gene targeting gRNA, then the first iteration of gene editing is already done before starting the process described in the above method. In some embodiments, contacting the genome editing platform cells with a nucleic acid including the gene targeting gRNA or the sequence encoding the gene targeting gRNA in step (b) is conducted by using a viral, a lentiviral, or a retroviral expression vector including the gene targeting gRNA or the sequence encoding the gene targeting gRNA. In some embodiments, the gene targeting gRNA is added to the cells by any suitable way, including transformation, transduction, electroporation, and spraying. In some embodiments, the nucleic acid including the gene targeting gRNA or the sequence encoding the gene targeting gRNA is DNA. In some embodiments, the nucleic acid including the gene targeting gRNA or the sequence encoding the gene targeting gRNA is RNA. In some embodiments, the nucleic acid including the gene targeting gRNA or the sequence encoding the gene targeting gRNA is a transient expression vector, which does not integrate into the genome. In some embodiments, the gene targeting gRNA is more than one gene targeting gRNA. In some embodiments, the contacting in step (b) further includes adding an inducer to induce expression of the genome editing enzyme. In some embodiments, the gene targeting gRNA is inducible, and the method further includes a step between step (b) and step (c) of adding an inducer to express the gene targeting gRNA. Isolating genome editing platform cells in which the desired gene has been edited in step (c) generally requires identifying the change between the original and the edited gene and therefore depends on the edited gene. This may be done by a specific PCR or by sequencing, or by any other method suitable to identify the change. As explained above with respect to the genome editing construct, after genome editing is done, inducing expression of the excision gRNA may be done directly, e.g., when the gRNA is under control of an inducible promoter, or indirectly, e.g., as demonstrated herein, by removing a transcription terminator, or as a combination of both. In some embodiments, the excision gRNA expression is driven by an inducible promoter, and inducing expression of the excision gRNA in step (d) is done by adding an inducer capable of inducing the promoter driving expression of the gRNA. The inducer may be any suitable inducer, depending on the promoter used. Non-limiting examples for inducers are detailed hereinabove. Some examples include heat shock (inducing HSP promoters), isopropyl B-D-l-thiogalactopyranoside (IPTG, inducer of beta-galactose promoter), and tetracycline (inducer of Tet promoter). In some embodiments, the sequence encoding the excision gRNA is downstream from a transcription terminator which is flanked by REC sites, and inducing expression of the excision gRNA in step (d) is done by inducing a site-specific recombinase, such as Cre or FLT, as explained above. In some embodiments, expression of the site-specific recombinase is driven by an inducible promoter, and inducing of expression of the excision gRNA in step (d) is done by adding an inducer capable of inducing expression from the promoter driving expression of the site-specific recombinase. Non-limiting examples for inducers are detailed hereinabove. In some embodiments, expression of the site-specific recombinase is controlled by a exon skipping system (explained in more detail above), and inducing expression of the excision gRNA in step (d) is done by adding to the cells a polyamine, or a polyamine analog. In some embodiments, inducing expression of the excision gRNA in step (d) is done by a stress-inducing factor, such as heat stress, cold stress, high / low pH stress, and / or physical stress, which elevate cellular poly amine levels. In some embodiments, the method further includes, after step (d), a step of negative selection, to eliminate cells in which the construct is still present in the edited genome. Nonlimiting examples include cytosine / isoguanine deaminase (CodA) and Diphtheria toxin A fragment (DT-A). CodA is an Escherichia coli gene encoding cytosine deaminase that hydrolyzes 5-fluorocytosine (5-FC) into the cytotoxic compound 5 fluorouracil (5-FC). When 5-FC is added to the cell medium, cells still including CodA in the genome are eliminated. In some embodiments, the step of negative selection includes growing the cells with 5-FC. In some embodiments, the present invention provides a modified organism, organ, tissue, or part of an organism, an organ, or a tissue, prepared by the method disclosed herein, or including the gene editing platform cells disclosed herein. In some embodiments, the organism is a plant. In general, definitions and embodiments mentioned above, and which may be relevant to the organism, also apply here, and vice versa. Some particularly relevant embodiments may be pointed out or explicitly repeated. For terms used herein, unless stated otherwise, their definition and embodiments are intended to be the same as above (mutatis mutandis). Applications of the construct and system of the invention Gene discovery platform The process of crossing to generate novel strains is very tedious, requiring intense selection and backcrossing using molecular markers, and is especially challenging when trying to identify complex traits. The present invention facilitates rapid generation of specific combinations of alleles, for examining the phenotypic effect and using the information obtained to shorten the crossing process. This testing is conducted by a method somewhat similar to the method for genome editing described above, but with some changes, as provided below. In some embodiments, the present invention provides a method for testing development of a desired trait, the method including: a) providing a population of the genome editing platform cells disclosed herein including the genome editing construct disclosed herein; b) contacting the genome editing platform cells with a nucleic acid molecule including a gene targeting gRNA, or a sequence encoding a gene targeting gRNA, the gRNA being designed to target a sequence of the desired gene; c) isolating genome editing platform cells in which the desired gene has been edited; d) testing characteristics of the isolated cells; and e) repeating steps (b)-(d), each time using a different gene targeting gRNA, until the testing provides a desired outcome. In general, definitions and embodiments mentioned above, and which may be relevant to the methods, also apply here, and vice versa. Some particularly relevant embodiments may be pointed out or explicitly repeated. For terms used herein, unless stated otherwise, their definition and embodiments are intended to be the same as above (mutatis mutandis). In some embodiments, the different gene targeting gRNAs used in the iterations in step (e) each have a different sequence. In some embodiments, the different gene targeting gRNAs used in the iterations in step (e) are each directed to a different gene. In some embodiments, at least two of the different gene targeting gRNAs used in the iterations in step (e) are directed to different sequences in the same gene. In some embodiments, at least two of the different gene targeting gRNAs used in the iterations in step (e) are directed to the same sequence. The testing in step (d) is conducted according to the characteristics to be evaluated. A nonlimiting example for testing characteristics of isolated cells is by Lugol's staining of tuber amyloplasts, testing for GBSS gene knockout. Since the staining binds to amylose, wild-type amyloplast are colored blue, but amyloplasts in a tuber in which the GBSS has been knocked out have only amylopectin, and exhibit a red-brownish color. The desired outcome of step (e) depends on the desired trait. In the above GBSS knockout example, red-brownish staining may represent the desired outcome. As stated above, high-amylopectin potatoes offer significant industrial value since their starch easily gelatinizes into a clear, stable paste, making them ideal for food processing as thickeners, stabilizers, and emulsifiers. Their superior freeze-thaw stability prevents syneresis, ensuring better performance in frozen products. Additionally, their high amylopectin content enhances ethanol production efficiency, making them a valuable raw material for biofuel and alcoholic beverage industries. If desired, the construct may be excised from the genome, as described in step (e) and relevant embodiments detailed with reference to the above genome editing method. Non-limiting example for use of the above method are provided below. Susceptibility (S) genes are plant genes which support microbial infection and facilitate its tolerance to a pathogen, for example late blight, caused by Phytophthora infestans, a fungus-like microorganism in potatoes and tomatoes. The genome editing platform of the present invention facilitates rapidly generating and testing different combinations of S genes. The information provided by the different combinations helps to quickly focus on the more successful combinations for using in the crossings. In some embodiments, the gene targeting gRNAs are designed to target S plant genes and the desired trait is resistance to late blight. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. All nucleic acid sequences are presented 5’-3’. The term “bp” means base pairs. The term "a" and "an" refers to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. The term "about" when referring to a measurable value such as an amount, a ratio, and the like, is meant to encompass variations of ±10% of the indicated value, as such variations are also suitable to perform the disclosed invention. Any numerical values appearing in the application are intended to be construed as if preceded by “about”, unless indicated otherwise. While certain embodiments of the invention have been illustrated and described, it will be clear that the invention is not limited to the embodiments described herein. Numerous modifications, changes, variations, substitutions, and equivalents will be apparent to those skilled in the art without departing from the spirit and scope of the present invention as described by the claims, which follow. EXAMPLES Materials and Methods Plant material and growth conditions Experiments were performed using potato plants (Solanum tuberosum L. cv. Desiree or Russet Burbank). Plants were cultivated on Murashige and Skoog (MS) medium supplemented with 3% (w / v) sucrose (Duchefa Biochemie, The Netherlands) and solidified with agar in plates or jars. The plants were maintained in a culture room at a constant temperature of 24 °C under a 16 hour light / 8 hour dark photoperiod. Plasmid construction. The constructs were cloned between the left and the right borders of the Agrobacterium binary vector pPZP221 (GenBank: U10491.1; Hajdukiewicz and Maliga, 1994, Plant Mol Biol 25(6):989-994). The specific components of the constructs used in the below examples are as follows (5'-3'; see Fig. 1 (left-right): 1. A left border (LB) of the T-DNA repeat (bases 6398-6422; GenBank: U10491.1); 2. A gRNA recognition sequence followed by a protospacer adjacent motif (PAM): ttaaactatcagtgtttgacAGG, SEQ ID NO: 1; 3. The Arabidopsis thaliana constitutive Ubiquitin 10 promoter (UBQlOp) accession number AT4G05320 in The Arabidopsis Information Resource (TAIR), positioned 1,327 bp upstream of an AUG of a neomycin resistance gene (nptll) coding sequence (see Item no. 5) and further including a 5' UTR and an intron of the UBQ10 gene (GenBank accession AC012392.1 bases 2536-3830). 4. A LoxP sequence inserted following the UBQ10 intron -ATAACTTCGTATAGCATACATTATACGAAGTTAT, SEQ ID NO: 3. 5. A neomycin resistance gene (nptll) coding sequence (GenBank: EF212293.1 bases 42945088); 6. An octopine synthase (OCS) terminator (GenBank: EF212293.1 bases 5089-5830); 7. A second LoxP sequence identical to the first LOXp sequence; 8. A complex of tRNA(Gly, GenBank AC011001.2 bases 23872- 23948) - guide RNA (TTAAACTATCAGTGTTTGAC, SEQ ID NO: 2) - scaffold RNA (Protein databank (PDB) 8T6P_B bases 11-86) - tRNA(Gly) - exonuclease (RefSeq NM_011907.4 bases 82789); 9. Cauliflower mosaic virus 35S terminator (GenBank EU049862.1 bases 2808- 2965); 10. Three optional promoters derived from Arabidopsis thaliana genome, TAIR accessions: AT1G76200 (NADH dehydrogenase ubiquinone 1 beta subcomplex subunit, construct 56), AT2G27520 (F-box and associated interaction domains-containing protein, construct 61), and At5g45420 (membrane anchored MYB, construct 62), and; ll.Cre recombinase including an exon skipping regulatory element disclosed in WO2020141528 (GenBank CP 164919.1 bases 33776-32745). 12. A Nopaline synthase terminator (GenBank AB551245.2 bases 11636- 11888); 13. A Mannopine synthase promoter (GenBank KP638478.1 bases 362-742); 14. A cytosine / isoguanine deaminase (coda) - negative selection (GenBank JQ284303.1 bases 7434-8717); [accession:] 15. Cauliflower mosaic virus 35S terminator (same as Item 9); 16. Cauliflower mosaic virus 35S promoter X2 (GenBank EU049862.1 bases 509-1180); 17. Cas9 encoding sequence (contains a modified second intron of the potato ST-LS1 gene) (e.g., ON773610.1 bases 5107-9396); 18. Cauliflower mosaic virus 35S terminator (same as Item 9); 19. gRNA recognition sequence followed by PAM sequence identical to the sequence in Item 2 but in reverse orientation. 20. A right border (RB) of the T-DNA repeat, GenBank U10491.1, bases 8594-8618. In addition, constructs 56, 61, and 62 included, in addition to the basic cassette described above, an RNA polymerase III StU6-l promoter (Johansen, et al. "High efficacy full allelic CRISPR / Cas9 gene editing in tetrapioid potato." Scientific Reports 9.1 (2019): 17715) positioned between the Cas9 terminator and the RB. The promoter was followed by a guide RNA (gRNA) sequence GGTCCTTGGAGCAAAACTGG (SEQ ID NO: 4), designed to target the granulebound starch synthase (GBSS) gene (Fig. 2). A scaffold sequence as described above and a poly-T terminator were included downstream of the gRNA to ensure proper expression and termination of the gRNA. Generation of transgenic plants. Sterile potato (Solanum tuberosum) leaf discs were transformed using an Agrobacterium tumefaciens-mediated protocol with modifications based on Ginzberg et al. (Ginzberg et al., "Induction of potato steroidal glycoalkaloid biosynthetic pathway by overexpression of cDNA encoding primary metabolism HMG-CoA reductase and squalene synthase." Planta 235 (2012): 1341-1353.). The leaf discs were incubated with Agrobacterium suspension for 5-10 minutes and then placed in MS medium containing 3% (w / v) sucrose (Sue) and 200 pM acetosyringone (AS; Sigma-Aldrich, Israel). The cultures were incubated in the dark at 24°C for 48 hours. The explants were subsequently transferred to MS medium supplemented with 3% (w / v) Sue, 0.1 mg / L 6-benzylaminopurine (BA; Sigma-Aldrich), 5 mg / L naphthalene acetic acid (NAA; Duchefa), 500 mg / L Claforan (Cefotaxime; Duchefa), and 50 mg / L kanamycin (Kan; Duchefa). The plates were incubated at 24°C under a 16-hour light / 8-hour dark photoperiod for 10 days. After this period, the explants were transferred to a selection medium consisting of MS medium with 3% (w / v) Sue, 2 mg / L zeatin riboside (Duchefa), 0.02 mg / L gibberellic acid (GAs; Duchefa), 0.02 mg / L NAA, 500 mg / L Claforan, and 50 mg / L kanamycin. The explants were maintained on the selection medium for approximately 6 weeks, during which regenerated plantlets were developed. Regenerated plantlets were transferred to a rooting medium including MS medium with 3% (w / v) Sue, 500 mg / L Claforan, and 50 mg / L kanamycin. DNA extraction Genomic DNA was extracted from plant leaf or stem tissue using the Wizard® Genomic DNA Purification Kit (Promega, USA). The extraction was performed following the manufacturer's protocol to ensure the recovery of high-quality DNA suitable for downstream applications. Quantitative PCR (qPCR) Quantitative PCR reactions were prepared using 4 pL of genomic DNA (20-25 ng / pL), 200 nM of forward and reverse primers (primer sequences listed in Table 1), and 5 pL of ABsolute Blue™ QPCR Mix, SYBR Green (Thermo Fisher Scientific, Germany). Reaction efficiencies for each primer set were determined using a series of genomic DNA dilutions. All reactions were performed on a CFX Connect™ Real-Time PCR Detection System (BioRad, Singapore) under the following thermal cycling conditions: 3min 95°C, 40 times (10 s 95°C; 30 s 60°C), followed by melting curve generated from 65°C to 90°C. Two technical replicates were conducted for each sample, T-DNA and reference sequence. Raw data were analyzed using Bio-Rad CFX Manager 3.1 software, and T-DNA content was quantified using the AACt method as described by Livak and Schmittgen (Livak & Schmittgen (2001) Analysis of relative gene expression data using real time quantitative PCR and the 2AACT method. METHODS 25, 402408). Primers 424 and 425 were used to assess the abundance of NPTII, while primers 436 and 437 were used to evaluate the abundance of Cas9. The Elongation factor 1-alpha (EFl) gene (accession: AB061263.1) served as the reference, using primers 430 and 431. 5 Lugol staining of starch granules Isolated starch granules were stained using Lugol’s solution prepared with glycerol and distilled water in a 1:1:1 ratio. The stained samples were analyzed under a light microscope (Leica Microsystems) to assess starch composition. 10 Table 1: Primer sequences Description Name SEQID Sequence qPCR Cas FW 436 5 AAAGGGAAACGAGCTTGCTC qPCR Cas RV 437 6 TGTGCTGCTCAACGAAAAGT qPCR NPTII FW 424 7 GTTGTCACTGAAGCGGGAAG qPCR NPTII RV 425 8 GTAGCCGGATCAAGCGTATG qPCREFl FW 430 9 ATTGGAAACGGATATGCTCCA qPCREFl RV 431 10 TCCTTACCTGAACGCCTGTCA Left border region FW 155 11 CGCCAAGCTCTTCAGCAATA Left border region RV 156 12 ACTGGGCACAACAGACAATC Middle region FW 147 13 CCGCGCGCGATAATTTATC Middle region RV 330 14 GGCGCTAAGGATGACTCTGG Right border region FW 249 15 CAAGCTAAGCTTAGGCCTGTCG Right border region RV 288 16 TTATGCGGACACTGACGGCT GBSSFW 349 17 GGCAAGCATCACAGCTTCACAC GBSSRV 350 18 CGATGTCCGCGGGCCTAAATG Example 1: Gene editing efficiency of different constructs In the demonstrated systems, a specific system for controlling the Cre expression was used, described briefly above, and in more detail in WO2020141528. 15 The constructs described above (56, 61, and 62), including three different promoters (TAIR acc. AT1G76200, AT2G27520, and At5g45420, respectively) driving the expression of Cre recombinase, were prepared and transformed into potato plants. From each promoter, at least 20 independent lines were analyzed. To evaluate the gene editing efficiency of the different constructs, a guide RNA (gRNA) designed to target the granule-bound starch synthase (GBSS) gene under the control of a StU6-l promoter was added to the construct. GBSS is essential for amylose synthesis in potato tubers. Starch, a semicrystalline polymer, is composed predominantly of two polysaccharides: amylose and amylopectin. Amylose, constituting 20-30% of tuber starch, is a linear polymer of a-D-glucose units linked by a-(l,4) bonds. Its synthesis relies on enzymatic activity of GBSS and the substrate ADP-glucose. Amylopectin, which includes 70-80% of tuber starch, is a highly branched polysaccharide with short a-(l,4)-glucan chains joined by a-(l,6) bonds at branch points. Knockout of the GBSS gene via gene editing results in tubers containing nearly 100% amylopectin. This functional disruption was used to evaluate effect of gene editing in knocking out the GBSS gene. To confirm GBSS gene editing, PCR amplification of the target sequence followed by digestion with Bsrl was used. The Bsrl restriction site coincides with the Cas9 cleavage site (Fig. 2) and therefore edited fragments lack the restriction site and remain undigested by Bsrl. To further characterize the mutation in the GBSS the amplified PCR product was sent for NGS sequencing. As shown in Figs. 3A-3B, all constructs were able to drive gene editing of the GBSS gene. However, constructs with different Cre promoters demonstrated variable gene editing frequencies. For example, plants transformed with the 61 construct exhibited the highest percentage of edited independent lines (95%; Fig. 3A) and the highest percentage of fully edited lines (30%; Fig. 3B). The results demonstrate the efficacy of the constructs in inducing targeted GBSS knockout, showcasing their potential for starch composition modification in potato tubers Example 2: Excision efficiency of constructs After identifying edited lines, each line was propagated and Cre recombinase expression was induced by the addition of a polyamine or a polyamine analogue, which induces expression in the system described in WO2020141528. As control, the same line was used without induction. DNA samples were collected from each line after 4 weeks. Following induction, the NPTII gene with its terminator is first removed by the recombinase, followed by expression of the gRNA and the exonuclease, directing the genome editing enzyme to fully remove the construct. Accordingly the NPTII deletion is an indication for successful induction of the recombinase and the genome editing enzyme deletion is an indication for complete construct extraction. The ability of the constructs to be excised from the genome following induction (IND) was assessed in two construct 61 lines (61-22 and 61-25) by using qPCR for testing for the presence of the positive selection gene NPTII and of the Cas9 gene. As shown in Figs. 4A (NPTII) and 4B (Cas 9), excision was observed for both the NPTII gene and the Cas9 gene, indicating that both steps were successful. The result presented for line 61-22 (Fig. 4B) reflects about 94% excision frequency 4 weeks after induction (relative Cas9 abundance of 0.06 in the induced compared to uninduced). Example 3: Negative selection and full construct excision In order to reach to 100% excision, leaf discs and internodes from each induced line were transferred to a regeneration medium supplemented with 5-fluorocytosine for negative selection. In line 62-27 (based on construct 62), full construct excision was achieved, as shown in Figs. 5A-5C. PCR analysis was conducted using primers flanking the left border (primers 155 and 156), the middle region (primers 147 and 330, amplifying a sequence between the recombinase and its terminator), and the right border (primers 249 and 288) of the construct. These analyses verified the complete absence of the construct, indicating successful and complete excision. Additionally, full gene editing of the granule-bound starch synthase (GBSS) gene was demonstrated in this line by PCR amplification of the target sequence using primers 349 and 350 followed by digestion with Bsrl was used to confirm editing (Fig. 5D). The Bsrl restriction site coincides with the Cas9 cleavage site, therefore, edited fragments lacked the restriction site and remained undigested by Bsrl. Additionally, the PCR product was also sent for NGS sequencing (Fig. 5E). Additionally, the T-DNA insertion point in the uninduced lines and the complete construct extraction in the induced lines were sequenced by next generation sequencing (NGS) followed by PCR and / or sanger sequencing. Further confirmation of the GBSS editing effect in the same cell line was obtained by analyzing tuber starch composition through Lugol staining. In wild-type (WT) tubers, the presence of amylose at the starch granules produced a dark blue color, whereas amylose-free tubers (amylopectin only) exhibited red-brownish colored starch granules, characteristic of successful GBSS knockout (Fig. 6).
Claims
1. An inducibly removable genome editing nucleic acid construct for clean editing of sequences in a genome, the genome editing construct comprising:- a left flanking (LF) sequence and a right flanking (RF) sequence defining the 5’ and 3’ ends of the construct, respectively, each comprising a target site for an excision gRNA;- a sequence encoding a genome editing enzyme;- a sequence encoding at least one inducible excision gRNA located downstream from a general promoter and designed to target the target sites in the LF and RF sequences; and- a sequence encoding an exonuclease designed to be transcribed together with the at least one excision gRNA,wherein expression of the at least one excision gRNA leads to excision of the genome editing construct from the genome by the genome editing enzyme and the exonuclease, leaving minimal or no sequence of the genome editing construct in the genome after the excision.
2. The genome editing construct of claim 1, further comprising:- a sequence encoding an inducible site-specific recombinase;- a first and a second recombination (REC) sites, which are recognizable by the site-specific recombinase and are positioned between the general promoter and the sequences encoding the at least one excision gRNA and the exonuclease; and- at least one transcription termination signal positioned between the first and the second REC sites,wherein cleavage at the first and second REC sites by the inducible site-specific recombinase results in removal of the at least one transcription termination signal, thereby facilitating expression of the at least one excision gRNA and the exonuclease.
3. The genome editing construct of claim 2, wherein the site-specific recombinase is selected from Cre, Hin, Tre, FLP, FRT, KDRT, B3RT.
4. The genome editing construct of claim 3, wherein the site-specific recombinase is Cre and the first and second REC sites are LoxP sequences.
5. The genome editing construct of any one of claims 2-4, wherein the inducible recombinase is under the control of an inducible promoter such as a heat shock promoter or a Tet inducible promoter.
6. The genome editing construct of any one of claims 2-4, wherein the inducible recombinase is controlled by an inducible exon skipping system.
7. The genome editing construct of any one of claims 1-6, wherein the general promoter is a constitutive promoter.
8. The genome editing construct of any one of claims 1-7, wherein the excision gRNA target sites in the LF sequence and the RF sequence are essentially identical to each other, and are positioned in a reverse orientation with respect to one another.
9. The genome editing construct of any one of claims 1-8, wherein the LF sequence and RF sequence comprise sequences of a desired genomic sequence.
10. The genome editing construct of any one of claims 1-8, wherein the LF sequence and RF sequence comprise or are comprised in a left border (LB) and a right border (RB), respectively, of a T-DNA of a Ti plasmid-based vector.
11. The construct of any one of claims 1-10, wherein the genome editing enzyme is selected from a clustered regularly interspaced short palindromic repeats (CRISPR) system enzyme such as Cas9 or Cas 12, a meganuclease, a zinc finger nuclease (ZFN), a transcription-activator like effector nuclease (TALEN), and a prime editing system, or any other enzyme known in the art for gene editing.
12. The genome editing construct of any one of claims 1-11, wherein the genome editing enzyme is under the control of a constitutive promoter, such as cauliflower mosaic virus (CaMV) 35S or a duplicated CaMV 35S.
13. The genome editing construct of any one of claims 1-11, wherein the genome editing enzyme is under the control of an inducible promoter.
14. The genome editing construct of any one of claims 1-13, wherein the exonuclease is a DPD1 or a TREX family exonuclease.
15. The genome editing construct of any one of claims 1-14, wherein the at least one excision gRNA and the exonuclease are located in a single transcription unit.
16. The genome editing construct of any one of claims 1-15, wherein the sequence between the at least one excision gRNA and the exonuclease comprises at least one sequence encoding a selfcleaving element, such as a self-cleaving tRNA.
17. The genome editing construct of any one of claims 1-16, further comprising a positive selection gene.
18. The genome editing construct of claim 17, wherein the positive selection gene is selected from an antibiotic gene, such as kanamycin / neomycin resistance, hygromycin, or BASTA.
19. The genome editing construct of any one of claims 1-18, further comprising a sequence encoding a negative selection gene, which is capable of ablation of cells carrying the gene.
20. The genome editing construct of claim 19, wherein the negative selection gene is selected from CodA and DT-A.
21. The genome editing construct of any one of claims 1-20, further comprising gene targeting gRNA which is designed to target a sequence of a desired gene.
22. A vector comprising the genome editing construct of any one of claims 1-21.
23. The vector of claim 22, which is a Ti plasmid-based vector.
24. A genome editing platform cell comprising the genome editing construct of any one of claims 1-21, integrated into the cell genome.
25. The genome editing platform cell of claim 24, wherein the cell is a plant cell, a mammalian cell, an algal cells, or a fungal cell.
26. The genome editing platform cell of claim 25, wherein the plant is selected from a potato, a sweet potato, or a tomato.
27. The genome editing platform cell of any one of claims 24-26, wherein the cell is in cell culture.
28. The genome editing platform cell of any one of claims 24-26, wherein the cell is in an organism, an organ, or a tissue.
29. The genome editing platform cell of any one of claims 24-28, further comprising a nucleic acid molecule comprising a gene targeting gRNA or a sequence encoding a gene targeting gRNA, the gene targeting gRNA being designed to target a desired sequence.
30. A method for genome editing of a desired gene in a genome, the method comprising:a) providing a population of the genome editing platform cells of any one of claims 24-28;b) contacting the genome editing platform cells with a nucleic acid molecule comprising a gene targeting gRNA or a sequence encoding a gene targeting gRNA, the gRNA being designed to target a sequence of the desired gene;c) isolating genome editing platform cells in which the desired gene has been edited; andd) inducing expression of the excision gRNA, thereby leading to excision of the genome editing construct from the genome, leaving minimal or no sequence of the genome editing construct in the genome.
31. The method of claim 30, wherein the genome editing platform cells are obtained by the following steps:i. providing a population of cells in which genome editing is desired; andii. contacting the cells with a nucleic acid molecule comprising the genome editing construct of any one of claims 1-21 or the vector of claim 22 or 23, and causing the genome editing construct to integrate into the genome, thereby generating genome editing platform cells.
32. The method of claim 31, wherein step (ii) of contacting the cells with the genome editing construct and causing the genome editing construct to integrate into the genome is conducted by agrobacterium-mediated T-DNA transformation of plant cells.
33. The method of any one of claims 30-32, wherein steps (b) and (c) are repeated more than once, each time by using a different gene targeting gRNA.
34. The method of any one of claims 30-33, wherein contacting the genome editing platform cells in step (b) is conducted by using a viral, a lentiviral, or a retroviral expression vector comprising the gene targeting gRNA, or the sequence encoding the gene targeting gRNA.
35. A modified organism prepared by the method of any one of claims 30-34.
36. The modified organism of claim 35, wherein the modified organism is a plant.
37. A method for testing development of a desired trait, the method comprising:a) providing a population of the genome editing platform cells of any one of claims 24-28;b) contacting the genome editing platform cells with a nucleic acid molecule comprising a gene targeting gRNA, or a sequence encoding a gene targeting gRNA, the gRNA being designed to target a sequence of the desired gene;c) isolating genome editing platform cells in which the desired gene has been edited;d) testing characteristics of the isolated cells; ande) repeating steps (b)-(d), each time using a different gene targeting gRNA, until the testing provides a desired outcome.