Eimeria Tenella complex immunity regulation type DNA vaccine

Abstract

The invention relates to an Eimeria tenella composite immunoregulation type DNA vaccine, belonging to a technical field of biological animal drug. The invention utilizes molecule biological technique to clone gene fragments centralized in the spore gene SO7 and the 2nd generation merozoite gene MZ5-7 T cell epitope of Eimeria tenella, two fragments of the SO7 are respectively named as s1 and s2, two fragments of the MZ5-7 are respectively named as m1 and m2. The four fragments are connected in series with eukaryotic expression vector pVAX1, and also connected with Chicken interferon gamma (chIFN-gamma) gene, so as to generate a centralized multi-phase antigen gene fragment containing T-cell epitope and also a composite immunoregulation type DNA vaccine pVAX1-m1-m2-s1-s2-chIFN-gamma containing chIFN-gamma gene as immune adjuvant. The invention can prevent and cure coccidiosis of chicken.

Description

technical field

[0001] The invention relates to the technical field of biological veterinary medicine, and is an immunoregulatory DNA vaccine capable of preventing chicken coccidiosis. Background technique

[0002] Chicken coccidiosis is a kind of parasitic protozoan disease that seriously harms intensive chicken industry production and is prevalent in the world, and the economic loss caused by it is as high as more than 2 billion pounds every year (Williams RB. A compartmentalized model forestimation of the cost coccidiosis to the world's chicken production industry. Int J Parasitol 1999; 29: 1209-1229.). At present, anticoccidial drugs are still the main means of preventing and controlling chicken coccidiosis. With the increasingly serious problem of chicken coccidiosis resistance and people's increasing concern for food safety, people expect to replace the use of anticoccidial drugs with more ideal methods . The successful development and application of coccidiosis live...

Examples

Embodiment 1

[0039] Antigen epitope analysis of embodiment 1.SO7 and MZ5-7 gene (see Fig. 7)

[0040] DNAstar software was used to analyze the epitopes of the two gene sequences, and two sequences with relatively concentrated T cell epitopes were determined respectively, SO7 was s1 and s2, and MZ5-7 was m1 and m2.

[0041] The nucleotide sequences of s1, s2, m1 and m2 are respectively 1-324 bases, 334-684 bases, 691-975 bases and 982-1221 bases of SEQ ID NO.1 .

[0042] The selection parameters (Figure 7) are:

[0043] 1. Hydropathy-Hopp-Woods- Finding the epitope of a protein by calculating the maximum local hydrophilicity on the protein sequence

[0044] 2. Antigenicity-AMPHI-prediction of immunodominant helper T lymphocyte antigenic sites based on sequence

[0045] 3. Antigenicity-Rothbard-Taylor-prediction of potential T lymphocyte antigenic determinants containing specific motifs (motif)

[0046] 4. Antigenicity-Jameson-Wolf-Predict potential protein epitopes by combining existing...

Embodiment 2

[0047] Embodiment 2.s1, s2, the cloning of m1 and m2 and the construction of recombinant plasmid (seeing figure 8)

[0048] According to the different requirements for restriction sites and reading frames of the constructed recombinant plasmids, five pairs of specific primers were designed using the software primerpremier5.0, and sent to TaKaRa to synthesize primers. The sequence is as follows:

[0049] m1 upstream primer: 5'aaagctagcatgcaggaagtgccag3'

[0050] m1 downstream primer: 5'gggaagcttttggataaggacttcatca3'

[0051] m2 upstream primer: 5'aagcttatgcaaacacttgaa3'

[0052] m2 downstream primer: 5'ggtaccttgagttagcatgccgata3'

[0053] S1 upstream primer: 5'ttaggtaccgacctcttcagcggactc g3'

[0054] S1 downstream primer: 5'aaagaattccagcgcgcagcagct 3'

[0055] S2 upstream primer: 5'ccccccgaattcaaactggccctcg 3'

[0056] s2 downstream primer: 5'aaagcggccgccgccccgtagct3'

[0057] chIFN-γ upstream primer: 5'ttagcggccgcaatgacttgcca3'

[0058] chIFN-γ downstream primer: 5'ccc...

Embodiment 3

[0062] Example 3 Recombinant plasmid RT-PCR detection (see Figure 9)

[0063] A large number of recombinant plasmids were extracted, and the 7-day-old chicks (100 μg / piece) were injected into the leg muscles respectively. One week later, the injected site (leg muscle) and the non-injected site muscle (chest) were respectively extracted. Total RNA was extracted by one-step method, and DnaRase was added to remove The remaining recombinant plasmid and genomic DNA were used to amplify the target gene by RT-PCR using the total mRNA as a template.

technical field

[0001] The invention relates to the technical field of biological veterinary medicine, and is an immunoregulatory DNA vaccine capable of preventing chicken coccidiosis. Background technique

[0002] Chicken coccidiosis is a kind of parasitic protozoan disease that seriously harms intensive chicken industry production and is prevalent in the world, and the economic loss caused by it is as high as more than 2 billion pounds every year (Williams RB. A compartmentalized model forestimation of the cost coccidiosis to the world's chicken production industry. Int J Parasitol 1999; 29: 1209-1229.). At present, anticoccidial drugs are still the main means of preventing and controlling chicken coccidiosis. With the increasingly serious problem of chicken coccidiosis resistance and people's increasing concern for food safety, people expect to replace the use of anticoccidial drugs with more ideal methods . The successful development and application of coccidiosis live...

Examples

Embodiment 1

[0039] Antigen epitope analysis of embodiment 1.SO7 and MZ5-7 gene (see Fig. 7)

[0040] DNAstar software was used to analyze the epitopes of the two gene sequences, and two sequences with relatively concentrated T cell epitopes were determined respectively, SO7 was s1 and s2, and MZ5-7 was m1 and m2.

[0041] The nucleotide sequences of s1, s2, m1 and m2 are respectively 1-324 bases, 334-684 bases, 691-975 bases and 982-1221 bases of SEQ ID NO.1 .

[0042] The selection parameters (Figure 7) are:

[0043] 1. Hydropathy-Hopp-Woods- Finding the epitope of a protein by calculating the maximum local hydrophilicity on the protein sequence

[0044] 2. Antigenicity-AMPHI-prediction of immunodominant helper T lymphocyte antigenic sites based on sequence

[0045] 3. Antigenicity-Rothbard-Taylor-prediction of potential T lymphocyte antigenic determinants containing specific motifs (motif)

[0046] 4. Antigenicity-Jameson-Wolf-Predict potential protein epitopes by combining existing...

Embodiment 2

[0047] Embodiment 2.s1, s2, the cloning of m1 and m2 and the construction of recombinant plasmid (seeing figure 8)

[0048] According to the different requirements for restriction sites and reading frames of the constructed recombinant plasmids, five pairs of specific primers were designed using the software primerpremier5.0, and sent to TaKaRa to synthesize primers. The sequence is as follows:

[0049] m1 upstream primer: 5'aaagctagcatgcaggaagtgccag3'

[0050] m1 downstream primer: 5'gggaagcttttggataaggacttcatca3'

[0051] m2 upstream primer: 5'aagcttatgcaaacacttgaa3'

[0052] m2 downstream primer: 5'ggtaccttgagttagcatgccgata3'

[0053] S1 upstream primer: 5'ttaggtaccgacctcttcagcggactc g3'

[0054] S1 downstream primer: 5'aaagaattccagcgcgcagcagct 3'

[0055] S2 upstream primer: 5'ccccccgaattcaaactggccctcg 3'

[0056] s2 downstream primer: 5'aaagcggccgccgccccgtagct3'

[0057] chIFN-γ upstream primer: 5'ttagcggccgcaatgacttgcca3'

[0058] chIFN-γ downstream primer: 5'ccc...

Embodiment 3

[0062] Example 3 Recombinant plasmid RT-PCR detection (see Figure 9)

[0063] A large number of recombinant plasmids were extracted, and the 7-day-old chicks (100 μg / piece) were injected into the leg muscles respectively. One week later, the injected site (leg muscle) and the non-injected site muscle (chest) were respectively extracted. Total RNA was extracted by one-step method, and DnaRase was added to remove The remaining recombinant plasmid and genomic DNA were used to amplify the target gene by RT-PCR using the total mRNA as a template.

Images