A screening method for identifying nucleotide fragments of related microorganisms

Abstract

The application discloses a screening method for identifying nucleotide fragments of close relatives of microorganisms, which comprises the following steps: cutting the whole gene sequence of a target microorganism into small nucleic acid fragments containing overlapping regions by using an electronic cutting technology; comparing the fasta file of the small nucleic acid fragments with the NCBI NT database; obtaining a hit table I, deleting repeated sequences, and then obtaining hit nucleic acid sequences; comparing the hit nucleic acid sequences I with the small nucleic acid fragments containing overlapping regions, and obtaining non-hit nucleic acid sequences; repeating the above steps once, designing PCR primers, extracting the genomic total DNA of more than 10 strains of strains belonging to the genus or close genus of the target microorganism strain, constructing a nucleic acid pool, and verifying by PCR amplification. The specific nucleic acid screening method for identifying close relatives provided by the application can efficiently obtain specific nucleic acid sequences of the target microorganism strain in a large amount, the reproducibility of the experimental results is extremely high, the whole experimental process is simplified, and the method has good applicability.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of microbial informatics, and particularly relates to a screening method for identifying nucleic acid fragments of closely related microorganisms. BACKGROUND

[0002] Identifying closely related microorganisms has always been an important work for microbial breeders, especially for experts in the research of plant growth-promoting bacteria. Traditional identification methods based on morphology, physiology and biochemical characteristics have many defects, for example, it is difficult to identify microorganisms within the same genus because their morphological, physiological and biochemical characteristics are basically similar.

[0003] With the development of molecular biology and bioinformatics technology, and the completion of more and more microbial genome sequencing, various methods using DNA fragments as molecular markers for identifying species have been developed. These technologies have the characteristics of strong specificity, high accuracy, strong repeatability and short time, and have been widely used in the analysis and identification of various disease-causing microorganisms and environmental microorganisms. However, these technologies are difficult to distinguish different strains within the same genus because they are highly specific to nucleic acid sequences of specific species. It is difficult to screen specific nucleic acid sequences for a specific target microorganism. SUMMARY

[0004] The purpose of the present application is to provide a screening method for identifying nucleic acid fragments of closely related microorganisms to solve the problem of difficulty in identifying different strains within the same genus in the prior art.

[0005] To solve the above technical problems, the present application adopts the following technical solutions:

[0006] A screening method for identifying nucleic acid fragments of closely related microorganisms, characterized in that the method comprises the following steps:

[0007] (1) obtaining the whole genome sequence of the target microorganism;

[0008] (2) using the electronic cutting technology of the splitter online software to cut the genome sequence of the target strain into small nucleic acid fragments containing 100-500 bp overlapping regions, each with a length of 200-1500 bp; the website of the splitter online software is: http: / / www.bioinformatics.nl / emboss-explorer / .

[0009] (3) aligning the fasta file of the small nucleic acid fragments containing overlapping regions obtained in step (2) in the NCBI NT database;

[0010] (4) obtaining hit nucleic acid sequence I by deleting repetitive sequences from hit table I obtained after step (3) alignment.

[0011] (5) The hit nucleic acid sequence I obtained in step (4) is aligned with the small nucleic acid fragments containing overlapping regions obtained in step (2) to obtain a non-hit nucleic acid sequence I;

[0012] (6) The non-hit nucleic acid sequence I obtained in step (5) is aligned again in the NCBI NT database to obtain a hit table II, and the repeated repetitive sequences are deleted to obtain a hit nucleic acid sequence II;

[0013] (7) Step (5) is repeated, and the hit nucleic acid sequence II obtained in step (6) is aligned with the small nucleic acid fragments containing overlapping regions obtained in step (2) to obtain a non-hit nucleic acid sequence II, and the non-hit nucleic acid sequence II column is the strain-specific nucleic acid fragment of the possible target microorganism;

[0014] (8) The PCR primers are designed with the strain-specific nucleic acid fragment of the possible target microorganism obtained in step (7) as a template;

[0015] (9) The genomic total DNA of 10 or more strains of the genus or close genus to which the target microorganism strain belongs is extracted to construct a nucleic acid pool;

[0016] (10) The genomic DNA of the target microorganism strain and the nucleic acid pool obtained in step (9) are respectively used as templates, and the primers designed in step (8) are used as primers for PCR amplification, and the amplification product is detected by agarose electrophoresis;

[0017] If the PCR detection with the genomic DNA of the target microorganism strain as a template is positive, and the PCR detection with the nucleic acid pool obtained in step (9) as a template is negative, the nucleic acid fragment corresponding to the primer pair is the specific nucleic acid fragment for identifying the target microorganism strain.

[0018] When the nucleotide sequence is submitted to the NCBI NT database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK LOC=blasthome) for alignment, the genus corresponding to the target microorganism strain is selected, and the other parameters are set as default values.

[0019] The selected gene in the application is genomic DNA.

[0020] The obtained target microorganism strain-specific nucleic acid sequence can be used for qPCR, Southern blotting, Southern hybridization and the like to determine the quantity of the target strain.

[0021] An oligonucleotide fragment for identifying Azospirillum sp. TSA2S strain, comprising any one of the nucleotide sequences shown in SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8.

[0022] A primer for identifying Azospirillum sp. TSA2S strain, which is designed by taking any one of the nucleotide sequences shown in SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8 as a template.

[0023] Any one of the following primer pairs:

[0024] 2sFw12: GAAGAACAGGACACGTGCAA, 2sRv12: TCAAATGAGTGCCCTAAGCA;

[0025] 2sFw13: AATGGATTGCAGCAAAAAGC, 2sRv13: GATGCAGGAGTGCCAAAAGT;

[0026] 2sFw14: TTCGAGCCCTAACAGGAGAA, 2sRv14: TAAAGGGCAGACGCAATAGG;

[0027] 2sFw16: TGTTCGACTACGCTCATGCT, 2sRv16: GAGAGCTGCACCGACAGTTT;

[0028] 2sFw17: TTTCCCCTGACTGCGTATCT, 2sRv17: CTGAATCCGTTCACAGCAAA;

[0029] 2sFw18: TCAGATGTTTTGGCACATCG, 2sRv18: CTATCGTGCTCATTGCGGTA.

[0030] The oligonucleotide fragment for identifying Azospirillum sp. TSA2S strain is applied to identifying Azospirillum sp. TSA2S strain.

[0031] The primer for identifying Azospirillum sp. TSA2S strain is applied to identifying Azospirillum sp. TSA2S strain.

[0032] An oligonucleotide fragment for identifying Arthrobacter sp. 2 strain, comprising any one of the nucleotide sequences shown in SEQ ID NO: 17-18.

[0033] A primer for identifying Arthrobacter sp. 2 strain, which is designed by taking the nucleotide sequence shown in any one of SEQ ID NO 17-18 as a template.

[0034] Any one of the following primer pairs:

[0035] A2Fw3: ACAGGAAACGGAAATCGTTG, A2Rv3: GTTCTTCCTGCGAAGCTCAT;

[0036] A2Fw4: TTTTTCTCGGCGTCCATATC, A2Rv4: TGTTCCAGTGGTGCTTTGTC;

[0037] A2Fw5: TTCCCGCAGACCAGTTTATC, A2Rv5: GCACTATTATCCGCGTTCGT;

[0038] A2Fw6: TGGAGCAGGGACTTAGATGG, A2Rv6: TACATGGGCTCGGTGTATCC.

[0039] The above-mentioned oligonucleotide fragment for identifying Arthrobacter sp. 2 strain is applied to identify Arthrobacter sp. 2 strain.

[0040] The above-mentioned primer for identifying Arthrobacter sp. 2 strain is applied to identify Arthrobacter sp. 2 strain.

[0041] Beneficial effects:

[0042] The application provides a nucleic acid fragment screening method for identifying microbial strains and application, and the nucleic acid fragment library of a target strain is established by using the genomic information of the target microbial strain, and the genomic information of non-target strains is compared, and a comparison hit sequence is obtained, and then a non-hit sequence is obtained; a PCR primer is designed by using a conventional primer design method, a nucleic acid pool of a target strain is constructed, and a strain-specific nucleic acid sequence is further screened by a PCR method. The specific nucleic acid screening method for identifying close strains provided by the application can efficiently obtain a large amount of specific nucleic acid sequence of the target microbial strain, the reproducibility of the experimental results is extremely high, meanwhile, the early analysis is carried out by means of bioinformatics, and the whole experimental process is simplified. In addition, the specific nucleic acid sequence screened by the method of the application can be further quantitatively or semi-quantitatively detected by designing a PCR, a qPCR and a nucleic acid probe, and the abundance of the target microbial strain in an ecological system (for example, in soil or a plant rhizosphere). The experimental process adopts a general software, and the cost requirement of experimental equipment is not high, so that the method of the application has good applicability. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 Strain-specific primer PCR electropherogram of Azospirillum sp. TSA2S (Lane M: DL2000 molecular weight, Lanes 1-8: nucleic acid pools 1-8, Lane 9: Azospirillum sp. TSA2S, Lane 10: sterile water).

[0044] Figure 2 Strain-specific primer PCR electropherogram of Arthrobacter sp. 2 (Lane M: DL2000 molecular weight, Lanes 1-8: nucleic acid pools 1-8, Lane 9: Azospirillum sp. TSA2S, Lane 10: sterile water).

[0045] Figure 3 Quantitative determination of the survival of the Azospirillum sp. TSA2S strain in soil 22 days, 34 days and 41 days after inoculation by using strain-specific primer 2sFw 13 / 2sRv 13.

[0046] Figure 4 Quantitative determination of the survival of the Azospirillum sp. TSA2S strain in soil 22 days, 34 days and 41 days after inoculation by using strain-specific primer 2sFw 14 / 2sRv 14.

[0047] Figure 5 Quantitative determination of the survival of the Azospirillum sp. TSA2S strain in soil 22 days, 34 days and 41 days after inoculation by using strain-specific primer 2sFw 20 / 2sRv 20. DETAILED DESCRIPTION

[0048] The present application can be better understood in accordance with the following examples. However, it is to be understood that the examples described are merely illustrative of the present application and should not be considered limiting of the present application as described in the claims.

[0049] Example 1 Designing strain-specific fragments of Azospirillum sp. TSA2S.

[0050] The whole genome of Azospirillum sp. TSA2S was sequenced finely, and the electronic shearing tool splitter was used for electronic shearing to generate 300 bp fragments containing 100 bp overlaps. The obtained 300 bp fragments established a nucleic acid fragment database. In the NCBI NT database, the nucleic acid fragments were used as query conditions, the selected species was Azospirillum (taxid: 191), the maximum target was 10, and the other parameters were default. BLASTN search was performed. The hit table was downloaded, the hit sequences were extracted, and further non-hit table was obtained, and the non-hit sequences were extracted in the nucleic acid fragment database. The extracted non-hit sequences were used as query conditions, the maximum target was 10, and the other parameters were default. BLASTN search was performed. The hit table was downloaded, the hit sequences were extracted, and further non-hit table was obtained, and the non-hit sequences were extracted in the nucleic acid fragment database for the second time, which were the possible strain-specific fragments. Part of the obtained strain-specific fragments are shown as SEQ ID NO. 1-14.

[0051] Example 2 Designing strain-specific primers of Azospirillum sp. TSA2S.

[0052] The strain-specific qPCR primers were designed according to the following standards using the strain-specific fragments shown in SEQ ID NO. 1-15 as templates: the PCR product is not more than 280 bp, the primer length is not in 18-27 bp, the primer Tm is about 56-60℃, the Tm difference of the two primers is less than 2℃, and the primer has no predicted hairpin structure, repetition and primer dimer formation. The designed strain-specific primers of Azospirillum sp. TSA2S are shown in Table 1.

[0053] Table 1 Strain-specific primers of Azospirillum sp. TSA2S

[0054]

[0055]

[0056] Example 3 Screening strain-specific primers of Azospirillum sp. TSA2S.

[0057] The total genomic DNA of Azospirillum sp. TSA2S was extracted and the non-target strain genomic nucleic acid pools were constructed with the possible Azospirillum sp. TSA2S strain-specific primers in Table 2 according to Table 3, with sterile water as the negative control.

[0058] Table 2 Information of possible Azospirillum sp. TSA2S strain-specific primers for verification

[0059]

[0060] Table 3 Information of non-target strain genomic nucleic acid pools

[0061]

[0062]

[0063] PCR amplification was performed with 2720 Thermal cycler (Applied Biosystems, Foster City, CA, USA) PCR instrument according to the following conditions.

[0064] Reaction system:

[0065]

[0066]

[0067] Reaction parameters:

[0068]

[0069] PCR product detection was performed by 2% agarose gel electrophoresis. If the primers successfully amplified Azospirillum sp. TSA2S, failed to amplify sterile water and non-target nucleic acid pools, they were strain-specific primers. As shown in FIG. 2, 2sFw12Rv12, 2sFw13Rv13, 2sFw14Rv14, 2sFw16Rv16, 2sFw17Rv17 and 2sFw18Rv18 were the strain-specific primers of Azospirillum sp. TSA2S. Figure 1

[0070] Example 4

[0071] The strain-specific primers of Azospirillum sp. TSA2S screened were converted into qPCR primers, and the number of Azospirillum sp. TSA2S strains in soil samples was determined.

[0072] Example 5 ​

[0073] Southern hybridization was performed according to the strain-specific nucleic acid sequence of Azospirillum sp. TSA2S obtained by screening, and semi-quantitative determination of the number of Azospirillum sp. TSA2S strains in soil samples was performed.

[0074] Example 6 Design of strain-specific fragments of Arthrobacter sp. 2

[0075] Fine whole genome sequencing of Arthrobacter sp. 2 was performed, and electronic shearing was performed using the electronic shearing tool splitter to generate 300 bp fragments containing 100 bp overlaps. The obtained 300 bp fragments were used to establish a nucleic acid fragment database. BLASTN search was performed in the NCBI NT database with the nucleic acid fragments as the query condition, the maximum target was 10, and the other parameters were default. The hit table was downloaded, the hit sequences were extracted, and further non-hit table was obtained, and the non-hit sequences were extracted in the nucleic acid fragment database. BLASTN search was performed with the extracted non-hit sequences as the query condition, the maximum target was 10, and the other parameters were default. The hit table was downloaded, the hit sequences were extracted, and further non-hit table was obtained, and the non-hit sequences were extracted in the nucleic acid fragment database for the second time, which were the possible strain-specific fragments. Part of the obtained strain-specific fragments are shown in SEQ ID NO. 15-20.

[0076] Example 7:

[0077] The strain-specific primers of Arthrobacter sp. 2 designed with the nucleotide sequences shown in SEQ ID NO. 1-6 are shown in Table 4.

[0078] Table 4 Strain-specific primers of Arthrobacter sp. 2

[0079]

[0080]

[0081] Example 8

[0082] The total genomic DNA of Arthrobacter sp. 2 was extracted, and the possible strain-specific primers of Arthrobacter sp. 2 in Table 5 were used to construct the genomic nucleic acid pool of non-target strains according to Table 6, and sterile water was used as a negative control.

[0083] Table 5 Information of possible Arthrobacter sp. 2 strain-specific primers for verification

[0084]

[0085] Table 6 Genomic nucleic acid pool information of non-target strains

[0086]

[0087]

[0088] PCR amplification was performed using a 2720 Thermal cycler (Applied Biosystems, Foster City, CA, USA) PCR instrument according to the following conditions.

[0089] Reaction system:

[0090]

[0091] Reaction parameters:

[0092]

[0093]

[0094] PCR product detection was performed using 2% agarose gel electrophoresis. If the primers of Arthrobacter sp. 2 were successfully amplified, but the primers of sterile water and non-target nucleic acid pool were not amplified, the primers were strain-specific primers. As shown in FIG. 2, the primers A2Fw3Rv3, A2Fw4Rv4, A2Fw5Rv5 and A2Fw6Rv6 were strain-specific primers. Figure 2

[0095] Example 9

[0096] The strain-specific primers of Arthrobacter sp. 2 screened were converted into qPCR primers, and the number of Arthrobacter sp. 2 strains in soil samples was determined.

[0097] Example 10

[0098] Southern hybridization probes were designed according to the strain-specific nucleic acid sequences of Arthrobacter sp. 2 screened, and semi-quantitative determination of the number of Arthrobacter sp. 2 strains in soil samples was performed. SEQUENCE LISTING <110> Nanjing University of Information Engineering Nanjing University of Information Engineering <120> A screening method for identifying nucleotide fragments of closely related microorganisms <160> 60 ​<170> SIPOSequenceListing 1.0 <210> 1 <211> 300 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 agcccactaa aattttcctt aagcctatct cctaaaatac ataatattct ttcttcttct 60 gaaagtggca ttcacgaagg aagcagatta ccttgggacg ttgtgcaagc cttttcgacc 120 gcactacatg agaatataca ttggtggcaa catatcggat caacggctgg ctttatcttt 180 agcttagcag ggccaatgca atttcatgca aattatggac atcttaaaaa ttttcttaag 240 aaaattggcc ccaaaatgcc aatcataaac atcactagct cgaaaacaat gttgcaacag 300 <210> 2 <211> 300 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 2 atttcatgca aattatggac atcttaaaaa ttttcttaag aaaattggcc ccaaaatgcc 60 aatcataaac atcactagct cgaaaacaat gttgcaacag cttgaaaaag aagaacagga 120 cacgtgcaat aaaataataa ataactatat ggacatagaa tttttcttta actatcaatt 180 ttctccggag aagtttgaag aaaaagccgg taatatttat tttgagtgct tagggcactc 240 atttgatata acttatggaa atgcaataac caccttgatt gcaacgcttg acatgtacaa 300 <210> 3 <211> 300 <212> DNA <213> Artificial Sequence <400> 3 acaacagtga tgatgatggt attcacatag caatcataca aggcatggat gagaaagaca 60 tgatggagac gctaggatct ttctatgcag atatagtggt tcacgaaatc tctcgacaat 120 ggattgcagc aaaaagcgtt tttaaatacg atcttgaatg gctttcaaaa aagcacgagt 180 accctgtaat gaaaggttat atagatgatc tttttatcca aacttttggc actcctgcat 240 cagctttcga atatgtaagg tattcctgat aatgtcagac ttacttagga gccccaggta 300 <210> 4 <211> 300 <212> DNA <213> Artificial Sequence <400> 4 gaattcgagc cctaacagga gaaggaggag gttcttaaaa ggaattgtca gggaggttgt 60 tctccttcag attgataggt ggtggtattc cacttgcact aggagatttt ctaatatgac 120 acctattgcg tctgcccttt acgattcact aaaaactcac cgttcggagc gagttcgtca 180 atatccccaa tatagtgagt caagaattag tcgatacact atttcatacg gtgaattgtg 240 ccgtatggct gaagttccaa ttcagccaat tggaattggc aagtatcttg gtgaagtggc 300 <210> 5 <211> 300 <212> DNA <213> Artificial Sequence <400> 5 tttcgcgata attgcattta aggactttgg tagatggcac tggagttttt gggatgctgc 60 tccattgtta gcattatcct gtctgatttc aggaatcatc acgttttact ataaaatcaa 120 ttctgaaaag tacgtggctg gcaaattcgg tgacagcaga ccatactcct ttgaaggaga 180 ttatgattcg aatgaagata acaacaatgt ggttgtgtat tccggtttga acccgtttgt 240 tggatccggg aataatatag gaggatgggt tcttgcaatt gacctgaaaa aaataaacga 300 <210> 6 <211> 300 <212> DNA <213> Artificial Sequence <400> 6 tctaaattca tcatctcatc attctttatc ccaatagtcg tttcgctcgg cccaaataca 60 attgtttccc ctgactgcgt atctgtcaga gaaactatgt cgacgacata accaaccaca 120 gcctccaggc aagctgcgtc tgtaacttgc tgtataaagt cacctaaaac attttttgct 180 gtgaacggat tcagaatctt agtttctgac acaagaatgc atgtaatttg atttttatag 240 attgttagac gaatatcacc atgaataccc gcctcgggat ggcggaattt aacaccaaat 300 <210> 7 <211> 300 <212> DNA <213> Artificial Sequence <400> 7 cggaaacttt ggatgggaac ctcttataag ccgaaccgac tttaaggagc gtttcttaga 60 cttcaggtct aaagttttcg ccctcacatt tatgcgtcta cgacgaacgc acaccctttt 120 ggctctaaaa ggctgccatg gcgaaataat cagatgtttt ggcacatcgc gaatagtgca 180 tacatttact gtaacatttt ccccttcaac cccatcccca cgtgttgcag caagtacaag 240 cctgccccat tcataccgca atgagcacga tagaccatca atctttggct cagcaacgaa 300 <210> 8 <211> 300 <212> DNA <213> Artificial Sequence <400> 8 tctccaatta ttctgcctcc gttcggatta aattacattt ttgaaggaca agcaagattt 60 tctcaaatac aatatctttc actttcctca aataagaaat ttgattttga tcatgcaaat 120 tctgcaggaa tgatgtcaga gctttataca aaagctttca atttttacat tgagaaaacg 180 ggcataccat atccttcttc aatactagat aattctgtaa acttgtttct tctggcatgc 240 gatatatctc tgaatactac tgcaggattt ccattatcat acacgacaga agacgaaacg 300 <210> 9 <211> 300 <212> DNA <213> Artificial Sequence <400> 9 caagaattag tcgatacact atttcatacg gtgaattgtg ccgtatggct gaagttccaa 60 ttcagccaat tggaattggc aagtatcttg gtgaagtggc aacccactgt aatgaacacg 120 gatttcctcc catcaatgca cttgcggtca acggagacag tggattgcct ggtgacagtt 180 acgatcaagc gggagacggg ctttgctccc ttgctaattg gccaaaggag ctagaaagct 240 gcattaatga acagaggcaa tacccataaa ataatattga attatatttt catgtctctg 300 <210> 10 <211> 300 <212> DNA <213> Artificial Sequence <400> 10 ttcaggtttg gcaaccgaaa gcagcaagac actgatccga gggttgcaaa atgacattct 60 cgcagatctt ccttccacat ccgcctgcag atgccgtcac ccctggcaaa tcatactcaa 120 tccaagcccc caattttccg gaaaagcaaa agctaattct cggctatttt cagcaaggac 180 gccaagagga cgcacctcaa aaccaaagcg ttttcagaag gatttcatat atcagtccct 240 gctcaggggg aacaattttg ctgcaaatcc tgcaatagct tttttcagta tttctaggtc 300 <210> 11 <211> 300 <212> DNA <213> Artificial Sequence <400> 11 aaaaagccgg taatatttat tttgagtgct tagggcactc atttgatata acttatggaa 60 atgcaataac caccttgatt gcaacgcttg acatgtacaa agaaggggaa gatattgaat 120 ctcttttccc taacgcaaac ataatggcag aaataaattc tgaaagaaaa agcaaaaagg 180 aaaataacta ctaccatggc tctccaatta ttctgcctcc gttcggatta aattacattt 240 ttgaaggaca agcaagattt tctcaaatac aatatctttc actttcctca aataagaaat 300 <210> 12 <211> 300 <212> DNA <213> Artificial Sequence <400> 12 gcgcccgagt tgcgtttgga gattacttaa cactcacaag taatcgccga aaatatagtc 60 tagaatgaag ctttcttctt ctttttttct tgctctcttc tgtcactaag agtttcactc 120 cattctggcc cttcatatgt gatagaaatc caaccttccc ctctccttcc gagggacttt 180 atctccatca tgataaccat actctgtaat tcccaaagcg taaaccaata cccgcagccg 240 tcgtaattaa ggcattgata aaactcatca ctctctttgt agagctttaa cccgtaattc 300 <210> 13 <211> 300 <212> DNA <213> Artificial Sequence <400> 13 aatacaaaga gaaatccgaa ttggagaaag aagttaaaga aaatcctcta tacgactatg 60 gcataaaatc taccatgcgg gaagaggaaa gctctggcgt aaaaagctat tttcagatga 120 tcgacagaat aggaattgtt aagatagttg agaaggaaat actctcaact atcgtgaatt 180 ttcttgaagag cgtggcgtgg acacgtcaga gcttaaggaa cggcagacat ctatcctga 240 ataacggaat tatcatctct ggtggaaatg taaatgcgaa cggaattgtg gctggaaaca 300 <210> 14 <211> 300 <212> DNA <213> Artificial Sequence <400> 14 ggtgctgccg tcgacatccc attcagatca ccagtggcga aggatgcaga tcgaaaaatg 60 tttggccgcg ctttttccat atggtgccga ggagcctggg tccgtgcaga ctctccctct 120 agactcatac tcttgctgtg atgtgttcga ctacgctcat gctgccgaaa tagttatgga 180 acaagttgaa agtcagggag gttgcgccaa catatctttg atacacatgg gcgcaaagct 240 ccaaactgtc ggtgcagctc tcgcattagc tgcgcgccca gaagttgccc tcgtgggtgc 300 <210> 15 <211> 300 <212> DNA <213> Artificial Sequence <400> 15 cacggctctc ttaccctgcc aatagttgac ggttatttag cttcacccgg tcgggtgttg 60 ctcctggtat ccaccgcacc cctcatccgg acccgggggg ccggaccgta agaggcgcag 120 ttcttgaagag cgtggcgtgg acacgtcaga gcttaaggaa cggcagacat ctatcctga 240 ataacggaat tatcatctct ggtggaaatg taaatgcgaa cggaattgtg gctggaaaca 300 <210> 14 <211> 300 <212> DNA <213> Artificial Sequence <400> 14 ggtgctgccg tcgacatccc attcagatca ccagtggcga aggatgcaga tcgaaaaatg 60 tttggccgcg ctttttccat atggtgccga ggagcctggg tccgtgcaga ctctccctct 120 agactcatac tcttgctgtg atgtgttcga ctacgctcat gctgccgaaa tagttatgga 180 acaagttgaa agtcagggag gttgcgccaa catatctttg atacacatgg gcgcaaagct 240 ccaaactgtc ggtgcagctc tcgcattagc tgcgcgccca gaagttgccc tcgtgggtgc 300 <210> 15 <211> 300 <212> DNA <213> Artificial Sequence <400> 15 cacggctctc ttaccctgcc aatagttgac ggttatttag cttcacccgg tcgggtgttg 60 ctcctggtat ccaccgcacc cctcatccgg acccgggggg ccggaccgta agaggcgcag 120 tcctccatac ccggaagccg ggcttcggac agggagggct ggatacgcgt agtcagccac 180 tgctcccgca ctcctgaatg agacgtgctg cttgtgtccg cgtcagcgga ctaggcatga 240 gggcacagca aactgctcca ccaagtgtac tacagcggac ctgcacggaa ggacggtttc 300 <210> sixteen <211> three hundred <212> DNA <213> Artificial Sequence <400> sixteen atcagggacg tgagtgattt cattgcttcc ccctgcaacg cgtcacacac gtgcccggca 60 tcagactgcc cacaaccgcg catcacacgg tcacggcacg tgaatgtgaa aaatagccct 120 gtctcgtcag tgcttcatca cgcgacagcc cgtgcaacgg tgctgaggtt cgcgcagtca 180 gccactgatt tcgggcccgc ccattcctga accgaagact tggcgggtcg tttgggccca 240 ctcgaaaatc tacctacggc atggagcacg aacgcgagta gttgttacct gatttagtga 300 <210> seventeen <211> three hundred <212> DNA <213> Artificial Sequence <400> seventeen agccagctca ccgggggtca gcccgtcctg agcatatcga gctatgtcct ctcgtatgga 60 TGATTGATCTCTGACAGGAAACGGAAATCGTTGGCCAACGAGGCGGTGTCACACTCG 120 CAGGGAGGTCTGCATAGCCAGTTTGATAGCCAAACCAACGGCCCATTTCGGAGCGCGGAATC 180 GTACATCGATGAGCTTCGCAGGAAGAAGACGAGATCAGTCCCTTCCAGGTCAGCCC 240 AGACAAGGTATTCCCGCCCACAGCGATGACCGTAGCAGGCTCGTCCGTATAGATGAGACG 300 <210> 18 <211> 300 <212> DNA <213> Artificial Sequence <400> 18 TGCTTCGGTCAGCCGGGAGGCCAGGGGTATCTGGTCTATTCCTGCGACGCCTCCCGCAT 60 TGCCCTCCTGGACGCTCCCCGCTGGACC GAGTCCTCGCTA ACTTTTTTCTCGGC 120 GTTTCTTCACGTCCC GCAGCGATGCGACGGACTGGCTCAA 180 TGACGACCGGTAGGTGCCGTGTTCTGCCCTGCGGCGGACGATCCGAGGCGGACAAAGCAC 240 CCTTTCGGAGCGCGGAATCGTTGGCCAACGAGGCGGTGTCACACTCGGAGGTCTGCATAGCC 300 <210> 19 <211> 300 <212> DNA <213> Artificial Sequence <400> 19 TGATGAGGAG GAGAAGAATG GAGGAGGAAA TGGAATGAGA AGAAGAAGAA TGCCTGAGAA 60 GCGTCTCGAG ATGAGCGAGA AGAAGAAGAA TGCCTGAGAA TGCCTGAGAA TGCCTGAGAA 60 TGAATCCGCG GAAAACGGCC Cgaatcggcc cttaaaaccc cttgacgaac gcggataata 180 GTGCATTGGG CACCCTCTGC CAAGGGCCGC Cgggtacgac ggcggacggt caccgaatcc 240 GCgtttgagc gccattgcgg ataggctatg cctgaataat gtttcaagac tctcaaggag 300 <210> 20 <211> 300 <212> DNA <213> Artificial Sequence <400> 20 AGGGCAGCAA CGGGAAGGTG TGGACTCGAT TTCTCACGTC AGGcatcacg accacagacg 60 CGACTGATGC CTACATTcgc cgagaagcg acgatcgacc ctcgcatacc gtttcacatg g 120 AGCAGGGACT TAGATGGGTA TCCGCggacg tttacgccga gtcccaggcc gcagactgtg t 180 ACGGCgggtt tctgaaagct gcgttgtggc cgagcgggga attcggatac accgagccca 240 TGTATCTTCG GACGgtatgg caccaaataa ggaacagcga aagttgtgcg attccattag 300 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <400> 21 ttctgaaagt ggcattcacg 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <400> 22 aagataaagc cagccgttga 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <400> 23 gaagaacagg acacgtgcaa 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <400> 24 tcaaatgagt gccctaagca 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <400> 25 aatggattgc agcaaaaagc 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <400> 26 gatgcaggag tgccaaaagt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 ttcgagccct aacaggagaa 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <400> 28 taaagggcag acgcaatagg 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <400> 29 agtacgtggc tggcaaattc 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <400> 30 ttattcccgg atccaacaaa 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <400> 31 tgttcgacta cgctcatgct 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <400> 32 gagagctgca ccgacagttt 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <400> 33 tttcccctga ctgcgtatct 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <400> 34 ctgaatccgt tcacagcaaa 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <400> 35 tcagatgttt tggcacatcg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <400> 36 ctatcgtgct cattgcggta 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <400> 37 tgcaggaatg atgtcagagc 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <400> 38 tatcgcatgc cagaagaaac 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <400> 39 tggcaaccca ctgtaatgaa 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <400> 40 ccaattagca agggagcaaa 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <400> 41 ctcgcagatc ttccttccac 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <400> 42 gcgtccttgc tgaaaatagc 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <400> 43 taaccacctt gattgcaacg 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <400> 44 cggaggcaga ataattggag 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <400> 45 ctccattctg gcccttcata 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <400> 46 ttggtttacg ctttgggaat 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <400> 47 gaggaaagct ctggcgtaaa 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <400> 48 ccgttcctta agctctgacg 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <400> 49 ggctctctta ccctgccaat 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <400> 50 gtatggagga ctgcgcctct 20 <210> 51 <211> 21 <212> DNA <213> Artificial Sequence <400> 51 cagggacgtg agtgatttca t 21 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <400> 52 tgaagcactg acgagacagg 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <400> 53 acaggaaacg gaaatcgttg 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <400> 54 gttcttcctg cgaagctcat 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <400> 55 tttttctcgg cgtccatatc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <400> 56 tgttccagtg gtgctttgtc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <400> 56 ttcccgcaga ccagtttatc 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <400> 58 gcactattat ccgcgttcgt 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <400> 59 tggagcaggg acttagatgg 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <400> 60 tacatgggct cggtgtatcc 20

Claims

1. A screening method for identifying nucleotide fragments of related microorganisms, characterized by, The method comprises the following steps: (1) obtaining the whole gene sequence of the target microorganism; (2) using the electronic cutting technology of the splitter online software to cut the genome sequence of the target strain into nucleic acid small fragments containing overlapping regions; the length of the overlapping region of the nucleic acid small fragments containing overlapping regions is 100-500 bp, and the length of the nucleic acid small fragments is 200-1500 bp; (3) aligning the fasta file of the nucleic acid small fragments containing overlapping regions obtained in step (2) in the NCBI NT database; when aligning, the genus corresponding to the target microorganism strain is selected, and other parameters are set as default values; (4) obtaining hit nucleic acid sequence I by deleting the repeated sequences in hit table I obtained after step (3) is aligned; (5) aligning the hit nucleic acid sequence I obtained in step (4) with the nucleic acid small fragments containing overlapping regions obtained in step (2) to obtain non-hit nucleic acid sequence I; (6) aligning the non-hit nucleic acid sequence I obtained in step (5) in the NCBI NT database again to obtain hit table II, deleting the repeated sequences in hit table II, and then obtaining hit nucleic acid sequence II; (7) repeating step (5), aligning the hit nucleic acid sequence II obtained in step (6) with the nucleic acid small fragments containing overlapping regions obtained in step (2) to obtain non-hit nucleic acid sequence II, which is the possible strain-specific nucleic acid fragment of the target microorganism; (8) using the possible strain-specific nucleic acid fragment of the target microorganism obtained in step (7) as a template to design PCR primers; (9) extracting the genomic total DNA of 10 or more strains of the genus or close genus to which the target microorganism strain belongs to construct a nucleic acid pool; (10) using the genomic DNA of the target microorganism strain and the nucleic acid pool obtained in step (9) as templates, respectively, and using the primers designed in step (8) to perform PCR amplification, and the amplification product is detected by agarose electrophoresis; If the PCR detection with the genomic DNA of the target microorganism strain as the template is positive, and the PCR detection with the nucleic acid pool obtained in step (9) as the template is negative, the nucleic acid fragment corresponding to the primer pair is the specific nucleic acid fragment for identifying the target microorganism strain.

Images