Oligonucleotides containing phosphorodithioate internucleoside linkages

Abstract

The present invention relates to an oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (I) as defined in the specification and claims. The oligonucleotides of the present invention can be used as medicaments.

Description

BACKGROUND OF THE INVENTION

[0002] The use of synthetic oligonucleotides as therapeutic agents has witnessed significant progress over the last few decades, leading to the development of molecules that act through diverse mechanisms, including gapmers that activate RNase H, splice-switching oligonucleotides, microRNA inhibitors, siRNAs or aptamers (S.T. Crooke, Antisense drug technology: principles, strategies, and applications, 2nd ed., Boca Raton, FL: CRC Press, 2008). However, oligonucleotides are inherently unstable in biological systems to the nuclease degradation process. Additionally, they display highly unfavorable pharmacokinetic behavior. To ameliorate these drawbacks, various types of chemical modifications have been investigated over the last few decades. Arguably, one of the most successful modifications has been the introduction of the thiophosphate linkage, where one of the non-bridging phosphate oxygen atoms is replaced by a sulfur atom (F. Eckstein, Antisense and Nucleic Acid Drug Development 2009, 10, 117-121). Such thiophosphate oligodeoxynucleotides display increased protein binding and significantly higher stability to nuclease degradation and thus significantly higher half-lives in plasma, tissues and cells compared to their unmodified phosphodiester analogs. These decisive features have allowed the development of the first generation of oligonucleotide therapeutic agents and opened the door for their further improvement through more recent modifications such as locked nucleic acids (LNAs). However, the replacement of the phosphodiester linkage with a thiophosphate creates a chiral center at the phosphorus atom. Thus, all approved thiophosphate oligonucleotide therapeutic agents are used as mixtures of a vast number of diastereomeric compounds, which may all have different (and possibly opposite) physicochemical and pharmacological properties.

[0003] Although it may now be possible to stereospecifically synthesize single stereochemically defined phosphorothioate oligonucleotides (N. Oka, M. Yamamoto, T. Sato, T. Wada, J. Am. Chem. Soc. 2008, 130, 16031-16037), it remains a challenge to identify the stereoisomers with optimal properties within the vast number of possible diastereoisomers. In this context, reducing the diastereoisomeric complexity by using achiral phosphorothioate linkages is of great significance. For example, symmetric non-bridging dithioate modifications in which both of the non-bridging oxygen atoms within the phosphate linkage are replaced by sulfur (see, e.g., W. T. Wiesler, M. H. Caruthers, J. Org. Chem. 1996, 61, 4272-4281) have been applied to immunostimulatory oligonucleotides (A. M. Krieg, S. Matson, E. Fisher, Antisense Nucleic Acid Drug Dev. 1996, 6, 133-139), siRNAs (e.g., X. Yang, M. Sierant, M. Janicka, L. Peczek, C. Martinez, T. Hassell, N. Li, X. Li, T. Wang, B. Nawrot, ACS Chem. Biol. 2012, 7, 1214-1220) and aptamers (e.g., X. Yang, S. Fennewald, B. A. Luxon, J. Aronson, N. K. Herzog, D. G. Gorenstein, Bioorg. Med. Chem. Lett. 1999, 9, 3357-3362). Interestingly, attempts to utilize such achiral modifications in the context of antisense oligonucleotides have so far met with limited success (see, e.g., M. K. Ghosh, K. Ghosh, O. Dahl, J. S. Cohen, Nucleic Acids Res. 1993, 21, 5761-5766; and J. P. Vaughn, J. Stekler, S. Demirdji, J. K. Mills, M. H. Caruthers, J. D. Iglehart, J. R. Marks, Nucleic Acids Res. 1996, 24, 4558-4564).

[0004] Surprisingly, we have now found that non-bridging dithiophosphates can be introduced into oligonucleotides, especially generally into oligonucleotide gapmers or mixmers and specifically into LNA-DNA-LNA gapmers or LNA / DNA mixmers. Such modifications are well tolerated and the resulting molecules show great potential for therapeutic applications, while each non-bridging dithiophosphate modification reduces the size of the total library of possible diastereoisomers by 50%. When the modifications are placed in the LNA flanks of gapmers, the resulting oligonucleotides are generally found to be more effective than the corresponding all-thiophosphate parents. Generally, the modifications are additionally well tolerated within the gap region and even more surprisingly, when appropriately placed, can also lead to improved potency.

[0005] Accordingly, we have surprisingly found that the present invention provides oligonucleotides having improved physicochemical and pharmacological properties (e.g., including improved potency). In some aspects, the oligonucleotides of the present invention retain activity or efficacy and may be as effective as or more effective than the same compounds (thiophosphate reference compounds) in which the dithiophosphate linkages of formula (IA or IBIB) are replaced with conventional atactic thiophosphate linkages. Each introduction of a non-bridging dithiophosphate modification removes one of the chiral centers at phosphorus and thus reduces the diastereoisomeric complexity of the compound by 50%. Additionally, whenever a dithioate modification is introduced, the oligonucleotides appear to be taken up by cells much better, especially by cells such as hepatocytes, muscle cells, and heart cells.

[0006] Introducing non-bridging dithioate modifications into the LNA flanks of gapmers appears to be particularly beneficial, resulting in molecules showing higher target reduction and much better uptake behavior, higher stability, and a favorable safety profile.

[0007] The chemical synthesis of non-bridging phosphorodithioate linkages in oligonucleotides is preferably achieved by solid-phase oligonucleotide synthesis techniques using suitable thiophosphoramidite building blocks. The successful application of such thiophosphoramidites has been described for normal DNA (X. Yang, Curr Protoc Nucleic Acid Chem 2016, 66, 4.71.71-74.71.14.) as well as for RNA (X. Yang, Curr Protoc Nucleic Acid Chem 2017, 70, 4.77.71–74.77.13.), and the required building blocks are available from commercial sources. Intriguingly, the synthesis of the more challenging corresponding LNA thiophosphoramidites has not been reported. In the present application, we also report the successful synthesis of all four LNA thiophosphoramidites and their incorporation into oligonucleotides.

[0008] BRIEF DESCRIPTION OF THE INVENTION

[0009] The present invention relates to an oligonucleotide comprising at least one phosphorodithioate internucleoside linkage of formula (I)

[0010]

[0011] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is an LNA nucleoside and wherein R is hydrogen or a phosphate protecting group. The present invention also particularly relates to a gapmer oligonucleotide comprising a phosphorodithioate internucleoside linkage of formula (I). The present invention also relates to a method for manufacturing the oligonucleotides of the present invention and to LNA nucleoside monomers which can be used in particular for manufacturing the oligonucleotides of the present invention.

[0012] The present invention relates to an oligonucleotide comprising at least one phosphorodithioate internucleoside linkage of (IA) or (IB)

[0013]

[0014] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2) is linked to the 5'-carbon atom, and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation.

[0015] In other words, M is a metal, such as an alkali metal, such as Na or K; or M is NH4.

[0016] The present invention provides an antisense oligonucleotide comprising a phosphorothioate internucleoside linkage of formula IA or IB as described herein. The oligonucleotide of the present invention is preferably a single-stranded antisense oligonucleotide comprising one or more 2'-sugar modified nucleosides, such as one or more LNA nucleosides or one or more 2'-MOE nucleosides. The antisense oligonucleotide of the present invention is capable of regulating the expression of a target nucleic acid (e.g., target pre-mRNA or target microRNA) in a cell expressing the target RNA in vivo or in vitro. In some embodiments, the single-stranded antisense oligonucleotide further comprises a phosphorothioate internucleoside linkage. The single-stranded antisense oligonucleotide can be in the form of, for example, a gapmer oligonucleotide, a mixmer oligonucleotide or a fullmer oligonucleotide. The single-stranded antisense oligonucleotide mixmer can be used to regulate splicing events in target pre-mRNA. The single-stranded antisense oligonucleotide mixmer can be used to inhibit the expression of target microRNA.

[0017] The present invention also relates to the use of the oligonucleotide of the present invention (such as a single-stranded antisense oligonucleotide) as a therapeutic agent.

[0018] The present invention also particularly relates to a mixmer oligonucleotide comprising a phosphorothioate internucleoside linkage of formula (IA or IB). The present invention also particularly relates to a fullmer oligonucleotide comprising a phosphorothioate internucleoside linkage of formula (IA or IB).

[0019] The present invention also relates to a method for manufacturing the oligonucleotide of the present invention and to LNA nucleoside monomers that can be particularly used for manufacturing the oligonucleotide of the present invention.

[0020] The present invention also relates to a method for manufacturing the oligonucleotide of the present invention and to MOE nucleoside monomers that can be particularly used for manufacturing the oligonucleotide of the present invention.

[0021] The present invention also provides new MOE monomers and LNA monomers that can be used for manufacturing the oligonucleotide of the present invention.

[0022] During oligonucleotide synthesis, the use of protective R groups is often employed. After oligonucleotide synthesis, the protecting group is generally exchanged for a hydrogen atom or a cation such as an alkali metal or ammonium cation, such as when the oligonucleotide is in salt form. The salt generally contains a cation, such as a metal cation, for example, a sodium or potassium cation or an ammonium cation. For antisense oligonucleotides, preferably R is hydrogen, or the antisense oligonucleotide is in salt form (as shown in IB).

[0023] The phosphorothioate internucleoside linkage of formula (IB) can be selected, for example, from:

[0024]

[0025] wherein M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation. The oligonucleotides of the present invention can thus be in the form of: oligonucleosides, alkali metal salts, such as sodium salts, potassium salts or ammonium salts.

[0026] Alternatively, the oligonucleotides of the present invention can comprise a phosphorothioate internucleoside linkage of formula IA' or IB'

[0027]

[0028] The present invention also particularly relates to a nicked polymer oligonucleotide comprising a phosphorothioate internucleoside linkage of formula (I) (formula IA or IB or formula IA' or formula IB').

[0029] The present invention also particularly relates to a chimeric polymer oligonucleotide comprising a phosphorothioate internucleoside linkage of formula (I) (formula IA or IB or formula IA' or formula IB').

[0030] The present invention also particularly relates to a homopolymer oligonucleotide comprising a phosphorothioate internucleoside linkage of formula (I) (formula IA or IB or formula IA' or formula IB').

[0031] In a preferred embodiment of the oligonucleotides of the present invention, at least one of the two nucleosides (A 1 ) and (A 2 ) is an LNA nucleoside.

[0032] In a preferred embodiment of the oligonucleotides of the present invention, at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-O-MOE nucleoside.

[0033] In a preferred embodiment of the oligonucleotides of the present invention, the oligonucleotide is a single-stranded antisense oligonucleotide, and at least one of the two nucleosides (A 1 ) and (A 2 ) is an LNA nucleoside.

[0034] In a preferred embodiment of the oligonucleotides of the present invention, the oligonucleotide is a single-stranded antisense oligonucleotide, and at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-O-MOE nucleoside.

[0035] The present invention provides an antisense oligonucleotide for inhibiting a target RNA in a cell, wherein the antisense gapmer oligonucleotide comprises at least one phosphorothioate internucleoside linkage of formula (IA) or (IB).

[0036]

[0037] wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, wherein the antisense oligonucleotide is or comprises an antisense gapmer oligonucleotide (referred to herein as a gapmer or a gapmer oligonucleotide).

[0038] The antisense oligonucleotide of the present invention can thus comprise or consist of a gapmer.

[0039] The present invention provides an antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA) or (IB).

[0040]

[0041] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, wherein A 2 is the 3'-terminal nucleoside of the oligonucleotide.

[0042] The present invention provides an antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA or IB).

[0043]

[0044] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, wherein A1 is the 5'-terminal nucleoside of the oligonucleotide.

[0045] The present invention provides an antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA or IB)

[0046]

[0047] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2-O-MOE nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, wherein A 2 is the 3'-terminal nucleoside of the oligonucleotide.

[0048] The present invention provides an antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA or IB)

[0049]

[0050] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2-O-MOE nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, wherein A 1 is the 5'-terminal nucleoside of the oligonucleotide.

[0051] The present invention provides an antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA or IB)

[0052]

[0053] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), wherein the two nucleosides (A 1) and (A 2)At least one of them is a 2'-sugar modified nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, and wherein A 2 is the 3'-terminal nucleoside of the oligonucleotide.

[0054] The present invention provides an antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA or IB)

[0055]

[0056] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, and wherein A 1 is the 5'-terminal nucleoside of the oligonucleotide.

[0057] The 2'-sugar modified nucleoside can independently be selected from such 2'-sugar modified nucleosides selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA and LNA nucleosides.

[0058] The present invention provides a single-stranded antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA) or (IB)

[0059]

[0060] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded oligonucleotide further comprises at least one stereodefined phosphorothioate internucleoside linkage, being (Sp,S) or (Rp,R)

[0061]

[0062] wherein N 1 and N 2 are nucleosides.

[0063] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10–30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the contiguous nucleotide sequence is a phosphorothioate linkage of formula (IA) or (IB)

[0064]

[0065] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2) and wherein R is hydrogen or a phosphate protecting group.

[0066] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10–30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the contiguous nucleotide sequence is a phosphorothioate linkage of formula IA or IB

[0067]

[0068] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is for modulating the splicing of a pre-mRNA target RNA.

[0069] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10–30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the contiguous nucleotide sequence is a phosphorothioate linkage of formula (IA) or (IB)

[0070]

[0071] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 3'-carbon atom of another adjacent nucleoside (A 2) is linked to the 5'-carbon atom; and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of non-coding long RNA. For examples of lncRNAs that can be targeted by the compounds of the present invention, see WO 2012 / 065143.

[0072] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate linkage of formula IA or IB

[0073]

[0074] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of a human mRNA or pre-mRNA target.

[0075] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate linkage of formula IA or IB

[0076]

[0077] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of a viral RNA target. Suitable viral RNA targets can be, for example, HCV or HBV.

[0078] The present invention also provides single-stranded antisense oligonucleotides for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a continuous nucleotide sequence of 7–30 nucleotides in length, wherein the continuous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the continuous nucleotide sequence is a phosphorodithioate linkage of formula IA or IB

[0079]

[0080] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A 2 ); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is for inhibiting the expression of a microRNA.

[0081] For targeting an RNA target, such as a pre-mRNA target, an mRNA target, a viral RNA target, a microRNA or a long non-coding RNA target, the oligonucleotides of the present invention are suitably capable of inhibiting the expression of the target RNA. This is achieved by complementarity between the antisense oligonucleotide and the target RNA. Inhibition of the RNA target can be achieved by reducing the level of the RNA target or by blocking the function of the RNA target. RNA inhibition of the RNA target can suitably be achieved by recruiting a cellular ribonuclease such as RNase H (e.g. by using a gapmer), or can be achieved by a non-nuclease mediated mechanism, such as a steric hindrance mechanism (such as a steric hindrance mechanism for microRNA inhibition, for pre-mRNA splicing regulation, or for blocking the interaction between long non-coding RNA and chromatin).

[0082] The present invention also relates to methods for manufacturing the oligonucleotides of the present invention and to LNA or MOE nucleoside monomers which are particularly useful for manufacturing the oligonucleotides of the present invention.

[0083] The present invention provides pharmaceutically acceptable salts of the oligonucleotides of the present invention, or conjugates thereof, in particular sodium salts, potassium salts or ammonium salts.

[0084] The present invention provides a conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt thereof and at least one conjugate moiety covalently linked (optionally via a linker moiety) to the oligonucleotide or the pharmaceutically acceptable salt.

[0085] The present invention provides a pharmaceutical composition comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate of the present invention and a therapeutically inert carrier.

[0086] The present invention provides any oligonucleotide, pharmaceutically acceptable salt or conjugate thereof of the present invention for use as a therapeutic active substance.

[0087] The present invention provides a method for modulating RNA in a cell expressing a target RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, pharmaceutically acceptable salt, conjugate or composition of the present invention, wherein the oligonucleotide is complementary to the target RNA.

[0088] The present invention provides a method for modulating the splicing of a pre-RNA target in a cell expressing the pre-mRNA target, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, pharmaceutically acceptable salt, conjugate or composition of the present invention, wherein the oligonucleotide is complementary to the target RNA and capable of modulating splicing events in the pre-mRNA.

[0089] The present invention provides the use of an oligonucleotide, pharmaceutical salt, conjugate or composition of the present invention for inhibiting pre-mRNA, mRNA or non-coding long RNA in a cell (such as a human cell).

[0090] The above method or use can be an in vitro method or an in vivo method.

[0091] The present invention provides the use of an oligonucleotide, pharmaceutical salt, conjugate or composition of the present invention in the manufacture of a medicament.

[0092] The present invention provides the use of a phosphorodithioate internucleoside linkage of IA or IB for enhancing the in vitro or in vivo stability of a single-stranded phosphorothioate antisense oligonucleotide.

[0093] The present invention provides the use of a phosphorodithioate internucleoside linkage of formula IA or IB for enhancing the duration of action of a single-stranded phosphorothioate antisense oligonucleotide in vitro or in vivo.

[0094] The present invention provides the use of a phosphorodithioate internucleoside linkage of formula IA or IB for enhancing the cellular uptake or tissue distribution of a single-stranded phosphorothioate antisense oligonucleotide.

[0095] The present invention provides the use of a phosphorodithioate internucleoside linkage of formula IA or IB) for enhancing the uptake of a single-stranded phosphorothioate antisense oligonucleotide into tissues selected from skeletal muscle, heart, epithelial cells including retinal epithelial cells (e.g., a compound targeting Htra1), liver, kidney or spleen.

[0096] For in vivo use, the single-stranded phosphorothioate antisense oligonucleotide can be a therapeutic oligonucleotide. Brief Description of the Drawings

[0098] Figures 1 - 4Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of the oligonucleotides of the present invention.

[0099] Figure 1 Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having a single phosphorothioate internucleoside linkage of the present invention in the gap.

[0100] Figure 2 Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having multiple phosphorothioate internucleoside linkages of the present invention in the gap.

[0101] Figure 3 Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having multiple phosphorothioate internucleoside linkages of the present invention in the gap.

[0102] Figure 4 Shows the target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having phosphorothioate internucleoside linkages of the present invention in the flanks.

[0103] Figure 5 Shows the thermal melting (Tm) of an oligonucleotide containing a phosphorothioate internucleoside linkage of the present invention that hybridizes to RNA and DNA.

[0104] Figure 6 Shows the stability of an oligonucleotide containing a phosphorothioate internucleoside linkage of the present invention in rat serum.

[0105] Figure 7 : Explore the residual mRNA levels in primary rat hepatocytes after treatment with achiral phosphorothioates in the gap region and flanking regions of the gapmer.

[0106] Figure 8 : Explore the position dependence and optimization of achiral phosphorothioates in the gap region of the gapmer - residual mRNA levels in primary rat hepatocytes after treatment.

[0107] Figures 9A - 9B : Explore the effect of achiral phosphorothioates in the gap region of the gapmer - on cellular uptake.

[0108] Figures 10A - 10B : Introduction of achiral phosphorothioates in the flanking region of the gapmer provides increased potency, and the correlation between the phosphorothioate loading and the increased potency (4 phosphorothioate linkages in the flanks > 3 linkages > 2 linkages > 1 linkage > no phosphorothioate linkages).

[0109] Figure 11 : IC in different cell types 50 value.

[0110] Figure 12 : In vitro serum stability of 3'-end protected LNA oligonucleotides in rats

[0111] Figure 13 : In vivo evaluation of nicked polymers containing achiral phosphorothioate linkages in the flanking and nicked regions - target inhibition

[0112] Figure 14A : In vivo evaluation of nicked polymers containing achiral phosphorothioate linkages in the flanking and nicked regions - tissue uptake

[0113] Figure 14B : In vivo evaluation of nicked polymers containing achiral phosphorothioate linkages in the flanking and nicked regions - liver / kidney ratio

[0114] Figure 15A and Figure 15B : In vivo evaluation of nicked polymers containing achiral phosphorothioate linkages in the flanking and nicked regions - metabolite analysis

[0115] Figure 16 : The duration of action of antisense oligonucleotides containing achiral phosphorothioate internucleotide linkages can be further enhanced by combining with stereodefined phosphorothioate internucleotide linkages

[0116] Figure 17A : In vitro EC of achiral phosphorothioate nicked polymers targeting MALAT-1 50 determination.

[0117] Figure 17B : In vivo potency of achiral phosphorothioate nicked polymers targeting MALAT-1

[0118] Figure 17C : In vivo study of achiral phosphorothioate nicked polymers targeting MALAT-1 - tissue content

[0119] Figure 18A : In vitro study of achiral monophosphorothioate-modified nicked polymer oligonucleotides targeting ApoB. Activity data

[0120] Figure 18B : In vitro study of achiral monophosphorothioate-modified nicked polymer oligonucleotides targeting ApoB. Cell content data

[0121] Figure 19A: In vitro study of chiral dithiophosphate-modified gapmer oligonucleotides targeting ApoB. Activity data

[0122] Figure 19B : In vitro study of chiral dithiophosphate-modified gapmer oligonucleotides targeting ApoB. Cell content data.

[0123] Figure 20 : Effect of the achiral dithiophosphate (P2S) internucleoside linkage present in a splicing-switching oligonucleotide targeting the 3' splice site of TNFRSF1B. Human Colo 205 cells were seeded in 96-well plates and treated with 5 μM (A) and 25 μM (B) oligomers, respectively. The percentage of exon 7 skipping was analyzed by droplet digital PCR using a probe targeting the exon 6-8 junction and was compared to the total amount of TNFRSF1B by an assay targeting exons 2-3. SSO#26 is the parental oligomer and SSO#27 is a negative control that does not target TNFRSF1B.

[0124] Figure 21 : Stability assay using S1 nuclease. Oligomers containing dithioesters were incubated with S1 nuclease for 30 minutes and 120 minutes, respectively. The oligomers were visualized on a 15% TBE-urea gel. As a migration marker, intact oligomer (SSO#14) that did not undergo S1 nuclease treatment was included.

[0125] Definitions

[0126] In this specification, the term "alkyl", alone or in combination, refers to a straight-chain or branched-chain alkyl group having 1 to 8 carbon atoms, particularly a straight-chain or branched-chain alkyl group having 1 to 6 carbon atoms and more particularly a straight-chain or branched-chain alkyl group having 1 to 4 carbon atoms. Examples of straight-chain and branched-chain C1-C8 alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, isomeric pentyl, isomeric hexyl, isomeric heptyl, and isomeric octyl, particularly methyl, ethyl, propyl, butyl, and pentyl. Particular examples of alkyl groups are methyl, ethyl, and propyl.

[0127] The term "cycloalkyl", alone or in combination, refers to a cycloalkyl ring having 3 to 8 carbon atoms, particularly a cycloalkyl ring having 3 to 6 carbon atoms. Examples of cycloalkyl groups are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl, more specifically cyclopropyl and cyclobutyl. A specific example of "cycloalkyl" is cyclopropyl.

[0128] The term "alkoxy", alone or in combination, refers to a group of the formula alkyl-O-, where the term "alkyl" has the meaning given previously, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, and tert-butoxy. Specific "alkoxy" groups are methoxy and ethoxy. Methoxyethoxy is a specific example of an "alkoxyalkoxy".

[0129] The term "oxy", alone or in combination, refers to the -O- group.

[0130] The term "alkenyl", alone or in combination, refers to a straight-chain or branched-chain hydrocarbon residue containing an olefinic bond and up to 8, preferably up to 6, particularly preferably up to 4 carbon atoms. Examples of alkenyl are vinyl, 1-propenyl, 2-propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl, and isobutenyl.

[0131] The term "alkynyl", alone or in combination, refers to a straight-chain or branched-chain hydrocarbon residue containing a triple bond and up to 8, particularly 2 carbon atoms.

[0132] The term "halogen" or "halo", alone or in combination, refers to fluorine, chlorine, bromine, or iodine and specifically refers to fluorine, chlorine, or bromine, more specifically fluorine. The term "halo" in combination with another group means that the said group is substituted by at least one halogen, particularly by one to five halogens, specifically one to four halogens (i.e., one, two, three, or four halogens).

[0133] The term "haloalkyl", alone or in combination, refers to an alkyl group substituted by at least one halogen, particularly by one to five halogens, specifically one to three halogens. Examples of haloalkyl include mono-, di-, or trifluoro-substituted -methyl, -ethyl, or -propyl, such as 3,3,3-trifluoropropyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, fluoromethyl, or trifluoromethyl. Fluoromethyl, difluoromethyl, and trifluoromethyl are specific "haloalkyl".

[0134] The term "halocycloalkyl", alone or in combination, refers to a cycloalkyl as defined above substituted by at least one halogen, particularly by one to five halogens, specifically one to three halogens. Specific examples of "halocycloalkyl" are halocyclopropyl, particularly fluorocyclopropyl, difluorocyclopropyl, and trifluorocyclopropyl.

[0135] The term "hydroxyl", alone or in combination, refers to the -OH group.

[0136] The terms "thiohydroxyl" and "mercapto", alone or in combination, refer to the -SH group.

[0137] The term "carbonyl", alone or in combination, refers to the -C(O)- group.

[0138] The term "carboxyl", alone or in combination, refers to the -COOH group.

[0139] The term "amino", alone or in combination, refers to a primary amino group (-NH2), a secondary amino group (-NH-), or a tertiary amino group (-N-).

[0140] The term "alkylamino", alone or in combination, refers to an amino group as defined above that is substituted by one or two alkyl groups as defined above.

[0141] The term "sulfonyl", alone or in combination, means the -SO2 group.

[0142] The term "sulfinyl", alone or in combination, refers to the -SO- group.

[0143] The term "sulfanyl", alone or in combination, refers to the -S- group.

[0144] The term "cyano", alone or in combination, refers to the -CN group.

[0145] The term "azido", alone or in combination, refers to the -N3 group.

[0146] The term "nitro", alone or in combination, refers to the NO2 group.

[0147] The term "formyl", alone or in combination, refers to the -C(O)H group.

[0148] The term "carbamoyl", alone or in combination, refers to the -C(O)NH2 group.

[0149] The term "carbamido", alone or in combination, refers to the -NH-C(O)-NH2 group.

[0150] The term "aryl", alone or in combination, refers to a monovalent aromatic carbocyclic monocyclic or bicyclic system containing 6 to 10 carbon ring atoms, which system is optionally substituted by 1 to 3 substituents independently selected from the following: halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, and formyl. Examples of aryl include phenyl and naphthyl, especially phenyl.

[0151] The term "heteroaryl", alone or in combination, refers to a monocyclic or bicyclic system of a monovalent aromatic heterocycle having 5 to 12 ring atoms, said system containing 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining ring atoms being carbon, optionally substituted by 1 to 3 substituents independently selected from the following: halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of heteroaryl include pyrrolyl, furyl, thienyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, benzofuryl, isothiazolyl, benzothienyl, indolyl, isoindolyl, isobenzofuryl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzisothiazolyl, benzoxadiazolyl, benzothiadiazolyl, benzotriazolyl, purinyl, quinolyl, isoquinolyl, quinazolinyl, quinoxalinyl, carbazolyl or acridinyl.

[0152] The term "heterocyclyl", alone or in combination, refers to a monocyclic or bicyclic system of a monovalent saturated or partially unsaturated heterocycle having 4 to 12, especially 4 to 9 ring atoms, said system containing 1, 2, 3 or 4 ring heteroatoms selected from N, O and S, the remaining ring atoms being carbon, optionally substituted by 1 to 3 substituents independently selected from the following: halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of monocyclic saturated heterocyclyl are azetidinyl, pyrrolidinyl, tetrahydrofuryl, tetrahydro-thienyl, pyrazolidinyl, imidazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl, morpholinyl, thiomorpholinyl, 1,1-dioxo-thiomorpholin-4-yl, azepanyl, diazepanyl, homopiperazinyl or oxazepanyl. Examples of bicyclic saturated heterocycloalkyl are 8-aza-bicyclo[3.2.1]octyl, quinuclidinyl, 8-oxa-3-aza-bicyclo[3.2.1]octyl, 9-aza-bicyclo[3.3.1]nonyl, 3-oxa-9-aza-bicyclo[3.3.1]nonyl or 3-thia-9-aza-bicyclo[3.3.1]nonyl. Examples of partially unsaturated heterocycloalkyl are dihydrofuryl, imidazolinyl, dihydrooxazolyl, tetrahydropyridyl or dihydropyranyl.

[0153] The term "pharmaceutically acceptable salt" refers to those salts which retain the biological effects and properties of the free base or free acid and which are not biologically disadvantageous or adverse. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, especially hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, N-acetylcysteine. In addition, these salts can be prepared by adding an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include but are not limited to sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts. Salts derived from organic bases include but are not limited to salts formed with the following organic bases: primary amines, secondary amines and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, polyamine resins. The oligonucleotides of the present invention may also exist in zwitterionic form. Particularly preferred pharmaceutically acceptable salts of the present invention are sodium salts, lithium salts, potassium salts and trialkylammonium salts.

[0154] The term "protecting group", alone or in combination, refers to a group which selectively blocks a reactive site in a polyfunctional compound so that a chemical reaction can be carried out selectively at another unprotected reactive site. The protecting group can be removed. Exemplary protecting groups are amino protecting groups, carboxyl protecting groups or hydroxyl protecting groups.

[0155] A "phosphate protecting group" is a protecting group for a phosphate group. Examples of phosphate protecting groups are 2-cyanoethyl and methyl. A specific example of a phosphate protecting group is 2-cyanoethyl.

[0156] A "hydroxyl protecting group" is a protecting group for a hydroxyl group and is also used to protect a thiol group. Examples of hydroxyl protecting groups are acetyl (Ac), benzoyl (Bz), benzyl (Bn), β-methoxyethoxymethyl ether (MEM), dimethoxytrityl (or bis-(4-methoxyphenyl)phenylmethyl) (DMT), trimethoxytrityl (or tris-(4-methoxyphenyl)phenylmethyl) (TMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl or triphenylmethyl (Tr), silyl ethers (such as trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), triisopropylsilyloxymethyl (TOM) and triisopropylsilyl (TIPS) ethers), methyl ether and ethoxyethyl ether (EE). Specific examples of hydroxyl protecting groups are DMT and TMT, especially DMT.

[0157] "Thiol protecting group" is a protecting group for a thiol group. Examples of thiol protecting groups are those groups that are "hydroxyl protecting groups".

[0158] If one of the starting materials or compounds of the present invention contains one or more functional groups that are unstable or reactive under the reaction conditions of one or more reaction steps, then by methods well known in the art, suitable protecting groups can be introduced prior to the critical step (as described, for example, in "Protective Groups in Organic Chemistry" by T.W. Greene and P.G.M. Wuts, 3rd Edition, 1999, Wiley, New York). Standard methods described in the literature can be used to remove such protecting groups late in the synthesis. Examples of protecting groups are tert-butoxycarbonyl (Boc), 9-fluorenylmethyl carbamate (Fmoc), 2-trimethylsilylethyl carbamate (Teoc), benzyloxycarbonyl (Cbz), and p-methoxybenzyloxycarbonyl (Moz).

[0159] The compounds described herein can contain several asymmetric centers and can exist in the form of optically pure enantiomers, mixtures of enantiomers (such as, for example, racemates), mixtures of diastereomers, diastereomeric racemates, or mixtures of diastereomeric racemates.

[0160] Oligonucleotide

[0161] As used herein, the term "oligonucleotide" is defined as a molecule that contains two or more covalently linked nucleosides, as is commonly understood by those skilled in the art. Such covalently bound nucleosides can also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are often produced in the laboratory by solid-phase chemical synthesis methods and then purified. When referring to the sequence of an oligonucleotide, it refers to the sequence or order of the nucleobase portions of the covalently linked nucleotides or nucleosides or their modifications. The oligonucleotides of the present invention are artificial, chemically synthesized, and generally purified or isolated. The oligonucleotides of the present invention can contain one or more modified nucleosides or nucleotides.

[0162] Antisense oligonucleotide

[0163] As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of regulating target gene expression by hybridizing to a target nucleic acid, particularly to a contiguous sequence on the target nucleic acid. Antisense oligonucleotides are not substantially double-stranded and are thus not siRNA or shRNA. Preferably, the antisense oligonucleotides of the present invention are single-stranded. It is understood that the single-stranded oligonucleotides of the present invention can form hairpin or intermolecular duplex structures (duplexes between two identical oligonucleotides) as long as the degree of internal or intermolecular self-complementarity is less than 50% across the full length of the oligonucleotide.

[0164] Regulation of expression

[0165] As used herein, the term "regulation of expression" is to be understood as an umbrella term for the ability of an oligonucleotide to alter the expression of, or the level of, a target nucleic acid. The regulation of expression can be determined by comparing the expression of, or the level of, the target nucleic acid before administration of the oligonucleotide, or can be determined by reference to a control experiment in which the oligonucleotides of the invention are not administered. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mimic).

[0166] One type of regulation is the ability of an oligonucleotide to inhibit, downregulate, reduce, repress, remove, stop, block, prevent, attenuate, decrease, avoid, or terminate the expression of a target nucleic acid, for example by degrading the target nucleic acid (e.g., by RNase H1-mediated degradation) or blocking transcription. Another type of regulation is the ability of an oligonucleotide to restore, increase, or enhance the expression of a target RNA, for example by modulating splicing events on the target pre-mRNA or by blocking inhibitory mechanisms such as miRNA repression of mRNA.

[0167] Contiguous nucleotide sequence

[0168] The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary (e.g., fully complementary) to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence". In some embodiments, all of the nucleotides of the oligonucleotide constitute a contiguous nucleotide sequence. In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence, such as an F-G-F' gapmer region, and can optionally comprise additional nucleotides, such as a nucleotide linker region that can be used to conjugate a functional group to the contiguous nucleotide sequence, such as region D or D'. The nucleotide linker region can be complementary or non-complementary to the target nucleic acid. Antisense oligonucleotide hybrids as referred to herein can comprise a contiguous nucleotide sequence or can consist thereof.

[0169] Nucleotide

[0170] A "nucleotide" is the structural unit of oligonucleotides and polynucleotides and for the purposes of the present invention includes both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety, and one or more phosphate ester groups (which are not present in nucleosides). Nucleosides and nucleotides can also be referred to interchangeably as "units" or "monomers".

[0171] Modified nucleoside

[0172] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside modified as compared to an equivalent DNA nucleoside or RNA nucleoside, such as by the introduction of one or more sugar moieties or (nucleo)base moieties. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term "modified nucleoside" may also be used interchangeably herein with the term "nucleoside analogue" or modified "unit" or modified "monomer". Nucleosides having an unmodified DNA or RNA sugar moiety are referred to herein as DNA nucleosides or RNA nucleosides. Nucleosides having a modification in the base region of a DNA nucleoside or RNA nucleoside are generally still referred to as DNA or RNA if Watson Crick base pairing is permitted.

[0173] Modified internucleoside linkage

[0174] The term "modified internucleoside linkage" is defined as understood by one of ordinary skill in the art as linkages other than the phosphodiester (PO) linkage that covalently links two nucleosides together. The oligonucleotides of the present invention can thus comprise modified internucleoside linkages. In some embodiments, the modified internucleoside linkages increase the nuclease resistance of the oligonucleotide as compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage comprises a phosphate group that creates a phosphodiester linkage between adjacent nucleosides. Modified internucleoside linkages can be particularly useful for stabilizing oligonucleotides for in vivo use and can protect against nuclease cleavage in the DNA nucleoside or RNA nucleoside regions (e.g., inside the gap region of a gapmer oligonucleotide) as well as in the modified nucleoside regions (such as, regions F and F') of the oligonucleotides of the present invention.

[0175] In one embodiment, the oligonucleotide comprises one or more internucleoside linkages modified from a native phosphodiester, such as one or more modified internucleoside linkages that are more resistant to nuclease attack, for example. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (such as snake venom phosphodiesterase (SVPD)), both of which are well known in the art. An internucleoside linkage of an oligonucleotide that enhances nuclease resistance is referred to as an anti-nuclease internucleoside linkage. In some embodiments, at least 50% of the internucleoside linkages in the oligonucleotide or in its contiguous nucleotide sequence are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide or in its contiguous nucleotide sequence are anti-nuclease internucleoside linkages. In some embodiments, all of the internucleoside linkages in the oligonucleotide or in its contiguous nucleotide sequence are anti-nuclease internucleoside linkages. It will be appreciated that in some embodiments, the nucleosides linking the oligonucleotides of the present invention to non-nucleotide functional groups such as conjugates can be phosphodiesters.

[0176] A preferred modified internucleoside linkage for use in the oligonucleotides of the present invention is phosphorothioate.

[0177] Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics, and ease of production. In some embodiments, at least 50% of the internucleoside linkages in an oligonucleotide or a contiguous nucleotide sequence thereof are phosphorothioates, such as at least 60% of the internucleoside linkages in an oligonucleotide or a contiguous nucleotide sequence thereof, such as at least 70%, such as at least 80% or such as at least 90% of the internucleoside linkages are phosphorothioates. In some embodiments, all of the internucleoside linkages in an oligonucleotide or a contiguous nucleotide sequence thereof, except for dithiophosphorothioate internucleoside linkages, are phosphorothioates. In some embodiments, in addition to dithiophosphorothioate linkages, the oligonucleotides of the present invention further comprise phosphorothioate internucleoside linkages and at least one phosphodiester linkage, such as 2, 3, or 4 phosphodiester linkages. In a gapmer oligonucleotide, when present, the phosphodiester linkage is suitably not between contiguous DNA nucleosides in the gap region G.

[0178] Nuclease-resistant linkages (such as phosphorothioate linkages) are particularly useful in oligonucleotide regions that are capable of recruiting nucleases when forming a duplex with a target nucleic acid (such as region G of a gapmer). However, phosphorothioate linkages can also be used in regions that do not recruit nucleases and / or regions that enhance affinity (such as regions F and F' of a gapmer). In some embodiments, a gapmer oligonucleotide can comprise one or more phosphodiester linkages in region F or region F' or both regions F and F', wherein the internucleoside linkages in region G can be all phosphorothioates.

[0179] Advantageously, all of the internucleoside linkages in a contiguous nucleotide sequence of an oligonucleotide or all of the internucleoside linkages of an oligonucleotide are phosphorothioate linkages.

[0180] It is recognized that, as disclosed in EP 2 742 135, antisense oligonucleotides can comprise other internucleoside linkages (in addition to phosphodiesters and phosphorothioates), such as alkyl phosphonate internucleoside linkages / methyl phosphonate internucleoside linkages, which, according to EP 2 742 135, can be tolerated, for example, in a gap region that is not a DNA phosphorothioate.

[0181] Atactic phosphorothioate linkages

[0182] A phosphorothioate linkage is a internucleoside phosphate linkage in which one of the non-bridging oxygens has been replaced by sulfur. The replacement of an oxygen by sulfur introduces a chiral center and thus within a single phosphorothioate oligonucleotide, each phosphorothioate internucleoside linkage will be in the S(Sp) or R(Rp) stereoisomer. Such internucleoside linkages are referred to as "chiral internucleoside linkages". By comparison, phosphodiester internucleoside linkages are achiral because they have two non-terminal oxygen atoms.

[0183] The naming of the chirality of the stereogenic center is determined according to the standard Cahn-Ingold-Prelog rules (CIP priority rules) first published in the following literature: Cahn, R.S.; Ingold, C.K.; Prelog, V. (1966) "Specification of Molecular Chirality" Angewandte Chemie International Edition 5(4): 385–415. doi:10.1002 / anie.196603851.

[0184] During standard oligonucleotide synthesis, the stereoselectivity of coupling and subsequent sulfurization is uncontrolled. For this reason, the stereochemistry of each phosphorothioate internucleoside linkage is randomly Sp or Rp, and thus phosphorothioate oligonucleotides produced by conventional oligonucleotide synthesis methods can actually exist in up to 2 X different phosphorothioate diastereoisomers, where X is the number of phosphorothioate internucleoside linkages. Such oligonucleotides are referred to herein as stereorandom phosphorothioate oligonucleotides and do not contain any stereodefined internucleoside linkages. Stereorandom phosphorothioate oligonucleotides are thus mixtures of diastereoisomers derived from non-stereochemically defined synthesis. In this case, the mixture is defined as up to 2 X different phosphorothioate diastereoisomers.

[0185] Stereodefined internucleoside linkages

[0186] A stereodefined internucleoside linkage is a chiral internucleoside linkage that has an enantiomeric excess of one of its two diastereomeric forms, Rp or Sp.

[0187] It should be recognized that stereoselective oligonucleotide synthesis methods used in the art generally provide at least about 90% or at least about 95% diastereoselectivity at each chiral internucleoside linkage, and thus up to about 10%, such as about 5%, of the oligonucleotide molecules can have the alternative diastereomeric form.

[0188] In some embodiments, the diastereomeric ratio for each chiral internucleoside linkage that defines configuration is at least about 90:10. In some embodiments, the diastereomeric ratio for each chiral internucleoside linkage is at least about 95:5.

[0189] A phosphorothioate linkage that defines configuration is a specific example of an internucleoside linkage that defines configuration.

[0190] A phosphorothioate linkage that defines configuration

[0191] A phosphorothioate linkage that defines configuration is a phosphorothioate linkage having an enantiomeric excess for one of its two diastereomeric forms, Rp or Sp.

[0192] The Rp and Sp configurations of a phosphorothioate internucleoside linkage are shown below.

[0193]

[0194] Wherein the 3’R group represents the 3’ position of the adjacent nucleoside (5’ nucleoside), and the 5’R group represents the 5’ position of the adjacent nucleoside (3’ nucleoside).

[0195] Herein, the Rp internucleoside linkage can also be designated as srP, and the Sp internucleoside linkage can be designated as ssP.

[0196] In a specific embodiment, the diastereomeric ratio for each phosphorothioate linkage that defines configuration is at least about 90:10 or at least 95:5.

[0197] In some embodiments, the enantiomeric ratio for each phosphorothioate linkage that defines configuration is at least about 97:3. In some embodiments, the enantiomeric ratio for each phosphorothioate linkage that defines configuration is at least about 98:2. In some embodiments, the enantiomeric ratio for each phosphorothioate linkage that defines configuration is at least about 99:1.

[0198] In some embodiments, the internucleoside linkages that define configuration are in the same diastereomeric form (Rp or Sp) in at least 97%, such as at least 98%, such as at least 99%, or (substantially) all of the oligonucleotide molecules present in a population of oligonucleotide molecules.

[0199] The diastereomeric purity can be measured in a model system having only an achiral backbone (i.e., phosphodiester). The diastereomeric purity of each monomer can be measured by coupling monomers having a stereodefined internucleoside linkage to the following model system “5’t-po-t-po-t-po3’”. The result of such measurement will then give 5’DMTr-t-srp-t-po-t-po-t-po 3’ or 5’DMTr-t-ssp-t-po-t-po-t-po 3’ which can be separated by HPLC. The diastereomeric purity is determined by integrating the UV signals from the two possible diastereoisomers and obtaining the ratio of these diastereoisomers (e.g., 98:2, 99:1 or >99:1).

[0200] It should be understood that the diastereomeric purity of a particular single diastereoisomer (a single oligonucleotide molecule having a stereodefined structure) will vary with the coupling selectivity of the stereogenic centers defined at each internucleoside position and the number of stereodefined internucleoside linkages to be introduced. By way of example, if the coupling selectivity at each position is 97%, the resulting purity of a stereodefined oligonucleotide having 15 stereodefined internucleoside linkages will be 0.97 15 , i.e., the desired diastereoisomer is 63% as compared to 37% of other diastereoisomers. The purity of the defined diastereoisomer can be improved after synthesis by purification (e.g., by HPLC such as ion exchange chromatography or reverse phase chromatography).

[0201] In some embodiments, a stereodefined oligonucleotide refers to an oligonucleotide population in which at least about 40% (such as at least about 50%) of the population belongs to the desired diastereoisomer.

[0202] In other words, in some embodiments, a stereodefined oligonucleotide refers to an oligonucleotide population in which at least about 40% (such as at least about 50%) of the population is composed of the desired (specific) stereodefined internucleoside linkage motif (also referred to as a stereodefined motif).

[0203] For a stereodefined oligonucleotide containing atactic internucleoside stereocenters and stereogenic internucleoside chiral centers, the purity of the stereodefined oligonucleotide is determined with reference to the % of the oligonucleotide population retaining the desired stereodefined internucleoside linkage motif, without considering atactic linkages in the calculation.

[0204] Nucleobase

[0205] The term "nucleobase" includes the purine moieties (e.g., adenine and guanine) and pyrimidine moieties (e.g., uracil, thymine, and cytosine) in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but are functional during nucleic acid hybridization. In such cases, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, volume 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0206] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolylcytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolyluracil, 2-thio-uracil, 2'-thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0207] The nucleobase moiety can be indicated by the letter code of each corresponding nucleobase (e.g., A, T, G, C, or U), where each letter can optionally include a functionally equivalent modified nucleobase. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides can be used.

[0208] Modified oligonucleotides

[0209] The term "modified oligonucleotide" describes an oligonucleotide that contains one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term chimeric "oligonucleotide" is a term that has been used in the literature to describe oligonucleotides with modified nucleosides.

[0210] Stereodefined oligonucleotides are defined

[0211] Stereodefined oligonucleotides are oligonucleotides in which at least one of the internucleoside linkages is a stereodefined internucleoside linkage.

[0212] A stereodefined phosphorothioate oligonucleotide is an oligonucleotide in which at least one of the internucleoside linkages is a stereodefined phosphorothioate internucleoside linkage.

[0213] Complementarity

[0214] The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It should be understood that oligonucleotides can contain nucleosides with modified nucleobases, such as 5-methylcytosine being often used in place of cytosine, and thus the term "complementarity" encompasses Watson Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al. (2012) Accounts of Chemical Research Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0215] As used herein, the term "% complementary" refers to the proportion of such nucleotides within a continuous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) where, at a given position, the nucleotide is complementary (i.e., forms a Watson Crick base pair) to the continuous nucleotide sequence at the given position in a separate nucleic acid molecule (e.g., a target nucleic acid). This percentage is calculated by: (when aligning the target sequence 5'-3' and the oligonucleotide sequence 3'-5') counting the number of aligned bases that form pairs between the two sequences, dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison, unaligned (forming base pairs) nucleobases / nucleotides are called mismatches. Preferably, insertions and deletions are not allowed when calculating the % complementarity of a continuous nucleotide sequence.

[0216] The term "fully complementary" refers to 100% complementarity.

[0217] Identity

[0218] As used herein, the term "identity" refers to the number of nucleotides in a contiguous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide), expressed as a percentage, where at a given position, the nucleotide is identical to the contiguous nucleotide sequence at the given position of a separate nucleic acid molecule (e.g., a target nucleic acid) (i.e., in terms of its ability to form Watson Crick base pairs with a complementary nucleoside). This percentage is calculated by counting the number of aligned bases that are the same between the two sequences, dividing by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Percent identity = (matches x 100) / length of the aligned region. Preferably, insertions and deletions are not allowed when calculating the % complementarity of the contiguous nucleotide sequences.

[0219] Hybridization

[0220] As used herein, the terms "hybridized" or "hybridization" will be understood to mean that two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) form hydrogen bonds between base pairs on opposite strands, thus forming a duplex. The affinity of the binding interaction between the two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T m ), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. Under physiological conditions, T m is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515–537). The standard state Gibbs free energy ΔG° is a more precise measure of the binding affinity and is related to the dissociation constant (K d ) of the reaction by ΔG° = -RTln(K d) related, where R is the gas constant and T is the absolute temperature. Thus, a very low ΔG° for the reaction between the oligonucleotide and the target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction where the water concentration is 1 M, the pH is 7, and the temperature is 37 °C. Hybridization of the oligonucleotide to the target nucleic acid is a spontaneous reaction and for a spontaneous reaction, ΔG° is less than zero. For example, ΔG° can be experimentally measured by using an isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36–38 and Holdgate et al., 2005, Drug Discov Today. One of ordinary skill in the art will know that commercial equipment is available for measuring ΔG°. ΔG can also be numerically estimated by using the nearest neighbor model as described in Santa Lucia, 1998, Proc Natl Acad Sci USA. 95:1460–1465 and appropriately using the thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211–11216 and McTigue et al., 2004, Biochemistry 43:5388–5405. To obtain the possibility of modulating its intended nucleic acid target by hybridization, the oligonucleotides of the present invention hybridize to the target nucleic acid with an estimated ΔG° value of less than -10 kcal for oligonucleotides having a length of 10 - 30 nucleotides. In some embodiments, the degree or strength of hybridization is measured based on the standard state Gibbs free energy ΔG°. The oligonucleotide can hybridize to the target nucleic acid with an estimated ΔG° value of less than 10 kcal, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal for oligonucleotides having a length of 8 - 30 nucleotides. In some embodiments, the oligonucleotide hybridizes to the target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, such as -12 to -40 kcal, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal.

[0221] Sugar modification

[0222] When compared to the ribose sugar moiety present in DNA and RNA, the oligomers of the present invention can comprise one or more nucleosides having a modified sugar moiety (i.e., sugar moiety modification).

[0223] Numerous nucleosides having a modified ribose sugar moiety have been generated, mainly for the purpose of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0224] Such modifications include modifications where, for example, the ribose ring structure is modified by replacing it with: a hexose ring (HNA) or a bicyclic ring (LNA) generally having a double bridge between the C2 and C4 carbons on the ribose ring or a non-linked ribose ring generally lacking a bond between the C2 carbon and the C3 carbon (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acid (WO2011 / 017521) or tricyclic nucleic acid (WO 2013 / 154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced by a non-sugar moiety, such as in the case of peptide nucleic acid (PNA) or morpholino nucleic acid.

[0225] Sugar modifications also include modifications made by changing a substituent on the ribose ring to a group other than hydrogen or the 2'-OH group naturally present in DNA nucleosides and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4' or 5' positions.

[0226] 2'-sugar modified nucleosides

[0227] 2'-sugar modified nucleosides are nucleosides that have a substituent other than H or -OH at the 2' position (2'-substituted nucleosides) or contain a 2'-linked double group capable of forming a bridge between the 2' carbon and a second carbon in the ribose ring, such as LNA (2'-4'-bicyclic bridged) nucleosides.

[0228] In fact, most attention has been devoted to the development of 2'-substituted nucleosides, and numerous 2'-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can provide enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. Other examples can be found, for example, in Freier and Altmann; Nucl. Acid Res., 1997, 25, 4429 - 4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293 - 213 and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Some 2'-substituted modified nucleosides are shown below.

[0229]

[0230] In relation to the present invention, 2'-substitution does not include 2'-bridged molecules such as LNA.

[0231] Locked nucleic acid nucleosides (LNA nucleosides)

[0232] "LNA nucleoside" is a 2'-modified nucleoside that contains a C2'-C4' bivalent (also referred to as a "2'-4' bridge") connecting the ribose sugar ring of the nucleoside, and the bivalent restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). For complementary RNA or DNA molecules, when incorporating LNA into an oligonucleotide, locking the conformation of the ribose is associated with enhanced hybridization affinity (duplex stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0233] The following non-limiting exemplary LNA nucleosides are disclosed in the following documents: WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729; Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76; Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81 and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238.

[0234] The 2'-4' bridge contains 2 to 4 bridging atoms and particularly has the formula -X-Y-, where X is connected to C4' and Y is connected to C2'.

[0235] where

[0236] X is oxygen, sulfur, -CR a R b -, -C(R a )=C(R b )-, -C(=CR a R b )-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -; -O-NR a -, -NR a -O-, -C(=J)-, Se, -O-NR a -, -NR a -CR aR b -, -N(R a )-O- or -O-CR a R b -;

[0237] Y is oxygen, sulfur, -(CR a R b ) n -, -CR a R b -O-CR a R b -, -C(R a )=C(R b )-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -, -C(=J)-, Se, -O-NR a -, -NR a -CR a R b -, -N(R a )-O- or -O-CR a R b -;

[0238] provided that -X-Y- is not -O-O-, Si(R a )2-Si(R a )2-, -SO2-SO2-, -C(R a )=C(R b )-C(R a )=C(R b ), -C(R a )=N-C(R a )=N-, -C(R a )=N-C(R a )=C(R b ), -C(R a )=C(R b )-C(R a )=N- or -Se-Se-;

[0239] J is oxygen, sulfur, =CH2 or =N(R a );

[0240] R a and R bindependently selected from hydrogen, halogen, hydroxy, cyano, mercapto, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocyclyl, amino, alkylamino, carbamoyl, alkylaminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, alkylcarbonylamino, ureido, alkanoyloxy, sulfonyl, alkylsulfonyloxy, nitro, azido, thiohydroxylsulfidealkylsulfanyl, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, -OC(=X a )R c 、-OC(=X a )NR c R d and-NR e C(=X a )NR c R d ;

[0241] or two R a and R b together form an optionally substituted methylene group;

[0242] or two R a and R b Together with the carbon atom to which they are attached, they form a cycloalkyl or halocycloalkyl group having only one carbon atom of -XY-;

[0243] wherein substituted alkyl, substituted alkenyl, substituted alkynyl, substituted alkoxy and substituted methylene are alkyl, alkenyl, alkynyl and methylene substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, heterocyclyl, aryl and heteroaryl;

[0244] X a is oxygen, sulfur or -NR c ;

[0245] R c , R d and R e are independently selected from hydrogen and alkyl; and

[0246] n is 1, 2, or 3.

[0247] In yet another embodiment of the present invention, X is oxygen, sulfur, -NR a -、-CR a R b -or-C(=CRa R b )-, specifically oxygen, sulfur, -NH-, -CH2- or -C(=CH2)-, more specifically oxygen.

[0248] In another specific embodiment of the present invention, Y is -CR a R b -, -CR a R b -CR a R b - or -CR a R b- CR a R b- CR a R b -, especially -CH2-CHCH3-, -CHCH3-CH2-, -CH2-CH2- or -CH2-CH2-CH2-.

[0249] In a specific embodiment of the present invention, -X-Y- is -O-(CR a R b ) n -, -S-CR a R b -, -N(R a )CR a R b -, -CR a R b -CR a R b -, -O-CR a R b -O-CR a R b -, -CR a R b -O-CR a R b -, -C(=CR a R b )-CR a R b -, -N(R a )CR a R b -, -O-N(R a )-CR a R b - or -N(R a )-O-CR a R b -.

[0250] In a specific embodiment of the present invention, R a and R bIndependently selected from hydrogen, halogen, hydroxyl, alkyl, and alkoxyalkyl, especially hydrogen, halogen, alkyl, and alkoxyalkyl.

[0251] In another embodiment of the present invention, R a and R b Independently selected from hydrogen, fluorine, hydroxyl, methyl, and -CH2-O-CH3, especially hydrogen, fluorine, methyl, and -CH2-O-CH3.

[0252] Advantageously, one of the R a and R b in -X-Y- is defined as above and the remaining ones are all hydrogen at the same time.

[0253] In yet another specific embodiment of the present invention, R a is hydrogen or alkyl, especially hydrogen or methyl.

[0254] In another specific embodiment of the present invention, R b is hydrogen or alkyl, especially hydrogen or methyl.

[0255] In a specific embodiment of the present invention, one or both of R a and R b are hydrogen.

[0256] In a specific embodiment of the present invention, only one of R a and R b is hydrogen.

[0257] In a specific embodiment of the present invention, one of R a and R b is methyl and the other is hydrogen.

[0258] In a specific embodiment of the present invention, R a and R b are both methyl at the same time.

[0259] In a specific embodiment of the present invention, -X-Y- is -O-CH2-, -S-CH2-, -S-CH(CH3)-, -NH-CH2-, -O-CH2CH2-, -O-CH(CH2-O-CH3)-, -O-CH(CH2CH3)-, -O-CH(CH3)-, -O-CH 2- O-CH2-, -O-CH2-O-CH2-, -CH2-O-CH2-, -C(=CH2)CH2-, -C(=CH2)CH(CH3)-, -N(OCH3)CH2- or -N(CH3)CH2-;

[0260] In a specific embodiment of the present invention, -X-Y- is -O-CR aR b -, wherein R a and R b are independently selected from hydrogen, alkyl and alkoxyalkyl, especially hydrogen, methyl and -CH2-O-CH3.

[0261] In one specific embodiment, -X-Y- is -O-CH2- or -O-CH(CH3)-, especially -O-CH2-.

[0262] The 2'-4' bridge can be located below the plane of the ribose ring (β-D-configuration), or above the plane of the ring (α-L-configuration), as shown in formula (A) and formula (B) respectively.

[0263] The LNA nucleosides of the present invention especially belong to formula (B1) or (B2)

[0264]

[0265] wherein

[0266] W is oxygen, sulfur, -N(R a )- or -CR a R b -, especially oxygen;

[0267] B is a nucleobase or a modified nucleobase;

[0268] Z is an internucleoside linkage to an adjacent nucleoside or a 5'-terminal group;

[0269] Z* is an internucleoside linkage to an adjacent nucleoside or a 3'-terminal group;

[0270] R 1 、R 2 、R 3 、R 5 and R 5* are independently selected from hydrogen, halogen, alkyl, haloalkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, azido, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl, formyl and aryl; and

[0271] X, Y, R a and R b are as defined above.

[0272] In one specific embodiment, in the definition of -X-Y-, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of -X-Y-, R b is hydrogen or alkyl, especially hydrogen or methyl. In yet another specific embodiment, in the definition of -X-Y-, R a and R bOne or both of them are hydrogen. In a specific embodiment, in the definition of -X-Y-, R a and R b Only one of them is hydrogen. In a specific embodiment, in the definition of -X-Y-, R a and R b One of them is methyl and the other is hydrogen. In a specific embodiment, in the definition of -X-Y-, R a and R b Both are methyl at the same time.

[0273] In yet another specific embodiment, in the definition of X, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of X, R b is hydrogen or alkyl, especially hydrogen or methyl. In a specific embodiment, in the definition of X, R a and R b One or both of them are hydrogen. In a specific embodiment, in the definition of X, R a and R b Only one of them is hydrogen. In a specific embodiment, in the definition of X, R a and R b One of them is methyl and the other is hydrogen. In a specific embodiment, in the definition of X, R a and R b Both are methyl at the same time.

[0274] In yet another specific embodiment, in the definition of Y, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of Y, R b is hydrogen or alkyl, especially hydrogen or methyl. In a specific embodiment, in the definition of Y, R a and R b One or both of them are hydrogen. In a specific embodiment, in the definition of Y, R a and R b Only one of them is hydrogen. In a specific embodiment, in the definition of Y, R a and R b One of them is methyl and the other is hydrogen. In a specific embodiment, in the definition of Y, R a and R b Both are methyl at the same time.

[0275] In a specific embodiment of the present invention, R 1 、R 2 、R 3 、R 5 and R 5*Independently selected from hydrogen and alkyl, especially hydrogen and methyl.

[0276] In yet another specific and advantageous embodiment of the present invention, R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen simultaneously.

[0277] In another specific embodiment of the present invention, R 1 , R 2 , R 3 are all hydrogen simultaneously, one of R 5 and R 5* is hydrogen and the other is as defined above, specifically alkyl, more specifically methyl.

[0278] In a specific embodiment of the present invention, R 5 and R 5* are independently selected from hydrogen, halogen, alkyl, alkoxyalkyl, and azido, especially selected from hydrogen, fluorine, methyl, methoxyethyl, and azido. In a specific and advantageous embodiment of the present invention, one of R 5 and R 5* is hydrogen and the other is alkyl, especially methyl, halogen, especially fluorine, alkoxyalkyl, especially methoxyethyl, or azido; or R 5 and R 5* are both hydrogen or halogen simultaneously, especially both hydrogen or fluorine simultaneously. In such specific embodiments, W can advantageously be oxygen, and -X-Y- is advantageously -O-CH2-.

[0279] In a specific embodiment of the present invention, -X-Y- is -O-CH2-, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen simultaneously. Such LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, and WO 2004 / 046160, all of which are hereby incorporated by reference herein and include β-D-oxy LNA nucleosides and α-L-oxy LNA nucleosides commonly known in the art.

[0280] In another specific embodiment of the present invention, -X-Y- is -S-CH2-, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5*At the same time, they are all hydrogen. Such thio-LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated herein by reference.

[0281] In another specific embodiment of the present invention, -X-Y- is -NH-CH2-, W is oxygen and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such amino-LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated herein by reference.

[0282] In another specific embodiment of the present invention, -X-Y- is -O-CH2CH2- or -OCH2CH2CH2-, W is oxygen, and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such LNA nucleosides are disclosed in WO 00 / 047599 and Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, which are hereby incorporated herein by reference and include 2'-O-4'C-ethylene-bridged nucleic acids (ENA) commonly known in the art.

[0283] In another specific embodiment of the present invention, -X-Y- is -O-CH2-, W is oxygen, R 1 、R 2 、R 3 are all hydrogen at the same time, one of R 5 and R 5* is hydrogen and the other is not hydrogen, such as an alkyl group, for example, a methyl group. Such 5'-substituted LNA nucleosides are disclosed in WO 2007 / 134181, which is hereby incorporated herein by reference.

[0284] In another specific embodiment of the present invention, -X-Y- is -O-CR a R b -, where one or both of R a and R b are not hydrogen, especially an alkyl group, for example, a methyl group, W is oxygen, R 1 、R 2 、R 3 are all hydrogen at the same time, R 5 and R 5*One of them is hydrogen and the other is not hydrogen, especially an alkyl group, such as a methyl group. Such doubly modified LNA nucleosides are disclosed in WO 2010 / 077578, which is hereby incorporated by reference in its entirety.

[0285] In another specific embodiment of the present invention, -X-Y- is -O-CHR a -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. Such 6'-substituted LNA nucleosides are disclosed in WO 2010 / 036698 and WO 2007 / 090071, which are hereby incorporated by reference in their entirety. In such 6'-substituted LNA nucleosides, R a is especially a C1-C6 alkyl group, such as a methyl group.

[0286] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH2-O-CH3)- ("2'-O-methoxyethyl bicyclic nucleic acid", Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81).

[0287] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH2CH3)-;

[0288] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH2-O-CH3)-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. In the art, such LNA nucleosides are also referred to as cyclic MOE (cMOE) and are disclosed in WO2007 / 090071.

[0289] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH3)- ("2'-O-ethyl bicyclic nucleic acid", Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81).

[0290] In another specific embodiment of the present invention, -X-Y- is -O-CH 2- O-CH2- (Seth et al. J. Org. Chem. 2010, ibid.).

[0291] In another specific embodiment of the present invention, -X-Y- is -O-CH(CH3)-, W is oxygen and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such 6'-methyl LNA nucleosides are also referred to as cET nucleosides in the art and can be (S)-cET or (R)-cET diastereoisomers, as disclosed in WO 2007 / 090071 (β-D) and WO 2010 / 036698 (α-L), both of which are hereby incorporated by reference herein.

[0292] In another specific embodiment of the present invention, -X-Y- is -O-CR a R b -, where R a and R b are not hydrogen, W is oxygen and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. In a specific embodiment, R a and R b are both alkyl groups at the same time, especially both methyl groups at the same time. Such 6'-disubstituted LNA nucleosides are disclosed in WO 2009 / 006478, which is hereby incorporated by reference herein.

[0293] In another specific embodiment of the present invention, -X-Y- is -S-CHR a -, W is oxygen and R 1 、R 2 、R 3 、R 5 and R 5* are all hydrogen at the same time. Such 6'-substituted thio-LNA nucleosides are disclosed in WO 2011 / 156202, which is hereby incorporated by reference herein. In a specific embodiment of such 6'-substituted thio-LNA, R a is an alkyl group, especially a methyl group.

[0294] In a specific embodiment of the present invention, -X-Y- is -C(=CH2)C(R a R b )-, -C(=CHF)C(R a R b )- or -C(=CF2)C(R a R b )-, W is oxygen and R 1 、R2 , R 3 , R 5 and R 5* are all hydrogen at the same time. R a and R b are advantageously independently selected from hydrogen, halogen, alkyl, and alkoxyalkyl, especially hydrogen, methyl, fluorine, and methoxymethyl. R a and R b are especially all hydrogen or methyl at the same time or one of R a and R b is hydrogen and the other is methyl. Such vinyl carbon LNA nucleosides are disclosed in WO 2008 / 154401 and WO 2009 / 067647, and both of these documents are hereby incorporated by reference into this text for reference.

[0295] In a specific embodiment of the present invention, -X-Y- is -N(OR a ), -CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. In a specific embodiment, R a is an alkyl such as methyl. Such LNA nucleosides are also called N-substituted LNA and are disclosed in WO 2008 / 150729, and this document is hereby incorporated by reference into this text for reference.

[0296] In a specific embodiment of the present invention, -X-Y- is -O-N(R a ), -N(R a ), -O-, -NR a -CR a R b -CR a R b - or -NR a -CR a R b -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. R a and R b are advantageously independently selected from hydrogen, halogen, alkyl, and alkoxyalkyl, especially hydrogen, methyl, fluorine, and methoxymethyl. In a specific embodiment, R a is an alkyl, such as methyl, R b is hydrogen or methyl, especially hydrogen. (Seth et al., J. Org. Chem 2010, ibid.).

[0297] In a specific embodiment of the present invention, -X-Y- is -O-N(CH3)- (Seth et al., J. Org. Chem 2010, ibid.).

[0298] In a specific embodiment of the present invention, R 5 and R 5* are both hydrogen at the same time. In another specific embodiment of the present invention, one of R 5 and R 5* is hydrogen and the other is an alkyl group, such as methyl. In such embodiments, R 1 , R 2 and R 3 can especially be hydrogen and -X-Y- can especially be -O-CH2- or -O-CHC(R a )3-, such as -O-CH(CH3)-.

[0299] In a specific embodiment of the present invention, -X-Y- is -CR a R b -O-CR a R b -, such as -CH2-O-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. In such specific embodiments, R a can especially be an alkyl group such as methyl, R b can especially be hydrogen or methyl, especially hydrogen. Such LNA nucleosides are also called conformationally restricted nucleotides (CRN) and are disclosed in WO2013 / 036868, which is hereby incorporated by reference in its entirety.

[0300] In a specific embodiment of the present invention, -X-Y- is -O-CR a R b -O-CR a R b -, such as -O-CH2-O-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen at the same time. R a and R b are advantageously independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, especially hydrogen, methyl, fluorine and methoxymethyl. In such a specific embodiment, R a can especially be an alkyl group such as methyl, R bParticularly, it can be hydrogen or methyl, particularly hydrogen. Such LNA nucleotides are also referred to as COC nucleotides and are disclosed in Mitsuok et al., Nucleic Acids Research 2009, 37(4), 1225 - 1238, which is hereby incorporated by reference in its entirety.

[0301] It will be appreciated that, unless otherwise specified, the LNA nucleotides can be in the β - D or α - L stereoisomers.

[0302] Specific examples of the LNA nucleotides of the present invention are shown in Scheme 1 (where B is defined as above).

[0303] Scheme 1

[0304]

[0305]

[0306]

[0307] Specific LNA nucleotides are β - D - oxy - LNA, 6’ - methyl - β - D - oxy LNA such as (S) - 6’ - methyl - β - D - oxy - LNA ((S) - cET) and ENA.

[0308] MOE nucleotides

[0309] The term “MOE” stands for “methoxy - ethyl” and, by abbreviation, refers to nucleotides substituted with methoxy - ethoxy at the 2’ position as represented below.

[0310]

[0311] The above nucleotides can thus be named “MOE” or “2’ - O - MOE nucleotides”.

[0312] RNase H activity and recruitment

[0313] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when forming a duplex with a complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining RNase H activity, and this method can be used to determine the ability to recruit RNase H. An oligonucleotide is generally considered capable of recruiting RNase H if the following occurs: when a complementary target nucleic acid sequence is provided, it has such an initial rate measured in pmol / l / minute, and the initial rate is at least 5%, such as at least 10% or more than 20% of the initial rate determined using the following oligonucleotide and the method provided in Examples 91-95 of WO01 / 23613 (this document is thus incorporated herein by reference), where the oligonucleotide has the same base sequence as the test modified oligonucleotide but contains only DNA monomers, and all monomers of the oligonucleotide are phosphorothioate-linked. For use in determining RNase H activity, recombinant human RNase H1 is available from LubioScience GmbH, Switzerland.

[0314] Gapmer

[0315] The antisense oligonucleotide of the present invention or its continuous nucleotide sequence can be a gapmer. Antisense gapmers are often used to inhibit target nucleic acids by RNase H-mediated degradation. The gapmer oligonucleotide contains at least three distinct structural regions in the '5->3' orientation: a 5'-flanking region, a gap, and a 3'-flanking region, designated as F-G-F'. The "gap" region (G) contains a continuous DNA nucleotide that enables the oligonucleotide to recruit RNase H. Flanking the gap region are a 5'-flanking region (F) containing one or more sugar-modified nucleosides, advantageously sugar-modified high-affinity nucleosides, and a 3'-flanking region (F') containing one or more sugar-modified nucleosides, advantageously sugar-modified high-affinity nucleosides. One or more sugar-modified nucleosides in regions F and F' enhance the affinity of the oligonucleotide for the target nucleic acid (i.e., are sugar-modified nucleosides that enhance affinity). In some embodiments, one or more sugar-modified nucleosides in regions F and F' are 2'-sugar-modified nucleosides independently selected from LNA and 2'-MOE, such as high-affinity 2'-sugar modifications.

[0316] In the gapmer layout, the 5' and 3' terminal nucleosides of the gap region are DNA nucleosides, and sugar-modified nucleosides are present adjacent to the 5' (F) region or 3' (F') region, respectively. These flanking regions can be further defined by having at least one sugar-modified nucleoside at the end furthest from the gap region (i.e., at the 5' end of the 5'-flanking region and at the 3' end of the 3'-flanking region).

[0317] The region F-G-F' forms a continuous nucleotide sequence. The antisense oligonucleotide of the present invention or its continuous nucleotide sequence can contain a gapmer region of the formula F-G-F'.

[0318] The overall length of the nicked polymer layout F-G-F' can be, for example, 12 to 32 nucleotides, such as 13 to 24, such as 14 to 22 nucleotides, such as 14 to 17, such as 16 to 18 nucleotides.

[0319] By way of example, the nicked polymer oligonucleotides of the present invention can be represented by the following formula:

[0320] F 1-8 -G 5-16 -F' 1-8 , such as

[0321] F 1-8 -G 7-16 -F' 2-8

[0322] Provided that the overall length of the nicked polymer region F-G-F' is at least 12, such as at least 14 nucleotide lengths.

[0323] Regions F, G, and F' are further defined below and can be incorporated into the F-G-F' formula.

[0324] Nicked polymer - region G

[0325] The region G (nick region) of the nicked polymer is a nucleoside region that enables the oligonucleotide to recruit RNase H, such as human RNase H1, and is generally DNA nucleosides. RNase H is a cellular enzyme that recognizes the duplex between DNA and RNA and enzymatically cleaves the RNA molecule. Suitable nicked polymers can have a nick region (G) of at least 5 or 6 consecutive DNA nucleosides, such as 5–16 consecutive DNA nucleosides, such as 6–15 consecutive DNA nucleosides, such as 7-14 consecutive DNA nucleosides, such as 8–12 consecutive DNA nucleotides, such as 8–12 consecutive DNA nucleotides. In some embodiments, the nick region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive DNA nucleosides. In some cases, the cytosine (C) DNA in the nick region can be methylated, and such residues are annotated as 5-methyl-cytosine ( me C or e with c replaced). If a CpG dinucleotide is present in the nick, methylation of the cytosine DNA in the nick helps to reduce potential toxicity, and this modification has no significant effect on the efficacy of the oligonucleotide.

[0326] In some embodiments, the nick region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive phosphorothioate-linked DNA nucleosides. In some embodiments, all internucleoside linkages in the nick are phosphorothioate linkages.

[0327] Although conventional nicked polymers have DNA nicked regions, there are numerous instances of modified nucleosides that, when present within the nicked region, permit recruitment of RNase H. Modified nucleosides that have been reported to be capable of recruiting RNase H when incorporated within the nicked region include, for example, α-L-LNA, C4’-alkylated DNA (as described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296–2300, both of which are incorporated herein by reference), arabinose-derived nucleosides such as ANA and 2'F-ANA (Mangosr et al 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which is incorporated herein by reference). UNA is an unlocked nucleic acid, generally in which the bond between C2 and C3 of the ribose has been removed to form an unlocked “sugar” residue. The modified nucleosides used in such nicked polymers can be nucleosides that adopt a 2’-endo (DNA-like) conformation when introduced into the nicked region, i.e., modified nucleosides that permit recruitment of RNase H. In some embodiments, the DNA nicked region (G) described herein can optionally contain 1 to 3 sugar-modified nucleosides that adopt a 2’-endo (DNA-like) conformation when introduced into the nicked region.

[0328] Region G - “Gap-breaker”

[0329] Alternatively, there are numerous reports of inserting modified nucleosides that confer a 3'-endo conformation into the gap region of a gapped polymer while retaining some RNase H activity. Such gapped polymers with the following-described gap regions are referred to as "gap-breaker" or "gap-disrupted" gapped polymers, the gap regions of which contain one or more 3'-endo modified nucleosides, see, for example, WO2013 / 022984. Gap-breaker oligonucleotides retain a sufficient region of DNA nucleosides within the gap region to allow recruitment of RNase H. The ability of gap-breaker oligonucleotides to recruit RNase H generally has sequence specificity or even compound specificity - see Rukov et al., 2015 Nucl. Acids Res. Vol. 43 pp. 8476-8487, which discloses "gap-breaker" oligonucleotides that recruit RNase H and provide more specific target RNA cleavage in some cases. Modified nucleosides within the gap region of gap-breaker oligonucleotides can be, for example, modified nucleosides that confer a 3'-endo conformation, such as 2'-O-methyl (OMe) or 2'-O-MOE (MOE) nucleosides, or β-D LNA nucleosides (the bridge between C2' and C4' of the ribose sugar ring of the nucleoside is in the β conformation), such as β-D-oxy-LNA or ScET nucleosides.

[0330] Like the gapped polymers containing the above-described region G, the gap regions of gap-breaker gapped polymers or gap-disrupted gapped polymers have DNA nucleosides at the 5'-end of the gap (the 3'-nucleoside adjacent to region F) and DNA nucleosides at the 3'-end of the gap (the 5'-nucleoside adjacent to region F'). Gapped polymers containing disrupted gaps generally retain a region of at least 3 or 4 consecutive DNA nucleosides at the 5'-end or 3'-end of the gap region.

[0331] Exemplary layouts of gap-breaker oligonucleotides include

[0332] F 1-8 -[D 3-4 -E1-D 3-4 - F’ 1-8

[0333] F 1-8 -[D 1-4 -E1-D 3-4 -F’ 1-8

[0334] F 1-8 -[D 3-4 -E1-D 1-4 -F’ 1-8

[0335] where region G is within the brackets [D​n -E r -D m within the range, D is a contiguous DNA nucleoside sequence, E is a modified nucleoside (a nick breaker or a nick-hindering nucleoside), and F and F’ are flanking regions as defined herein, provided that the overall length of the nicked polymer region F-G-F’ is at least 12, such as at least 14 nucleotide lengths.

[0336] In some embodiments, the region G of the nick-hindering nicked polymer comprises at least 6 DNA nucleosides, such as 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 DNA nucleosides. As previously described, the DNA nucleosides may be contiguous or may optionally be interspersed with one or more modified nucleosides, provided that the nick region G is capable of mediating RNase H recruitment.

[0337] Nicked polymer - flanking regions, F and F’

[0338] Region F is present adjacent to the 5’ DNA nucleoside of region G. The 3’-most nucleoside of region F is a sugar-modified nucleoside, such as a sugar-modified high-affinity nucleoside, for example a 2’-substituted nucleoside, such as a MOE nucleoside, or a LNA nucleoside.

[0339] Region F’ is present adjacent to the 3’ DNA nucleoside of region G. The 5’-most nucleoside of region F’ is a sugar-modified nucleoside, such as a sugar-modified high-affinity nucleoside, for example a 2’-substituted nucleoside, such as a MOE nucleoside, or a LNA nucleoside.

[0340] Region F has a length of 1-8 contiguous nucleotides, such as 2-6, such as 3-4 contiguous nucleotide lengths. Advantageously, the 5’-most nucleoside of region F’ is a sugar-modified nucleoside. In some embodiments, the two 5’-most nucleosides of region F are sugar-modified nucleosides. In some embodiments, the 5’-most nucleoside of region F is a LNA nucleoside. In some embodiments, the two 5’-most nucleosides of region F are LNA nucleosides. In some embodiments, the two 5’-most nucleosides of region F are 2’-substituted nucleosides, such as two 3’ MOE nucleosides. In some embodiments, the 5’-most nucleoside of region F is a 2’-substituted nucleoside, such as a MOE nucleoside.

[0341] Region F’ has a length of 2-8 consecutive nucleotides, such as 3-6, such as 4-5 consecutive nucleotides. Advantageously, in some embodiments, the 3’-terminal nucleoside of region F’ is a sugar-modified nucleoside. In some embodiments, the two 3’-terminal nucleosides of region F’ are sugar-modified nucleosides. In some embodiments, the two 3’-terminal nucleosides of region F’ are LNA nucleosides. In some embodiments, the 3’-terminal nucleoside of region F’ is an LNA nucleoside. In some embodiments, the two 3’-terminal nucleosides of region F’ are 2’-substituted nucleosides, such as two 3’-MOE nucleosides. In some embodiments, the 3’-terminal nucleoside of region F’ is a 2’-substituted nucleoside, such as an MOE nucleoside.

[0342] It should be noted that when the length of region F or region F’ is one, it is advantageously an LNA nucleoside.

[0343] In some embodiments, region F and region F’ independently consist of or comprise a continuous sequence of sugar-modified nucleosides. In some embodiments, the sugar-modified nucleosides of region F can independently be selected from 2’-O-alkyl-RNA units, 2'-O-methyl-RNA, 2’-amino-DNA units, 2'-fluoro-DNA units, 2’-alkoxy-RNA, MOE units, LNA units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units.

[0344] In some embodiments, region F and region F’ independently comprise LNA and 2’-substituted modified nucleosides (hybrid flanking design).

[0345] In some embodiments, region F and region F’ consist of only one type of sugar-modified nucleoside (such as only MOE or only β-D-oxy-LNA or only ScET). Such a design is also referred to as a uniform flanking design or a uniform gapmer design.

[0346] In some embodiments, all of the nucleosides of region F or region F’ or both regions F and F’ are LNA nucleosides, such as independently selected from β-D-oxy-LNA, ENA, or ScET nucleosides. In some embodiments, region F consists of 1-5, such as 2-4, such as 3-4, such as 1, 2, 3, 4, or 5 consecutive LNA nucleosides. In some embodiments, all of the nucleosides of region F and region F’ are β-D-oxy-LNA nucleosides.

[0347] In some embodiments, all of the nucleosides in region F or region F’ or both regions F and F’ are 2’-substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments, region F consists of 1, 2, 3, 4, 5, 6, 7, or 8 consecutive OMe or MOE nucleosides. In some embodiments, only one of the flanking regions may consist of 2’-substituted nucleosides (such as OMe or MOE nucleosides). In some embodiments, it is the 5’ (F) flanking region that consists of 2’-substituted nucleosides (such as OMe or MOE nucleosides), while the 3’ (F’) flanking region contains at least one LNA nucleoside, such as a β-D-oxy-LNA nucleoside or a cET nucleoside. In some embodiments, it is the 3’ (F’) flanking region that consists of 2’-substituted nucleosides (such as OMe or MOE nucleosides), while the 5’ (F) flanking region contains at least one LNA nucleoside, such as a β-D-oxy-LNA nucleoside or a cET nucleoside.

[0348] In some embodiments, all of the modified nucleosides in regions F and F’ are LNA nucleosides, such as independently selected from β-D-oxy-LNA, ENA, or ScET nucleosides, wherein region F or region F’ or both F and F’ may optionally contain DNA nucleosides (alternating flanks, see the definitions of these regions for more details). In some embodiments, all of the modified nucleosides in regions F and F’ are β-D-oxy-LNA nucleosides, wherein region F or region F’ or both F and F’ may optionally contain DNA nucleosides (alternating flanks, see the definitions of these regions for more details).

[0349] In some embodiments, the 5’-terminal and 3’-terminal nucleosides of regions F and F’ are LNA nucleosides, such as β-D-oxy-LNA nucleosides or ScET nucleosides.

[0350] In some embodiments, the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between region F’ and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between the nucleosides in region F or region F’ or both F and F’ is a phosphorothioate internucleoside linkage.

[0351] Other gapmer designs are disclosed in WO 2004 / 046160, WO 2007 / 146511, and WO 2008 / 113832, which are hereby incorporated by reference in their entirety.

[0352] LNA Gapmer

[0353] An LNA gapmer is a gapmer in which either or both of region F and region F’ contain or consist of LNA nucleosides. A β-D-oxy gapmer is a gapmer in which either or both of region F and region F’ contain or consist of β-D-oxy-LNA nucleosides.

[0354] In some embodiments, the LNA gapmer has the formula: [LNA] 1–5 -[region G]-[LNA] 1-5 , where region G is defined as in the definition of the gapmer region G.

[0355] MOE gapmer

[0356] An MOE gapmer is a gapmer in which region F and region F’ consist of MOE nucleosides. In some embodiments, the MOE gapmer has the following layout: [MOE] 1-8 -[region G]-[MOE] 1-8 , as in [MOE] 2-7 -[region G] 5-16 -[MOE] 2-7 , as in [MOE] 3-6 -[region G]-[MOE] 3-6 , where region G is defined as in the gapmer definition. MOE gapmers with a 5-10-5 layout (MOE-DNA-MOE) have been widely used in the art.

[0357] Hybrid flanking gapmer

[0358] A hybrid flanking gapmer is an LNA gapmer in which one or both of region F and region F’ contain 2’-substituted nucleosides, such as 2’-substituted nucleosides independently selected from: 2’-O-alkyl-RNA units, 2'-O-methyl-RNA, 2’-amino-DNA units, 2'-fluoro-DNA units, 2’-alkoxy-RNA, MOE units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units, such as MOE nucleosides. In some embodiments in which at least one of region F and region F’ or both of region F and region F’ contain at least one LNA nucleoside, the remaining nucleosides of region F and region F’ are independently selected from MOE and LNA. In some embodiments in which at least one of region F and region F’ or both of region F and region F’ contain at least two LNA nucleosides, the remaining nucleosides of region F and region F’ are independently selected from MOE and LNA. In some hybrid flanking embodiments, one or both of region F and region F’ may further contain one or more DNA nucleosides.

[0359] Hybrid flanking gapmer layouts are disclosed in WO 2008 / 049085 and WO 2012 / 109395, which are hereby incorporated by reference in their entirety.

[0360] Alternating flanking gapmer

[0361] The flanking region can contain both LNA and DNA nucleotides and is termed "alternating flanks" because they contain an alternating motif of LNA-DNA-LNA nucleotides. A gapmer containing such alternating flanks is termed an "alternating flanking gapmer". An "alternating flanking gapmer" is thus an LNA gapmer oligonucleotide in which at least one of the flanks (F or F') contains DNA nucleotides in addition to LNA nucleotides. In some embodiments, at least one of region F or region F' or both regions F and F' contain both LNA and DNA nucleotides. In such embodiments, the flanking region F or F', or both F and F', contains at least three nucleotides, wherein the 5' and 3' terminal nucleotides of the F and / or F' region are LNA nucleotides.

[0362] Alternating flanking LNA gapmers are disclosed in WO 2016 / 127002.

[0363] The alternating flanking region can contain up to 3 consecutive DNA nucleotides, such as 1 to 2 or 1 or 2 or 3 consecutive DNA nucleotides.

[0364] The alternating flanks can be annotated as a series of integers that represent the number of LNA nucleotides (L), followed by the number of DNA nucleotides (D), e.g.

[0365] [L] 1-3 -[D] 1-4 -[L] 1-3

[0366] [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2

[0367] In the oligonucleotide layout, these will often be represented as numbers, so that 2-2-1 represents 5’[L]2-[D]2-[L]3’, and 1-1-1-1-1 represents 5’[L]-[D]-[L]-[D]-[L]3’. The lengths of the flanks (region F and region F’) in oligonucleotides with alternating flanks can independently be 3 to 10 nucleosides, such as 4 to 8, such as 5 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides. In some embodiments, only one of the flanks in the gapmer oligonucleotide has alternation, while the other is composed of LNA nucleotides. It can be advantageous to have at least two LNA nucleosides at the 3' end of the 3’ flank (F’) to confer additional exonuclease resistance. Some examples of oligonucleotides with alternating flanks are:

[0368] [L] 1-5 -[D] 1-4 -[L] 1-3 -[G] 5-16 -[L] 2-6

[0369] [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2 -[G] 5-16 -[L] 1-2 -[D] 1-3 -[L] 2-4

[0370] [L] 1-5 -[G] 5-16 -[L]-[D]-[L]-[D]-[L]2

[0371] Provided that the overall length of the gapmer is at least 12, such as at least 14 nucleotide lengths.

[0372] Region D’ or D” in the oligonucleotide

[0373] In some embodiments, the oligonucleotides of the invention can comprise a continuous nucleotide sequence (such as gapmer F-G-F’) complementary to the target nucleic acid and other 5’ and / or 3’ nucleosides or consist of them. The other 5’ and / or 3’ nucleosides can be fully complementary or can be not fully complementary to the target nucleic acid. Such other 5’ and / or 3’ nucleosides herein can be referred to as region D’ and D”.

[0374] To link a continuous nucleotide sequence, such as a nicked polymer, to a conjugate moiety or another functional group, regions D' or D'' can be added. When used for linking, the continuous nucleotide sequence with the conjugate moiety can act as a biocleavable linker. Alternatively, it can be used to provide exonuclease protection or facilitate synthesis or manufacture.

[0375] Regions D' and D'' can be linked to the 5'-end of region F or the 3'-end of region F', respectively, to produce layouts of the following formula: D'-F-G-F', F-G-F'-D'', or D'-F-G-F'-D''.

[0376] In this instance, F-G-F' is the nicked polymer portion of the oligonucleotide and regions D' or D'' constitute separate portions of the oligonucleotide.

[0377] Region D' or D'' can independently comprise or consist of 1, 2, 3, 4, or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' regions are not sugar-modified nucleotides, such as DNA or RNA or base-modified forms thereof. Region D' or D'' can act as a nuclease-labile biocleavable linker (see definition of linker). In some embodiments, the additional 5'- and / or 3'-terminal nucleotides are linked by phosphodiester linkages and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D'' are disclosed in WO 2014 / 076195, which by way of example includes phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in multi-oligonucleotide constructs is disclosed in WO 2015 / 113922, where they are used to link multiple antisense constructs (such as nicked polymer regions) within a single oligonucleotide.

[0378] In one embodiment, in addition to the continuous nucleotide sequence that constitutes the nicked polymer, the oligonucleotides of the invention further comprise region D' and / or D''.

[0379] In some embodiments, the oligonucleotides of the invention can be represented by the following formula:

[0380] F-G-F'; especially F 1-8 -G 5-16 -F' 2-8

[0381] D'-F-G-F'; especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8

[0382] F-G-F'-D''; especially F 1-8 -G 5-16-F’ 2-8 -D” 1-3

[0383] D’-F-G-F’-D”;especially D’ 1-3 -F 1-8 -G 5-16 -F’ 2-8 -D” 1-3

[0384] In some embodiments, the internucleoside linkage between region D’ and region F is a phosphodiester linkage. In some embodiments, the internucleoside linkage between region F’ and region D” is a phosphodiester linkage.

[0385] Totalmers

[0386] In some embodiments, all of the nucleosides of an oligonucleotide or a continuous nucleotide sequence thereof are sugar-modified nucleosides. Such oligonucleotides are referred to herein as totalmers.

[0387] In some embodiments, all of the sugar-modified nucleosides of a totalmer contain the same sugar modification. For example, they can all be LNA nucleosides, or they can all be 2’O-MOE nucleosides. In some embodiments, the sugar-modified nucleosides of a totalmer can be independently selected from LNA nucleosides and 2'-substituted nucleosides, such as 2'-substituted nucleosides selected from the following: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, an oligonucleotide contains LNA nucleosides and 2'-substituted nucleosides, such as 2'-substituted nucleosides selected from the following: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, an oligonucleotide contains LNA nucleosides and 2'-O-MOE nucleosides. In some embodiments, an oligonucleotide contains (S)cET LNA nucleosides and 2'-O-MOE nucleosides. In some embodiments, each nucleoside unit of an oligonucleotide is a 2'-substituted nucleoside. In some embodiments, each nucleoside unit of an oligonucleotide is 2'-O-MOE.

[0388] In some embodiments, all of the nucleosides of an oligonucleotide or a contiguous nucleotide sequence thereof are LNA nucleosides, such as β-D-oxy-LNA nucleosides and / or (S)cET nucleosides. In some embodiments, such LNA homopolymer oligonucleotides have a length between 7–12 nucleosides (see, for example, WO 2009 / 043353). Such short, intact LNA oligonucleotides are particularly effective in inhibiting microRNAs.

[0389] A variety of homopolymer compounds are highly effective as therapeutic oligomers, particularly when targeting microRNAs (anti-miR) or as splice-switching oligomers (SSO).

[0390] In some embodiments, the homopolymer comprises at least one XYX or YXY sequence motif, such as a repeating sequence XYX or YXY or consisting thereof, where X is an LNA and Y is an alternative (i.e., non-LNA) nucleotide analogue, such as a 2'-OMe RNA unit and a 2'-fluoro DNA unit. In some embodiments, the above sequence motifs can be, for example, XXY, XYX, YXY or YYX.

[0391] In some embodiments, the homopolymer can comprise or consist of a contiguous nucleotide sequence of between 7 and 24 nucleotides, such as 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.

[0392] In some embodiments, the contiguous nucleotide sequence of the homopolymer comprises at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as 95%, such as 100% LNA units. For fully LNA compounds, it is advantageous that they have a length of less than 12 (such as 7–10) nucleotides.

[0393] The remaining units can be selected from the non-LNA nucleotide analogues mentioned herein, such as those selected from 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, PNA units, HNA units, INA units and 2'-MOE RNA units or those selected from 2'-OMe RNA units and 2'-fluoro DNA units.

[0394] Heteropolymer

[0395] The term 'chimeramer' refers to an oligomer comprising both DNA nucleosides and sugar-modified nucleosides, where there is a sub-length of contiguous DNA nucleosides that recruits RNase H. Suitable chimeramers can contain up to 3 or up to 4 contiguous DNA nucleosides. In some embodiments, the chimeramer or its contiguous nucleotide sequence comprises alternating regions of sugar-modified nucleosides and DNA nucleosides. By incorporating alternating regions of sugar-modified nucleosides that form an RNA-like (3'-endo) conformation with the short DNA nucleoside region upon oligonucleotide incorporation, oligonucleotides that do not recruit RNase H can be prepared. Advantageously, the sugar-modified nucleosides are affinity-enhancing sugar-modified nucleosides.

[0396] Oligonucleotide chimeramers are often used to provide regulation based on occupancy of a target gene, such as a splicing regulator or a microRNA inhibitor.

[0397] In some embodiments, the sugar-modified nucleosides in the chimeramer or its contiguous nucleotide sequence comprise or are all LNA nucleosides, such as (S)cET or β-D-oxy-LNA nucleosides.

[0398] In some embodiments, all of the sugar-modified nucleosides of the chimeramer comprise the same sugar modification. For example, they can all be LNA nucleosides, or they can all be 2'-O-MOE nucleosides. In some embodiments, the sugar-modified nucleosides of the chimeramer can be independently selected from LNA nucleosides and 2'-substituted nucleosides, such as 2'-substituted nucleosides selected from: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, the oligonucleotide comprises LNA nucleosides and 2'-substituted nucleosides, such as 2'-substituted nucleosides selected from: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. In some embodiments, the oligonucleotide comprises LNA nucleosides and 2'-O-MOE nucleosides. In some embodiments, the oligonucleotide comprises (S)cET LNA nucleosides and 2'-O-MOE nucleosides.

[0399] In some embodiments, the chimeramer or its contiguous nucleotide sequence comprises only LNA and DNA nucleosides, and such LNA chimeramer oligonucleotides can, for example, be between 8 - 24 nucleosides in length (see, for example, WO2007112754, which discloses LNA antimiR inhibitors of microRNAs).

[0400] A variety of hybrid polymers are highly effective as therapeutic oligomers, particularly when targeting microRNAs (anti-miRs) or as splice-switching oligomers (SSOs).

[0401] In some embodiments, the hybrid polymer comprises the following motifs

[0402] …[L]m[D]n[L]m[D]n[L]m… or

[0403] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0404] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0405] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…

[0406] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0407] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0408] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m… or

[0409] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…

[0410] wherein L represents a sugar-modified nucleoside such as LNA or a 2'-substituted nucleoside (e.g., 2'-O-MOE), D represents a DNA nucleoside, and wherein each m is independently selected from 1–6, and each n is independently selected from 1, 2, 3, and 4, such as 1-3. In some embodiments, each L is an LNA nucleoside. In some embodiments, at least one L is an LNA nucleoside and at least one L is a 2'-O-MOE nucleoside. In some embodiments, each L is independently selected from LNA and 2'-O-MOE nucleosides.

[0411] In some embodiments, the chimeras can comprise or consist of a contiguous nucleotide sequence of from 10 to 24 nucleotides, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.

[0412] In some embodiments, the contiguous nucleotide sequence of the chimeras comprises at least 30%, such as at least 40%, such as at least 50% LNA units.

[0413] In some embodiments, the chimeras comprise or consist of a contiguous nucleotide sequence having a repeating pattern of nucleotide analogs and naturally occurring nucleotides, or a first type of nucleotide analogs and a second type of nucleotide analogs. The repeating pattern can be, for example, as follows: every second or every third nucleotide is a nucleotide analog, such as LNA, and the remaining nucleotides are naturally occurring nucleotides, such as DNA, or can be 2'-substituted nucleotide analogs such as 2'-MOE of 2'-fluoro analogs mentioned herein, or in some embodiments, can be selected from the group of nucleotide analogs mentioned herein. It is recognized that the repeating pattern of nucleotide analogs (such as LNA units) can be combined with nucleotide analogs at fixed positions, such as at the 5' or 3' termini.

[0414] In some embodiments, the first nucleotide of the oligomer, counted from the 3' terminus, is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0415] In some embodiments, which can be the same or different, the second nucleotide of the oligomer, counted from the 3' terminus, is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0416] In some embodiments, which can be the same or different, the 5' terminus of the oligomer is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0417] In some embodiments, the chimeras comprise at least one region that contains at least two contiguous nucleotide analog units (such as at least two contiguous LNA units).

[0418] In some embodiments, the chimeras comprise at least one region that contains at least three contiguous nucleotide analog units (such as at least three contiguous LNA units).

[0419] Exosomes

[0420] Exosomes are natural biological nanovesicles that participate in cell-cell communication by means of functional active cargo (such as miRNA, mRNA, DNA, and proteins), generally in the range of 30 to 500 nm.

[0421] Exosomes are secreted by all types of cells and are also abundantly present in body fluids such as saliva, blood, urine, and milk. The main role of exosomes is to carry information by delivering various effector or signaling molecules between specific cells (Acta Pol Pharm. July - August 2014; 71(4):537 - 43). Such effector or signaling molecules can be, for example, proteins, miRNAs, or mRNAs. Exosomes are currently being explored as delivery vehicles for various drug molecules, including RNA therapeutic molecules, to expand the therapeutic and diagnostic applications of such molecules. There are disclosures in the art of exosomes loaded with synthetic molecules such as siRNAs, antisense oligonucleotides, and small molecules, where the exosomes have been shown or suggested to have advantages in terms of the delivery and efficacy of such molecules compared to free drug molecules (see, for example, Andaloussi et al. 2013 Advanced Drug Delivery Reviews 65:391 - 397, WO2014 / 168548, WO2016 / 172598, WO2017 / 173034, and WO 2018 / 102397).

[0422] Exosomes can be isolated from biological sources such as milk (milk exosomes), and in particular, cow's milk is a rich source for isolating bovine milk exosomes. See, for example, Manca et al., Scientific Reports (2018) 8:11321.

[0423] In some embodiments of the present invention, single - stranded oligonucleotides are encapsulated in exosomes (exosome formulations), and examples of loading exosomes with single - stranded antisense oligonucleotides are described in EP application No. 18192614.8. In the methods of the present invention, antisense oligonucleotides can be administered to cells or subjects in the form of exosome formulations, and in particular, oral administration of exosome formulations is contemplated.

[0424] In some embodiments, the antisense oligonucleotides can be conjugated, for example, with a lipophilic conjugate such as cholesterol, and the lipophilic conjugate can be covalently linked to the antisense oligonucleotide via a biodegradable linker (such as a region of phosphodiester - linked DNA nucleotides). Such lipophilic conjugates can facilitate the entry of the antisense oligonucleotide formulation into exosomes and can further enhance delivery to target cells.

[0425] Conjugate

[0426] As used herein, the term "conjugate" refers to an oligonucleotide covalently linked to a non - nucleotide moiety (the conjugate moiety or region C or third region).

[0427] The conjugation of the oligonucleotides of the present invention with one or more non-nucleotide moieties can improve the pharmacology of the oligonucleotides, for example, by affecting the activity, cellular distribution, cellular uptake or stability of the oligonucleotides. In some embodiments, the conjugate moiety modulates or enhances the pharmacokinetic properties of the oligonucleotides by improving the cellular distribution, bioavailability, metabolism, excretion, permeability and / or cellular uptake of the oligonucleotides. In particular, the conjugate can direct the oligonucleotide to a specific organ, tissue or cell type and thus enhance the efficacy of the oligonucleotide in such organ, tissue or cell type. At the same time, the conjugate can serve to reduce the activity of the oligonucleotide in non-target cell types, tissues or organs (e.g., off-target activity or activity in non-target cell types, tissues or organs).

[0428] WO 93 / 07883 and WO 2013 / 033230 provide suitable conjugate moieties, and the documents are hereby incorporated by reference herein. Other suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular, trivalent N-acetylgalactosamine conjugate moieties are suitable for binding to ASGPR, see, for example, WO 2014 / 076196, WO 2014 / 207232 and WO 2014 / 179620 (the documents are hereby incorporated by reference herein). Such conjugates are used to enhance the uptake of oligonucleotides into the liver while reducing their presence in the kidney, thus increasing the liver / kidney ratio of the conjugated oligonucleotides compared to the unconjugated form of the same oligonucleotide.

[0429] Oligonucleotide conjugates and their synthesis have also been reported in the following documents: the comprehensive review by Manoharan, cited in Antisense Drug Technology, Principles, Strategies, and Applications, edited by S.T. Crooke, Chapter 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of the documents is hereby incorporated by reference in its entirety herein.

[0430] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from sugars, cell surface receptor ligands, drugs, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids) or combinations thereof.

[0431] Linker

[0432] A linkage or linker is a connection that joins one target chemical group or segment to another target chemical group or segment by means of one or more covalent bonds between two atoms. The conjugate moiety can be directly linked to the oligonucleotide or linked via a linking moiety (e.g., a linker or tether). The linker serves to covalently link a third region, such as a conjugate moiety (region C), to a first region, such as an oligonucleotide or contiguous nucleotide sequence (region A) that is complementary to the target nucleic acid.

[0433] In some embodiments of the invention, the conjugate or oligonucleotide conjugate of the invention may optionally comprise a linker region (second region or region B and / or region Y) located between the oligonucleotide or contiguous nucleotide sequence (region A or first region) that is complementary to the target nucleic acid and the conjugate moiety (region C or third region).

[0434] Region B refers to a biodegradable linker that comprises or consists of a physiologically labile bond that is cleavable under conditions normally encountered within the mammalian body or conditions similar to those encountered within the mammalian body. Conditions under which the physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration that are present or similar to those encountered within mammalian cells. Intracellular mammalian conditions also include the presence of enzymatic activities normally present in mammalian cells, such as those from proteolytic enzymes or hydrolases or nucleases. In one embodiment, the biodegradable linker is susceptible to cleavage by S1 nuclease. In a preferred embodiment, the nuclease-sensitive linker comprises between 1 and 10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, more preferably between 2 and 6 nucleosides and most preferably between 2 and 4 linked nucleosides, which comprise at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages. Preferably, the nucleosides are DNA or RNA. Biodegradable linkers containing phosphodiesters are described in more detail in WO 2014 / 076195 (which document is hereby incorporated by reference in its entirety).

[0435] Region Y refers to a linker that does not have to be biodegradable but mainly serves to covalently link the conjugate moiety (region C or third region) to the oligonucleotide (region A or first region). The region Y linker can comprise repeating units such as ethylene glycol units, amino acid units, or a chain structure or oligomer of aminoalkyls. The oligonucleotide conjugates of the invention can be constituted by the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C, or A-Y-C. In some embodiments, the linker (region Y) is aminoalkyl, such as C2–C36 aminoalkyl, for example including C6 to C12 aminoalkyl. In a preferred embodiment, the linker (region Y) is C6 aminoalkyl.

[0436] Administration

[0437] The oligonucleotides or pharmaceutical compositions of the present invention can be administered locally (e.g., to the skin, by inhalation, ocularly or aurally) or enterally (e.g., orally or through the gastrointestinal tract) or parenterally (e.g., intravenously, subcutaneously, intramuscularly, intracerebrally, intraventricularly or intrathecally).

[0438] In some embodiments, the oligonucleotides or pharmaceutical compositions of the present invention are administered by a parenteral route, which includes intravenous, intra-arterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial such as intracerebral or intraventricular, intravitreal administration. In one embodiment, an active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment, an oligonucleotide or oligonucleotide conjugate having subcutaneous activity is administered subcutaneously.

[0439] In some embodiments, the oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention are administered at a dose of 0.1–15 mg / kg, such as 0.2–10 mg / kg, such as 0.25–5 mg / kg. The administration can be once a week, every 2 weeks, every three weeks or once or twice a month.

[0440] The present invention also provides the use of the oligonucleotides or oligonucleotide conjugates of the present invention for the manufacture of a medicament, wherein the medicament is an ophthalmic dosage form such as an intravitreal injection dosage form. In some embodiments, the ophthalmic oligonucleotide is Htra-1.

[0441] The present invention also provides the use of the oligonucleotides or oligonucleotide conjugates of the present invention for the manufacture of a medicament, wherein the medicament is a dosage form for intravenous, subcutaneous, intramuscular, intracerebral, intraventricular or intrathecal administration (e.g., an injection).

[0442] Exemplary advantages

[0443] As shown herein, the achiral phosphorothioate internucleoside linkages used in the compounds of the present invention allow for a reduction in the complexity of the phosphorothioate oligonucleotides of undefined stereochemistry while maintaining the activity, efficacy or potency of the oligonucleotides.

[0444] Indeed, as shown herein, when combined with stereodefined phosphorothioates, the compounds of the present invention provide unique benefits, thus providing the opportunity to further reduce the complexity of phosphorothioate oligonucleotides while retaining or improving the activity, efficacy or potency of the oligonucleotides.

[0445] As shown herein, the achiral phosphorothioate internucleoside linkages used in the compounds of the present invention allow for improved cellular uptake in vitro or in vivo.

[0446] As shown herein, the achiral phosphorothioate internucleoside linkages used in the compounds of the invention allow for altered or improved biodistribution in vitro (as measured by tissue content or cellular content or activity / potency in the target tissue). Notably, we have seen improved tissue uptake, content, and / or potency in skeletal muscle, heart, spleen, liver, kidney, fibroblasts, and epithelial cells.

[0447] In the case of chimeric oligonucleotides, the inventors have identified that incorporation of phosphorothioate linkages (as shown in (IA) or (IB)) between or adjacent to one or more DNA nucleosides provides improvements such as enhanced stability and / or improved potency. In the case of gapmer oligonucleotides, the inventors have seen that incorporation of phosphorothioate linkages (as shown in (IA) or (IB)) between the nucleosides in the flanking regions (such as between 2'-sugar modified nucleosides) also provides improvements such as enhanced stability and / or improved potency.

[0448] As shown herein, the achiral phosphorothioate internucleoside linkages used in the compounds of the invention allow for improved oligonucleotide stability. Incorporation of achiral phosphorothioate internucleosides in the compounds of the invention provides enhanced resistance to serum and cellular exonucleases, particularly 3'-exonucleases, and additionally 5'-exonucleases, and the apparent stability of the compounds of the invention further suggests resistance to endonucleases. Stabilizing oligonucleotides is particularly important in reducing or preventing the accumulation of toxic degradation products and prolonging the duration of action of antisense oligonucleotides. As shown in the examples, rat serum stability can be used to analyze improved stability. To evaluate cellular stability, tissue (e.g., liver) homogenate extracts can be used - see, for example, WO2014076195, which provides such methods. Other assays for measuring oligonucleotide stability include the venom phosphodiesterase stability assay and the S1 nuclease stability.

[0449] The reduced toxicity risk of the claimed oligonucleotides is tested using in vitro hepatotoxicity assays (e.g., as disclosed in WO 2017 / 067970) or in vitro nephrotoxicity assays (e.g., as disclosed in WO 2017 / 216340) or in vitro neurotoxicity assays (e.g., as disclosed in WO2016127000). Alternatively, toxicity can be determined in vivo, for example, in mice or rats.

[0450] Enhanced stability can provide a benefit to the duration of action of the oligonucleotides of the invention, which is particularly beneficial when the route of administration is invasive, such as parenteral administration, e.g., intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intracerebroventricular, or intrathecal administration.

[0451] Gapmer Embodiments

[0452] 1. An antisense gapmer oligonucleotide for inhibiting a target RNA in a cell, wherein the antisense gapmer oligonucleotide comprises at least one phosphorodithioate internucleoside linkage of formula (IA) or (IB)

[0453]

[0454] wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation.

[0455] 2. The antisense gapmer oligonucleotide according to embodiment 1, wherein at least one phosphorodithioate internucleoside linkage has formula (IA) and R is hydrogen; or at least one phosphorodithioate internucleoside linkage has formula (IB) and M + is Na + , K + or ammonium.

[0456] 3. The gapmer oligonucleotide according to embodiment 1 or 2, wherein one of the two oxygen atoms of at least one internucleoside linkage of formula (I) is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside.

[0457] 4. The gapmer oligonucleotide according to any one of embodiments 1-3, wherein one of (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside and the other is a DNA nucleoside.

[0458] 5. The gapmer oligonucleotide according to any one of embodiments 1-3, wherein (A 1 ) and (A 2 ) are both 2'-modified nucleosides simultaneously.

[0459] 6. The gapmer oligonucleotide according to any one of embodiments 1-3, wherein (A 1 ) and (A 2 ) are both DNA nucleosides simultaneously.

[0460] 7. A nicked polymer oligonucleotide according to any one of embodiments 1 to 6, wherein the nicked polymer oligonucleotide comprises a continuous nucleotide sequence of formula 5'-F-G-F'-3', wherein G is a region of 5 to 18 nucleosides capable of recruiting RNase H, and said region G is flanked by flanking regions F and F' at the 5' and 3' sides respectively, wherein regions F and F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, and the nucleoside of region F adjacent to region G is a 2'-sugar modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar modified nucleoside.

[0461] 8. A nicked polymer oligonucleotide according to any one of embodiments 1 to 7, wherein the 2'-sugar modified nucleosides are independently selected from 2'-alkoxy-RNA nucleosides, 2'-alkoxyalkoxy-RNA nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, 2'-fluoro-ANA nucleosides, and LNA nucleosides.

[0462] 9. The nicked polymer oligonucleotide according to embodiment 8, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA (2'-O-MOE).

[0463] 10. A nicked polymer oligonucleotide according to any one of embodiments 7 to 8, wherein regions F and F' comprise or consist of 2'-methoxyethoxy-RNA nucleotides.

[0464] 11. A nicked polymer oligonucleotide according to any one of embodiments 7 to 10, wherein at least one or all of the 2'-sugar modified nucleosides in region F or region F' or both regions F and F' are LNA nucleosides.

[0465] 12. A nicked polymer oligonucleotide according to any one of embodiments 7 to 11, wherein region F or region F' or both regions F and F' comprise at least one LNA nucleoside and at least one DNA nucleoside.

[0466] 13. A nicked polymer oligonucleotide according to any one of embodiments 7 to 12, wherein region F or region F' or both regions F and F' comprise at least one LNA nucleoside and at least one non-LNA 2'-sugar modified nucleoside, such as at least one 2'-methoxyethoxy-RNA nucleoside.

[0467] 14. A nicked polymer oligonucleotide according to any one of embodiments 1 to 13, wherein the nicked region comprises 5 to 16, particularly 8 to 16, more specifically 8, 9, 10, 11, 12, 13, or 14 consecutive DNA nucleosides.

[0468] 15. A nicked polymer oligonucleotide according to any one of embodiments 1 to 14, wherein region F and region F’ independently have a length of 1, 2, 3, 4, 5, 6, 7 or 8 nucleosides.

[0469] 16. A nicked polymer oligonucleotide according to any one of embodiments 1 to 15, wherein region F and region F’ each independently comprise 1, 2, 3 or 4 LNA nucleosides.

[0470] 17. A nicked polymer oligonucleotide according to any one of embodiments 8 to 16, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6’-methyl-β-D-oxy-LNA and ENA.

[0471] 18. A nicked polymer oligonucleotide according to embodiments 8-18, wherein the LNA nucleoside is β-D-oxy-LNA.

[0472] 19. A nicked polymer oligonucleotide according to any one of embodiments 1 to 18, wherein the oligonucleotide or its consecutive nucleotide sequence (F-G-F’) has a length of 10 to 30 nucleotides, particularly 12 to 22, more particularly 14 to 20 nucleotides in length.

[0473] 20. A nicked polymer oligonucleotide according to any one of embodiments 1–19, wherein at least one of the flanking regions, such as region F and region F’, comprises a phosphorodithioate linkage of formula (IA) or (IB) as defined in any one of embodiments 1–19.

[0474] 21. A nicked polymer oligonucleotide according to any one of embodiments 1–19, wherein both flanking regions, such as region F and region F’, comprise a phosphorodithioate linkage of formula (IA) or (IB) as defined in any one of embodiments 1–19.

[0475] 22. A nicked polymer oligonucleotide according to any one of embodiments 1–21, wherein at least one of the flanking regions, such as F or F’, comprises a phosphorodithioate linkage of formula (IA) or (IB) as defined in any one of embodiments 1–19.

[0476] 23. A nicked polymer oligonucleotide according to any one of embodiments 1–21, wherein both flanking regions F and F’ comprise at least two phosphorodithioate linkages of formula (IA) or (IB) as defined in any one of embodiments 1–19.

[0477] 24. A nicked polymer oligonucleotide according to any one of embodiments 1–23, wherein one or both of the flanking regions each comprise LNA nucleosides having a phosphorodithioate linkage of formula (IA) or (IB) that links the LNA to a 3′ nucleoside.

[0478] 25. A nicked polymer oligonucleotide according to any one of embodiments 1–24, wherein one or both of the flanking regions each comprise two or more contiguous LNA nucleosides linked by a phosphorodithioate linkage of formula (IA) or (IB), wherein the phosphorodithioate linkage of formula (IA) or (IB) links the LNA to a 3′ nucleoside.

[0479] 26. A nicked polymer oligonucleotide according to any one of embodiments 1–25, wherein one or both of the flanking regions each comprise MOE nucleosides having a phosphorodithioate linkage of formula (IA) or (IB) that links the MOE to a 3′ nucleoside.

[0480] 27. A nicked polymer oligonucleotide according to any one of embodiments 1–26, wherein one or both of the flanking regions each comprise two or more contiguous MOE nucleosides linked by a phosphorodithioate linkage of formula (IA) or (IB), wherein the phosphorodithioate linkage of formula (IA) or (IB) links the MOE to a 3′ nucleoside.

[0481] 28. A nicked polymer oligonucleotide according to any one of embodiments 1–27, wherein the flanking regions F and F′ together comprise 1, 2, 3, 4, or 5 phosphorodithioate internucleoside linkages of formula (IA) or (IB), and wherein optionally, the internucleoside linkage between the 3′-most nucleoside of region F and the 5′-most nucleoside of region G is also a phosphorodithioate internucleoside linkage of formula (IA) or (IB).

[0482] 29. A nicked polymer oligonucleotide according to any one of embodiments 1 to 28, which comprises a phosphorodithioate internucleoside linkage of formula (IA) or (IB) between adjacent nucleosides located in region F or region F′, between region F and region G, or between region G and region F′.

[0483] 30. A nicked polymer region according to any one of embodiments 1–29, wherein the nicked region comprises 1, 2, 3, or 4 phosphorodithioate internucleoside linkages of formula (IA) or (IB), and wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0484] 31. A nicked polymer according to any one of embodiments 1–30, wherein the nicked region comprises a region having at least 5 consecutive DNA nucleotides, such as a region having 6–18 consecutive DNA nucleotides or 8–14 consecutive DNA nucleotides.

[0485] 32. A nicked polymer according to any one of embodiments 1–31, which further comprises one or more stereodefined phosphorothioate internucleoside linkages (Sp,S) or (Rp,R)

[0486]

[0487] wherein N 1 and N 2 are nucleosides.

[0488] 33. The nicked polymer according to embodiment 32, wherein the nicked polymer comprises at least one stereodefined internucleoside linkage (Sp,S) or (Rp,R) between two DNA nucleosides (such as between two DNA nucleosides in the nicked region).

[0489] 34. The nicked polymer oligonucleotide according to embodiment 32 or 33, wherein the nicked region comprises 2, 3, 4, 5, 6, 7, or 8 stereodefined phosphorothioate internucleoside linkages independently selected from Rp and Sp internucleoside linkages.

[0490] 35. The nicked polymer oligonucleotide according to any one of embodiments 32-33, wherein region G further comprises at least 2, 3, or 4 internucleoside linkages of formula IB.

[0491] 34. The nicked polymer oligonucleotide according to embodiments 32–35, wherein (i) all remaining internucleoside linkages within region G (i.e., between the nucleosides in region G) are stereodefined phosphorothioate internucleoside linkages independently selected from Rp and Sp internucleoside linkages, or (ii) all internucleoside linkages within region G are stereodefined phosphorothioate internucleoside linkages independently selected from Rp and Sp internucleoside linkages.

[0492] 35. The nicked polymer oligonucleotide according to any one of embodiments 1–34, wherein all internucleoside linkages within the flanking regions are dithiophosphorothioate internucleoside linkages of formula (IA) or (IB), wherein optionally, the internucleoside linkage between the 3'-terminal nucleoside of region F and the 5'-terminal nucleoside of region G is also a dithiophosphorothioate internucleoside linkage of formula (IA) or (IB), and the internucleoside linkage between the 3'-terminal nucleoside of region G and the 5'-terminal nucleoside of region F' is a stereodefined phosphorothioate internucleoside linkage.

[0493] 36. A nicked polymer oligonucleotide according to any one of embodiments 6 to 35, wherein the internucleoside linkages between the nucleosides in region G are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0494] 37. A nicked polymer oligonucleotide according to any one of embodiments 7 to 36, wherein the internucleoside linkages between the nucleosides in region G contain 0, 1, 2 or 3 dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1, in particular 0 dithiophosphonate internucleoside linkages of formula (I).

[0495] 38. A nicked polymer oligonucleotide according to any one of embodiments 1 to 37, wherein the remaining internucleoside linkages are independently selected from phosphorothioate internucleoside linkages, phosphodiester internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0496] 39. A nicked polymer oligonucleotide according to any one of embodiments 7 to 38, wherein the internucleoside linkages between the nucleosides in region F and the internucleoside linkages between the nucleosides in region F' are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0497] 40. A nicked polymer oligonucleotide according to any one of embodiments 7 to 39, wherein each of the flanking regions F and F' independently contains 1, 2, 3, 4, 5, 6 or 7 dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0498] 41. A nicked polymer oligonucleotide according to any one of embodiments 7 to 40, wherein all of the internucleoside linkages in the flanking region F and / or F' are dithiophosphonate internucleoside linkages of formula (I) as defined in embodiment 1.

[0499] 42. A nicked polymer oligonucleotide according to any one of embodiments 1 to 41, wherein the nicked polymer oligonucleotide contains at least one stereodefined internucleoside linkage, such as at least one stereodefined phosphorothioate internucleoside linkage.

[0500] 43. A nicked polymer oligonucleotide according to any one of embodiments 1 to 42, wherein the nicked region contains 1, 2, 3, 4 or 5 stereodefined phosphorothioate internucleoside linkages.

[0501] 44. A nicked polymer oligonucleotide according to any one of embodiments 1 to 43, wherein all of the internucleoside linkages between the nucleosides in the nicked region are stereodefined phosphorothioate internucleoside linkages.

[0502] 45. A nicked polymer oligonucleotide according to any one of embodiments 7 to 44, wherein at least one phosphorodithioate internucleoside linkage of formula (IA) or (IB) is located between the nucleosides of region F, or between the nucleosides of region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages within region F and within region F', between region F and region G, and between region G and region F' are independently selected from stereodefined phosphorothioate internucleoside linkages, stereorandom internucleoside linkages, phosphorodithioate internucleoside linkages of formula (IA) or (IB), and phosphodiester internucleoside linkages.

[0503] 46. The oligonucleotide nicked polymer according to embodiment 45, wherein the remaining internucleoside linkages within region F, within region F', or within both region F and region F' are all phosphorodithioate internucleoside linkages of formula (IA) or (IB).

[0504] 47. A nicked polymer oligonucleotide according to any one of embodiments 6 to 33, wherein the internucleoside linkage between the nucleosides of region G comprises 0, 1, 2, or 3 phosphorodithioate internucleoside linkages of formula (I) as defined in embodiment 1 and the remaining internucleoside linkages within region G are independently selected from stereodefined phosphorothioate internucleoside linkages, stereorandom internucleoside linkages, and phosphodiester internucleoside linkages.

[0505] 48. The nicked polymer oligonucleotide according to any one of embodiments 1 - 47, wherein the 3'-terminal nucleoside of the antisense oligonucleotide is an LNA nucleoside or a 2'-O-MOE nucleoside.

[0506] 49. The nicked polymer oligonucleotide according to any one of embodiments 1 - 48, wherein the 5'-terminal nucleoside of the antisense oligonucleotide is an LNA nucleoside or a 2'-O-MOE nucleoside.

[0507] 50. The nicked polymer oligonucleotide according to any one of embodiments 1–49, wherein the two 3'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0508] 51. The nicked polymer oligonucleotide according to any one of embodiments 1 - 50, wherein the two 5'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0509] 52. The nicked polymer oligonucleotide according to any one of embodiments 1 - 51, wherein the three 3'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0510] 53. A nicked polymer oligonucleotide according to any one of embodiments 1-52, wherein the three 5'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0511] 54. A nicked polymer oligonucleotide according to any one of embodiments 1–53, wherein the two 3'-most terminal nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0512] 55. A nicked polymer oligonucleotide according to any one of embodiments 1–54, wherein the two 5'-most terminal nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0513] 56. A nicked polymer oligonucleotide according to any one of embodiments 1–55, wherein the nucleoside (A 2 ) of formula (IA) or (IB) is the 3'-terminal nucleoside of the oligonucleotide.

[0514] 57. A nicked polymer oligonucleotide according to any one of embodiments 1–56, wherein the nucleoside (A 1 ) of formula (IA) or (IB) is the 5'-terminal nucleoside of the oligonucleotide.

[0515] 58. A nicked polymer oligonucleotide according to any one of embodiments 7–57, wherein the nicked polymer oligonucleotide comprises a continuous nucleotide sequence of formula 5'-D'-F-G-F'-D''-3', wherein F, G and F' are as defined in any one of embodiments 7 to 45 and wherein the regions D' and D'' each independently consist of from 0 to 5 nucleotides, in particular 2, 3 or 4 nucleotides, in particular DNA nucleotides (such as phosphodiester-linked DNA nucleosides) [oligonucleotide comprising the nicked polymer oligonucleotide and flanking sequences].

[0516] 59. A nicked polymer oligonucleotide according to any one of embodiments 1 to 58, wherein the nicked polymer oligonucleotide is capable of recruiting human RNase H1.

[0517] 60. A nicked polymer oligonucleotide according to any one of embodiments 1 to 59, wherein the nicked polymer oligonucleotide is for in vitro or in vivo inhibition of mammalian (such as human) mRNA or pre-mRNA targets, or viral targets or non-coding long RNAs.

[0518] 61. A pharmaceutically acceptable salt of a nicked polymer oligonucleotide according to any one of embodiments 1 to 60, in particular a sodium or potassium salt.

[0519] 62. A conjugate comprising a nicked polymer oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 61 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0520] 63. A pharmaceutical composition comprising a nicked polymer oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 62 and a therapeutically inert carrier.

[0521] 64. A nicked polymer oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 63 for use as a therapeutic active substance.

[0522] Antisense oligonucleotide embodiments

[0523] The present invention relates to an oligonucleotide comprising at least one phosphorothioate internucleoside linkage of (IA) or (IB)

[0524]

[0525] wherein one of two oxygen atoms is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation.

[0526] In other words, M is a metal, such as an alkali metal, such as Na or K; or M is NH4.

[0527] The oligonucleotide can be, for example, a single-stranded antisense oligonucleotide capable of regulating the expression of a target nucleic acid, such as a target microRNA, or capable of regulating the splicing process of a target pre-mRNA comprising a continuous nucleotide sequence. The antisense oligonucleotide of the present invention comprises a continuous nucleotide sequence complementary to the target nucleic acid and capable of hybridizing with the target nucleic acid and regulating its expression. In a preferred embodiment, the antisense oligonucleotide or its continuous nucleotide sequence is a mixed polymer oligonucleotide, wherein (A 1 ) or (A 2 ) is a DNA nucleoside, or both (A 1 ) and (A 2 ) are DNA nucleosides.

[0528] In the context of the present invention, an antisense oligonucleotide is a single-stranded oligonucleotide that is complementary to a nucleic acid target, such as a target RNA, and is capable of acting in a regulatory capacity (e.g., splicing regulation of a pre-mRNA target) or inhibiting the expression of a nucleic acid target (e.g., an mRNA target, a pre-mRNA target, a viral RNA target, or a long non-coding RNA target). Depending on the target, the length of the oligonucleotide or the length of the region thereof that is complementary to the target (i.e., the antisense – preferably, the complementary region is fully complementary to the target) can be 7–30 nucleotides (a region referred to as a contiguous nucleotide sequence). For example, an LNA nucleotide inhibitor of a microRNA can be as short as 7 contiguous complementary nucleotides (and can be up to 30 nucleotides), oligonucleotides that recruit RNase H generally have a length of at least 12 contiguous complementary nucleotides, such as a length of 12–26 nucleotides. Splicing-regulatory antisense oligonucleotides generally have a contiguous nucleotide region of 10–30 complementary nucleotides.

[0529] Splicing regulatory oligonucleotides, also known as splicing-switching oligonucleotides (SSOs), are short, synthetic, antisense, modified nucleic acids that base pair with pre-mRNA and disrupt normal transcript splice repertoires by blocking RNA–RNA base pairing or protein–RNA binding interactions that occur between components of the splicing apparatus and pre-mRNA. Splicing of pre-mRNA is required for proper expression of the vast majority of protein-coding genes, and thus, targeting this process provides a means to manipulate protein production from genes. Splicing regulation is particularly valuable in disease situations where mutations that disrupt normal splicing processes occur or when interfering with the normal splicing process of a gene transcript may be therapeutic. SSOs provide an effective and specific way to target and alter the splicing process in a therapeutic manner. See Haven’s and Hasting NAR (2016) 44, 6549-6563. SSOs can be complementary to exon / intron junctions in the target pre-mRNA or can target splicing enhancer or silencer elements (collectively referred to as cis-acting splicing elements) within the pre-mRNA that regulate the pre-mRNA splicing process. Splicing regulation can result in exon skipping or exon inclusion and thus regulate the alternative splicing process of pre-mRNA. SSOs function through non-nuclease-mediated regulation of the target pre-mRNA and thus are unable to recruit RNases. They are often fully modified oligonucleotides, i.e., each nucleoside contains a modified sugar moiety, such as a 2'-sugar substituted sugar moiety (e.g., based on a phosphorothioate backbone, e.g., a fully 2'-O-MOE oligonucleotide of 15–25 nucleotide length, often 18–22 or 20 nucleotide length), or an LNA copolymer oligonucleotide (an oligonucleotide of 10–30 nucleotide length that contains DNA nucleosides and LNA nucleosides, and optionally other 2'-sugar modified nucleosides such as 2'-O-MOE). LNA oligonucleotides that do not contain DNA nucleosides but contain LNA and other 2'-sugar modified nucleosides (such as 2'-O-MOE nucleosides) are also contemplated. Table 1 of Haven’s and Hasting NAR (2016) 44, 6549-6563, which is hereby incorporated by reference, shows a series of SSO targets and the chemistries of the oligonucleotides used with reported in vivo activity and is reproduced in Table A below:

[0530] Table A

[0531]

[0532]

[0533]

[0534] In some embodiments of the invention, the antisense oligonucleotide is a splicing regulatory oligonucleotide complementary to a pre-mRNA selected from: HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2, and ATXN3. Exemplary diseases that can be treated with the SSOs of the invention are provided on a target-by-target basis in Table A.

[0535] The following embodiments generally relate to single-stranded antisense oligonucleotides of the invention, and particularly to splicing regulatory antisense oligonucleotides (SSOs):

[0536] 1. A single-stranded antisense oligonucleotide for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a continuous nucleotide sequence 10–30 nucleotides in length, wherein the continuous nucleotide sequence comprises one or more 2'-sugar modified nucleosides, and wherein at least one of the internucleoside linkages present between the nucleosides of the continuous nucleotide sequence is a phosphorodithioate linkage of formula IA or IB

[0537]

[0538] wherein one of the two oxygen atoms is attached to the 3'-carbon atom of the adjacent nucleoside (A 1 ) and the other oxygen atom is attached to the 5'-carbon atom of the other adjacent nucleoside (A 2 ), and wherein R is hydrogen or a phosphate protecting group.

[0539] 2. The antisense oligonucleotide according to embodiment 1, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside.

[0540] 3. The antisense oligonucleotide according to embodiment 1, wherein both of the two nucleosides (A 1 ) and (A 2 ) are 2'-sugar modified nucleosides.

[0541] 4. The antisense oligonucleotide according to any one of embodiments 1-3, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) or both of the two nucleosides (A 1 ) and (A 2 ) are DNA nucleosides.

[0542] 5. An antisense oligonucleotide according to any one of embodiments 1-4, wherein at least one of two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside or a nucleoside independently selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0543] 6. An antisense oligonucleotide according to any one of embodiments 1-5, wherein at least one of (A 1 ) and (A 2 ) is an LNA nucleoside.

[0544] 7. An antisense oligonucleotide according to any one of embodiments 1-5, wherein both (A 1 ) and (A 2 ) are LNA nucleosides.

[0545] 8. An antisense oligonucleotide according to any one of embodiments 1-6, wherein at least one of (A 1 ) and (A 2 ) is a 2'-O-methoxyethyl nucleoside.

[0546] 9. An antisense oligonucleotide according to any one of embodiments 1-5, wherein both (A 1 ) and (A 2 ) are 2'-O-methoxyethyl nucleosides.

[0547] 10. An antisense oligonucleotide according to any one of embodiments 1–8, wherein the LNA nucleosides are selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, and ENA.

[0548] 11. An antisense oligonucleotide according to any one of embodiments 1–8, wherein the LNA nucleoside is β-D-oxy-LNA.

[0549] 12. An antisense oligonucleotide according to any one of embodiments 1–11, wherein the continuous nucleotide sequence comprises one or more other 2'-sugar modified nucleosides, such as one or more other 2'-sugar modified nucleosides selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0550] 13. An antisense oligonucleotide according to any one of embodiments 1-12, wherein the continuous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0551] 14. An antisense oligonucleotide according to any one of embodiments 1-12, wherein the continuous nucleotide sequence comprises LNA nucleosides and 2'-O-methoxyethyl nucleosides.

[0552] 15. An antisense oligonucleotide according to any one of embodiments 1-13, wherein the continuous nucleotide sequence comprises LNA nucleosides and 2'-fluoro RNA nucleosides.

[0553] 16. An antisense oligonucleotide according to any one of embodiments 1-13, wherein the continuous nucleotide sequence comprises any one of the following

[0554] (i) only LNA and DNA nucleosides

[0555] (ii) only LNA and 2'-O-methoxyethyl nucleosides

[0556] (iii) only LNA, DNA and 2'-O-methoxyethyl nucleosides

[0557] (iv) only LNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides

[0558] (v) only LNA, DNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides or only LNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides

[0559] (vi) only 2'-O-methoxyethyl nucleosides.

[0560] 17. An antisense oligonucleotide according to any one of embodiments 1-16, wherein the continuous nucleotide sequence does not comprise a sequence of 4 or more consecutive DNA nucleosides, or does not comprise a sequence of three or more consecutive DNA nucleosides.

[0561] 18. An antisense oligonucleotide according to any one of embodiments 1–17, wherein the antisense oligonucleotide or its continuous nucleotide sequence is a mixed polymer oligonucleotide or a homopolymer oligonucleotide.

[0562] 19. An antisense oligonucleotide according to any one of embodiments 1-18, wherein the antisense oligonucleotide is not capable of recruiting human RNase H1.

[0563] 20. An antisense oligonucleotide according to any one of embodiments 1–19, wherein the nucleoside (A 2 ) is the 3'-terminal nucleoside of the continuous nucleotide sequence or the oligonucleotide.

[0564] 21. An antisense oligonucleotide according to any one of embodiments 1–20, wherein the nucleoside (A 1 ) is the 5'-terminal nucleoside of the continuous nucleotide sequence or the oligonucleotide.

[0565] 22. An antisense oligonucleotide according to any one of embodiments 1–21, which comprises at least two phosphorodithioate internucleoside linkages of formula I, such as 2, 3, 4, 5 or 6 phosphorodithioate internucleoside linkages of formula I.

[0566] 23. An antisense oligonucleotide according to any one of embodiments 1–22, wherein the internucleoside linkage between the 2 3'-terminal nucleosides of the continuous nucleotide sequence is a phosphorodithioate internucleoside linkage of formula I, and wherein the internucleoside linkage between the 2 5'-terminal nucleosides of the continuous nucleotide sequence is a phosphorodithioate internucleoside linkage of formula I.

[0567] 24. An antisense oligonucleotide according to any one of embodiments 1-23, which further comprises a phosphorothioate internucleoside linkage.

[0568] 25. An antisense oligonucleotide according to any one of embodiments 1-24, which further comprises a stereodefined phosphorothioate internucleoside linkage.

[0569] 26. An antisense oligonucleotide according to any one of embodiments 1-25, wherein the remaining internucleoside linkages are independently selected from phosphorodithioate internucleoside linkages, phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0570] 27. An antisense oligonucleotide according to any one of embodiments 1-26, wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0571] 28. An antisense oligonucleotide according to any one of embodiments 1-27, wherein the continuous nucleotide sequence is complementary to, such as 100% complementary to, a mammalian pre-mRNA, a mammalian mature mRNA target, a viral RNA target or a mammalian non-coding long RNA.

[0572] 29. An antisense oligonucleotide according to any one of embodiments 28, wherein the RNA target is a human RNA target.

[0573] 30. An antisense oligonucleotide according to any one of embodiments 1–29, wherein the antisense oligonucleotide modulates the splicing of a mammalian (such as human) pre-mRNA target, for example is a splicing skipping or splicing regulatory antisense oligonucleotide.

[0574] 31. An antisense oligonucleotide according to any one of embodiments 1–30, wherein the antisense oligonucleotide is complementary to, such as 100% complementary to, an intron / exon splicing site of a human pre-mRNA or a human pre-mRNA splicing regulatory region.

[0575] 32. An antisense oligonucleotide according to any one of embodiments 1–30, wherein the antisense oligonucleotide or its consecutive nucleotide sequence is complementary to, such as fully complementary to, a human pre-mRNA sequence selected from the following: TNFR2, HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2, and ATXN3.

[0576] 33. An antisense oligonucleotide according to any one of embodiments 1–32, wherein the antisense oligonucleotide consists of or comprises a consecutive nucleotide sequence selected from SSO#1–SSO#25.

[0577] 34. An antisense oligonucleotide according to any one of embodiments 1–33, wherein the cell is a human cell.

[0578] 35. An antisense oligonucleotide according to any one of embodiments 1–34, wherein the length of the antisense oligonucleotide is 10–30 nucleotide lengths.

[0579] 36. An antisense oligonucleotide according to any one of embodiments 1–34, wherein the length of the antisense oligonucleotide is 12–24 nucleotide lengths.

[0580] 37. An antisense oligonucleotide according to any one of embodiments 1–36, wherein the 3’-terminal nucleoside of the antisense oligonucleotide or its consecutive nucleotide sequence is an LNA nucleoside or a 2-O-methoxyethyl nucleoside.

[0581] 38. An antisense oligonucleotide according to any one of embodiments 1–27, wherein the 5’-terminal nucleoside of the antisense oligonucleotide or its consecutive nucleotide sequence is an LNA nucleoside or a 2-O-methoxyethyl nucleoside.

[0582] 39. An antisense oligonucleotide according to any one of embodiments 1–38, wherein both the 5’-terminal nucleoside and the 3’-terminal nucleoside of the antisense oligonucleotide or its consecutive nucleotide sequence are LNA nucleosides.

[0583] 40. An antisense oligonucleotide according to any one of embodiments 1–39, wherein the consecutive nucleotide sequence comprises at least one region having two or three consecutive LNA nucleotides and / or at least one region having two or three consecutive 2’-O-methoxyethyl nucleotides.

[0584] 41. A pharmaceutically acceptable salt of the oligonucleotide according to any one of embodiments 1 to 40, in particular a sodium salt, a potassium salt or an ammonium salt.

[0585] 42. A conjugate comprising the oligonucleotide or pharmaceutically acceptable salt according to any one of embodiments 1 to 41 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0586] 43. A pharmaceutical composition comprising the oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 42 and a therapeutically inert carrier.

[0587] 44. The oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 43, for use as a therapeutic active substance.

[0588] 45. A method for modulating the RNA in a cell expressing a target RNA, the method comprising the step of administering to the cell an effective amount of the oligonucleotide, pharmaceutically acceptable salt, conjugate or composition according to any one of embodiments 1–44.

[0589] 46. A method for modulating the splicing of a target pre-RNA in a cell expressing the target pre-RNA, the method comprising the step of administering to the cell an effective amount of the oligonucleotide, pharmaceutically acceptable salt, conjugate or composition according to any one of embodiments 1–44.

[0590] 47. The method according to embodiment 45 or 46, wherein the method is an in vitro method or an in vivo method.

[0591] 48. Use of the oligonucleotide, pharmaceutical salt, conjugate or composition according to any one of embodiments 1–44 for inhibiting RNA in a cell (such as a human cell), wherein the use is in vitro or in vivo.

[0592] Certain hetero-polymer embodiments

[0593] 1. A single-stranded antisense oligonucleotide for modulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a continuous nucleotide sequence having a length of 10–30 nucleotides, wherein the continuous nucleotide sequence comprises an alternating region of 2'-sugar-modified nucleosides, wherein the maximum length of continuous DNA nucleosides having the continuous nucleotide sequence is 3 or 4, and wherein at least one of the internucleoside linkages present between the nucleosides of the continuous nucleotide sequence is a phosphorodithioate linkage of formula IA or IB

[0594]

[0595] wherein one of the two oxygen atoms is adjacent to the nucleoside (A 1) is linked to the 3'-carbon atom and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside (A 2 ), and wherein R is hydrogen or a phosphate protecting group.

[0596] 2. The antisense oligonucleotide according to embodiment 1, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside.

[0597] 3. The antisense oligonucleotide according to embodiment 1, wherein both of the two nucleosides (A 1 ) and (A 2 ) are 2'-sugar modified nucleosides.

[0598] 4. The antisense oligonucleotide according to any one of embodiments 1-3, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) or both of the two nucleosides (A 1 ) and (A 2 ) are DNA nucleosides.

[0599] 5. The antisense oligonucleotide according to any one of embodiments 1-4, wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside or a nucleoside independently selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0600] 6. The antisense oligonucleotide according to any one of embodiments 1-5, wherein at least one of (A 1 ) and (A 2 ) is an LNA nucleoside.

[0601] 7. The antisense oligonucleotide according to any one of embodiments 1-5, wherein both of (A 1 ) and (A 2 ) are LNA nucleosides.

[0602] 8. The antisense oligonucleotide according to any one of embodiments 1-6, wherein at least one of (A 1 ) and (A 2 ) is a 2'-O-methoxyethyl nucleoside.

[0603] 9. The antisense oligonucleotide according to any one of embodiments 1-5, wherein both of (A 1 ) and (A 2 ) are 2'-O-methoxyethyl nucleosides.

[0604] 10. An antisense oligonucleotide according to any one of embodiments 1–8, wherein the LNA nucleoside is selected from β-D-oxy-LNA, 6’-methyl-β-D-oxy-LNA, and ENA.

[0605] 11. An antisense oligonucleotide according to any one of embodiments 1–8, wherein the LNA nucleoside is β-D-oxy-LNA.

[0606] 12. An antisense oligonucleotide according to any one of embodiments 1–11, wherein the continuous nucleotide sequence comprises one or more other 2’-sugar modified nucleosides, such as one or more other 2’-sugar modified nucleosides selected from 2’-alkoxy-RNA, 2’-alkoxyalkoxy-RNA, 2’-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA, or LNA nucleosides.

[0607] 13. An antisense oligonucleotide according to any one of embodiments 1-12, wherein the continuous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0608] 14. An antisense oligonucleotide according to any one of embodiments 1-12, wherein the continuous nucleotide sequence comprises LNA nucleosides and 2’-O-methoxyethyl nucleosides.

[0609] 15. An antisense oligonucleotide according to any one of embodiments 1-13, wherein the continuous nucleotide sequence comprises LNA nucleosides and 2’-fluoro-RNA nucleosides.

[0610] 16. An antisense oligonucleotide according to any one of embodiments 1-13, wherein the continuous nucleotide sequence comprises any one of the following

[0611] (i) LNA and DNA nucleosides

[0612] (ii) LNA, DNA, and 2’-O-methoxyethyl nucleosides or

[0613] (iii) LNA, DNA, 2’-fluoro-RNA, and 2’-O-methoxyethyl nucleosides

[0614] 17. An antisense oligonucleotide according to any one of embodiments 1-16, wherein the continuous nucleotide sequence does not comprise a sequence of 3 or more consecutive DNA nucleosides, or does not comprise a sequence of 2 or more consecutive DNA nucleosides.

[0615] 18. An antisense oligonucleotide according to any one of embodiments 1–17, wherein the antisense oligonucleotide or its continuous nucleotide sequence is a mixed polymer oligonucleotide, such as a splicing regulatory oligonucleotide or a microRNA inhibitor oligonucleotide.

[0616] 19. An antisense oligonucleotide according to embodiment 21, wherein the copolymer consists of or comprises the following alternating region motifs

[0617] [L]m[D]n[L]m[D]n[L]m or

[0618] [L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0619] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0620] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0621] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0622] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0623] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0624] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m

[0625] wherein L represents a 2'-sugar modified nucleoside, D represents a DNA nucleoside, and wherein each m is independently selected from 1 - 6, and each n is independently selected from 1, 2, 3, and 4, as 1 - 3.

[0626] 20. An antisense oligonucleotide according to embodiment 19, wherein each L nucleoside is independently selected from LNA, 2'-O-MOE or 2'-fluoro nucleoside, or each L is independently LNA or 2'-O-MOE.

[0627] 21. An antisense oligonucleotide according to embodiment 20, wherein each L is LNA.

[0628] 22. An antisense oligonucleotide according to any one of embodiments 1 - 21, wherein the antisense oligonucleotide is not capable of recruiting human RNase H1.

[0629] 23. An antisense oligonucleotide according to any one of embodiments 1–22, wherein the nucleoside (A 2 ) is the 3'-terminal nucleoside of the continuous nucleotide sequence or the oligonucleotide.

[0630] 24. An antisense oligonucleotide according to any one of embodiments 1–23, wherein the nucleoside (A 1 ) is the 5'-terminal nucleoside of the continuous nucleotide sequence or the oligonucleotide.

[0631] 25. An antisense oligonucleotide according to any one of embodiments 1–24, which comprises at least two phosphorodithioate internucleoside linkages of formula I, such as 2, 3, 4, 5 or 6 phosphorodithioate internucleoside linkages of formula I.

[0632] 26. An antisense oligonucleotide according to any one of embodiments 1–25, wherein the continuous nucleotide sequence comprises two consecutive DNA nucleotides, and the internucleoside linkage between the two consecutive DNA nucleotides is a phosphorodithioate internucleoside linkage of formula (IA) or (IB), i.e., a P2S-linked DNA nucleotide pair.

[0633] 27. An antisense oligonucleotide according to any one of embodiments 1–26, wherein the continuous nucleotide sequence comprises more than one P2S-linked DNA nucleotide pair.

[0634] 28. An antisense oligonucleotide according to any one of embodiments 1–26, wherein all the internucleoside linkages between two consecutive DNA nucleotides present in the continuous nucleotide sequence are phosphorodithioate internucleoside linkages of formula (IA) or (IB).

[0635] 29. An antisense oligonucleotide according to any one of embodiments 1–27, wherein at least one internucleoside linkage between a 2'-sugar-modified nucleoside and a DNA nucleoside is a phosphorodithioate internucleoside linkage of formula (IA) or (IB).

[0636] 30. An antisense oligonucleotide according to any one of embodiments 1–27, wherein more than one internucleoside linkage between a 2'-sugar-modified nucleoside and a DNA nucleoside is a phosphorodithioate internucleoside linkage of formula (IA) or (IB).

[0637] 31. An antisense oligonucleotide according to any one of embodiments 1–27, wherein all the internucleoside linkages between a 2'-sugar-modified nucleoside and a DNA nucleoside are phosphorodithioate internucleoside linkages of formula (IA) or (IB).

[0638] 32. An antisense oligonucleotide according to any one of embodiments 1–27, wherein at least one of the internucleoside linkages between two 2'-sugar-modified nucleosides is not a phosphorodithioate internucleoside linkage of formula (IA) or (IB), e.g., is a phosphorothioate internucleoside linkage.

[0639] 33. An antisense oligonucleotide according to any one of embodiments 1–27, wherein all of the internucleoside linkages between two 2'-sugar-modified nucleosides are not phosphorodithioate internucleoside linkages of formula (IA) or (IB), e.g., are phosphorothioate internucleoside linkages.

[0640] 34. An antisense oligonucleotide according to any one of embodiments 1–33, wherein the internucleoside linkage between the two 3'-terminal nucleosides of a contiguous nucleotide sequence is a phosphorodithioate internucleoside linkage of formula I, and wherein the internucleoside linkage between the two 5'-terminal nucleosides of the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkage of formula I.

[0641] 35. An antisense oligonucleotide according to any one of embodiments 1-34, which further comprises a phosphorothioate internucleoside linkage.

[0642] 36. An antisense oligonucleotide according to any one of embodiments 1-35, which further comprises a stereodefined phosphorothioate internucleoside linkage.

[0643] 37. An antisense oligonucleotide according to any one of embodiments 1-35, wherein the remaining internucleoside linkages are independently selected from phosphorodithioate internucleoside linkages, phosphorothioate internucleoside linkages, and phosphodiester internucleoside linkages.

[0644] 38. An antisense oligonucleotide according to any one of embodiments 1-36, wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0645] 39. An antisense oligonucleotide according to any one of embodiments 1-37, wherein the contiguous nucleotide sequence is complementary to, e.g., 100% complementary to, mammalian (e.g., human) pre-mRNA.

[0646] 40. An antisense oligonucleotide according to any one of embodiments 1–38, wherein the antisense oligonucleotide regulates the splicing of a mammalian (e.g., human) pre-mRNA target, e.g., is a splicing-switching or splicing-regulatory antisense oligonucleotide.

[0647] 41. An antisense oligonucleotide according to any one of embodiments 1–39, wherein the antisense oligonucleotide is complementary to, e.g., 100% complementary to, an intron / exon splicing site of human pre-mRNA or a human pre-mRNA splicing regulatory region.

[0648] 42. An antisense oligonucleotide according to any one of embodiments 1–41, wherein the antisense oligonucleotide or its contiguous nucleotide sequence is complementary to, such as fully complementary to, a human pre-mRNA sequence selected from the group consisting of: TNFR2, HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2, and ATXN3.

[0649] 43. An antisense oligonucleotide according to any one of embodiments 1–42, wherein the antisense oligonucleotide consists of or comprises a contiguous nucleotide sequence selected from SSO#1–SSO#25.

[0650] 44. An antisense oligonucleotide according to any one of embodiments 1–43, wherein the cell is a mammalian cell.

[0651] 45. An antisense oligonucleotide according to any one of embodiments 1–44, wherein the antisense oligonucleotide has a length of 10–30 nucleotide lengths.

[0652] 46. An antisense oligonucleotide according to any one of embodiments 1–44, wherein the antisense oligonucleotide has a length of 12–24 nucleotide lengths.

[0653] 47. An antisense oligonucleotide according to any one of embodiments 1–46, wherein the 3'-terminal nucleoside of the antisense oligonucleotide or its contiguous nucleotide sequence is an LNA nucleoside or a 2'-O-methoxyethyl nucleoside.

[0654] 48. An antisense oligonucleotide according to any one of embodiments 1–47, wherein the 5'-terminal nucleoside of the antisense oligonucleotide or its contiguous nucleotide sequence is an LNA nucleoside or a 2'-O-methoxyethyl nucleoside.

[0655] 49. An antisense oligonucleotide according to any one of embodiments 1–48, wherein both the 5'-terminal nucleoside and the 3'-terminal nucleoside of the antisense oligonucleotide or its contiguous nucleotide sequence are LNA nucleosides.

[0656] 50. An antisense oligonucleotide according to any one of embodiments 1–49, wherein the contiguous nucleotide sequence comprises at least one region having two or three contiguous LNA nucleotides and / or at least one region having two or three contiguous 2'-O-methoxyethyl nucleotides.

[0657] 51. A pharmaceutically acceptable salt of the oligonucleotide according to any one of embodiments 1 to 50, in particular a sodium salt, a potassium salt or an ammonium salt.

[0658] 52. A conjugate comprising the oligonucleotide or pharmaceutically acceptable salt according to any one of embodiments 1 to 51 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0659] 53. A pharmaceutical composition comprising the oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 52 and a therapeutically inert carrier.

[0660] 54. The oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 53 for use as a therapeutic active substance.

[0661] 55. A method for modulating the RNA in a cell expressing a target RNA, the method comprising the step of administering to the cell an effective amount of the oligonucleotide, pharmaceutically acceptable salt, conjugate or composition according to any one of embodiments 1 - 54.

[0662] 56. A method for modulating the splicing of the pre - RNA in a cell expressing a target pre - RNA, the method comprising the step of administering to the cell an effective amount of the oligonucleotide, pharmaceutically acceptable salt, conjugate or composition according to any one of embodiments 1 - 54.

[0663] 57. The method according to embodiment 55 or 56, wherein the method is an in vitro method or an in vivo method.

[0664] 58. Use of the oligonucleotide, pharmaceutical salt, conjugate or composition according to any one of embodiments 1 - 54 for inhibiting RNA in a cell (such as a mammalian cell), wherein the use is in vitro or in vivo.

[0665] Certain embodiments related to 3'-end protection

[0666] 1. A single - stranded antisense oligonucleotide comprising at least one phosphorodithioate internucleoside linkage of formula (IA) or (IB)

[0667]

[0668] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the other adjacent nucleoside (A 2) is linked to the 5'-carbon atom, and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation, and wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside, such as an LNA nucleoside or a 2'-O-MOE nucleoside, and wherein R is hydrogen or a phosphate protecting group, wherein A 2 is the 3'-terminal nucleoside of the oligonucleotide.

[0669] 2. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside, or both (A 1 ) and (A 2 ) are LNA nucleosides.

[0670] 3. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside and (A 1 ) is a sugar-modified nucleotide.

[0671] 4. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside and (A 1 ) is a DNA nucleotide.

[0672] 5. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 1 ) is an LNA nucleoside and (A 2 ) is a sugar-modified nucleotide.

[0673] 6. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 1 ) is an LNA nucleoside and (A 2 ) is a DNA nucleotide.

[0674] 7. The single-stranded antisense oligonucleotide according to any one of embodiments 3 or 5, wherein the sugar-modified nucleoside is a 2'-sugar modified nucleoside.

[0675] 8. The single-stranded antisense oligonucleotide according to embodiment 7, wherein the 2'-sugar modified nucleoside is 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or an LNA nucleoside.

[0676] 9. The single-stranded antisense oligonucleotide according to embodiment 7 or 8, wherein the 2'-sugar modified nucleoside is a 2'-O-methoxyethyl nucleoside.

[0677] 10. A single-stranded antisense oligonucleotide according to any one of embodiments 1-9, wherein the LNA nucleoside or nucleotide is in the β-D configuration.

[0678] 11. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 10, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, and ENA.

[0679] 12. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 11, wherein the LNA is β-D-oxy-LNA.

[0680] 13. A single-stranded antisense oligonucleotide according to any one of embodiments 1–12, wherein the single-stranded antisense oligonucleotide consists of or comprises 7–30 consecutive nucleotides complementary to a target nucleic acid (such as a target nucleic acid selected from pre-mRNA, mRNA, microRNA, viral RNA, and non-coding long RNA) [referred to as the consecutive nucleotide sequence of the single-stranded antisense oligonucleotide].

[0681] 14. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the consecutive nucleotide sequence comprises a gapmer region of the formula 5'-F-G-F'-3', wherein G is a region of 5 to 18 nucleosides capable of recruiting RNase H, and the region G is flanked by flanking regions F and F' at the 5' and 3' sides respectively, wherein the regions F and F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, and the nucleoside of region F adjacent to region G is a 2'-sugar modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar modified nucleoside.

[0682] 14. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the consecutive nucleotide sequence is a mixed polymer oligonucleotide, wherein the mixed polymer oligonucleotide comprises LNA nucleosides and DNA nucleosides, and optionally 2'-sugar modified nucleosides [such as those according to embodiments 8–9], wherein the single-stranded antisense oligonucleotide does not comprise a region of 4 or more consecutive DNA nucleosides.

[0683] 15. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the consecutive nucleotide sequence comprises only sugar-modified nucleosides.

[0684] 16. The oligonucleotide according to embodiment 14 or 15, wherein the oligonucleotide is a splicing regulatory oligonucleotide [capable of regulating the splicing of pre-mRNA splicing events].

[0685] 17. The oligonucleotide according to embodiment 14 or 15, wherein the oligonucleotide is complementary to a microRNA, e.g., is a microRNA inhibitor.

[0686] 18. An oligonucleotide according to any one of embodiments 1 to 17, which comprises internucleoside linkages other than phosphodiester internucleoside linkages, phosphorothioate internucleoside linkages, and dithiophosphonate internucleoside linkages, independently selected therefrom; or wherein the internucleoside linkages other than those within the oligonucleotide or within its contiguous nucleotide sequence are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages.

[0687] 18. An oligonucleotide according to any one of embodiments 1 - 18, wherein the internucleoside linkages other than those of the oligonucleotide or its contiguous nucleotide sequence are all phosphorothioate internucleoside linkages.

[0688] 19. An oligonucleotide according to any one of embodiments 1–18, wherein the oligonucleotide comprises a 5' region that is position 5' relative to the contiguous nucleotide sequence, and wherein the 5' nucleoside region comprises at least one phosphodiester linkage.

[0689] 20. The oligonucleotide according to embodiment 19, wherein the 5' region comprises 1–5 DNA nucleosides with phosphodiester linkages, and optionally, the oligonucleotide or its contiguous nucleotide sequence can be linked to a conjugate moiety.

[0690] 21. An oligonucleotide according to any one of embodiments 1 to 20, wherein one or more nucleosides are nucleobase - modified nucleosides.

[0691] 22. An oligonucleotide according to any one of embodiments 1 to 21, wherein one or more nucleosides are 5 - methylcytosines, such as LNA 5 - methylcytosine or DNA 5 - methylcytosine.

[0692] 23. A pharmaceutically acceptable salt of an oligonucleotide according to any one of embodiments 1 to 22, especially a sodium salt, a potassium salt, or an ammonium salt.

[0693] 24. A conjugate, which comprises an oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 23 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally covalently linked via a linker moiety.

[0694] 25. A pharmaceutical composition, which comprises an oligonucleotide, a pharmaceutically acceptable salt, or a conjugate according to any one of embodiments 1 to 24 and a therapeutically inert carrier.

[0695] 26. An oligonucleotide, a pharmaceutically acceptable salt, or a conjugate according to any one of embodiments 1 to 25, which is used as a therapeutically active substance.

[0696] 27. An oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 24 for use in therapy, for administration to a subject by parenteral administration (such as intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intracerebroventricular or intrathecal administration).

[0697] Embodiments relating to oligonucleotides having achiral phosphorothioate and stereodefined phosphorothioate linkages

[0698] 1. A single-stranded antisense oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA) or (IB)

[0699]

[0700] wherein one of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is linked to the 5'-carbon atom of the other adjacent nucleoside (A2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded oligonucleotide further comprises at least one stereodefined phosphorothioate internucleoside linkage, being (Sp,S) or (Rp,R)

[0701]

[0702] wherein N 1 and N 2 are nucleosides. (Note: In some non-limiting embodiments, N 1 and / or N 2 are DNA nucleotides).

[0703] 2. The single-stranded antisense oligonucleotide according to embodiment 1, wherein A2 is the 3'-terminal nucleoside of the oligonucleotide.

[0704] 3. The single-stranded antisense oligonucleotide according to embodiment 1, wherein A1 is the 5'-terminal nucleoside of the oligonucleotide.

[0705] 4. The single-stranded antisense oligonucleotide according to any one of embodiments 1 - 3, wherein the single-stranded oligonucleotide comprises 1, 2, 3, 4, 5 or 6 internucleoside linkages of formula IB.

[0706] 5. The single-stranded antisense oligonucleotide according to any one of embodiments 1 - 4, wherein both the 5'-terminal internucleoside linkage and the 3'-terminal internucleoside linkage of the antisense oligonucleotide are internucleoside linkages of formula IB.

[0707] 6. A single-stranded antisense oligonucleotide according to any one of embodiments 1-5, wherein in at least one of the internucleoside linkages of formula IB, at least one of the two nucleosides (A1) and (A2) is a 2'-sugar modified nucleoside, such as a 2'-sugar modified nucleoside selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA, and LNA nucleosides.

[0708] 7. A single-stranded antisense oligonucleotide according to any one of embodiments 1-6, wherein in at least one of the internucleoside linkages of formula IB, at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside.

[0709] 8. A single-stranded antisense oligonucleotide according to any one of embodiments 1-6, wherein in at least one of the internucleoside linkages of formula IB, at least one of the two nucleosides (A1) and (A2) is a 2'-O-MOE nucleoside.

[0710] 9. A single-stranded antisense oligonucleotide according to any one of embodiments 1-8, wherein the 3'-terminal nucleoside of the antisense oligonucleotide is an LNA nucleoside or a 2'-O-MOE nucleoside.

[0711] 10. A single-stranded antisense oligonucleotide according to any one of embodiments 1-9, wherein the 5'-terminal nucleoside of the antisense oligonucleotide is an LNA nucleoside or a 2'-O-MOE nucleoside.

[0712] 11. A single-stranded antisense oligonucleotide according to any one of embodiments 1–10, wherein the two 3'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0713] 12. A single-stranded antisense oligonucleotide according to any one of embodiments 1–11, wherein the two 5'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0714] 13. A single-stranded antisense oligonucleotide according to any one of embodiments 1–12, wherein the three 3'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0715] 14. A single-stranded antisense oligonucleotide according to any one of embodiments 1–13, wherein the three 5'-most terminal nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0716] 15. A single-stranded antisense oligonucleotide according to any one of embodiments 1–14, wherein the two 3'-most terminal nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0717] 16. A single-stranded antisense oligonucleotide according to any one of embodiments 1–15, wherein the two 5'-most terminal nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0718] 17. A single-stranded antisense oligonucleotide according to any one of embodiments 1–16, wherein the antisense oligonucleotide further comprises a region of 2–16 DNA nucleotides, wherein the internucleoside linkage between the DNA nucleotides is a stereodefined phosphorothioate internucleoside linkage.

[0719] 18. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, and ENA.

[0720] 19. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the LNA nucleoside is β-D-oxy-LNA.

[0721] 20. A single-stranded antisense oligonucleotide according to any one of embodiments 1–19, wherein the oligonucleotide consists of or comprises 7–30 consecutive nucleotides that are complementary, such as fully complementary, to a target nucleic acid (such as a target nucleic acid selected from pre-mRNA, mRNA, microRNA, viral RNA, and non-coding long RNA) [antisense oligonucleotide].

[0722] 21. A single-stranded antisense oligonucleotide according to any one of embodiments 1–20, wherein the single-stranded oligonucleotide is capable of modulating an RNA target.

[0723] 22. A single-stranded antisense oligonucleotide according to any one of embodiments 1–20, wherein the single-stranded antisense oligonucleotide is capable of inhibiting an RNA target, such as by recruitment of RNase H1.

[0724] 23. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 22, wherein the consecutive nucleotide sequence of the oligonucleotide comprises a gapmer region of the formula 5'-F-G-F'-3', wherein G is a region of 5 to 18 nucleosides capable of recruiting RNase H1, and the region G is flanked on the 5' and 3' sides by flanking regions F and F', respectively, wherein the regions F and F' independently comprise or consist of 1 to 7 2'-sugar-modified nucleotides, and the nucleoside of region F adjacent to region G is a 2'-sugar-modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar-modified nucleoside.

[0725] 24. The single-stranded antisense oligonucleotide according to embodiment 23, wherein region F or region F' comprises an internucleoside linkage of formula IB according to any one of embodiments 1-19.

[0726] 25. The single-stranded antisense oligonucleotide according to embodiment 24, wherein both region F and region F' comprise an internucleoside linkage of formula IB according to any one of embodiments 1-19.

[0727] 26. The single-stranded antisense oligonucleotide according to embodiments 23-25, wherein all of the internucleoside linkages within region F and / or region F' are internucleoside linkages of formula IB according to any one of embodiments 1-19.

[0728] 27. The single-stranded antisense oligonucleotide according to embodiments 23–26, wherein both region F and region F' comprise or consist of LNA nucleosides.

[0729] 28. The single-stranded antisense oligonucleotide according to embodiments 23–27, wherein both region F and region F' comprise or consist of MOE nucleosides.

[0730] 29. The single-stranded antisense oligonucleotide according to embodiments 23–28, wherein region F comprises LNA nucleosides and F' comprises or consists of MOE nucleosides.

[0731] 30. The single-stranded antisense oligonucleotide according to embodiments 23–29, wherein region G further comprises at least one internucleoside linkage of formula IB between the 3'-terminal nucleoside of region F and the 5'-terminal nucleoside of region G.

[0732] 31. The single-stranded antisense oligonucleotide according to embodiments 23–30, wherein region G comprises at least one stereodefined phosphorothioate linkage between two DNA nucleosides.

[0733] 32. The single-stranded antisense oligonucleotide according to embodiments 23–31, wherein region G comprises at least one internucleoside linkage of formula IB between two DNA nucleosides.

[0734] 33. The single-stranded antisense oligonucleotide according to embodiments 23–32, wherein region G further comprises at least 2, 3, or 4 internucleoside linkages of formula IB.

[0735] 34. The single-stranded antisense oligonucleotide according to embodiments 23–31, wherein all of the remaining internucleoside linkages within region G are stereodefined phosphorothioate internucleoside linkages independently selected from Rp and Sp internucleoside linkages.

[0736] 35. A single-stranded antisense oligonucleotide according to embodiments 23–31, wherein all internucleoside linkages within region G are stereodefined phosphorothioate internucleoside linkages, which are independently selected from Rp and Sp internucleoside linkages, optionally except for the internucleoside linkage between the 3'-terminal nucleoside of region F and the 5'-terminal nucleoside of region G.

[0737] 36. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 22, wherein the antisense oligonucleotide comprises fewer than 4 consecutive DNA nucleotides.

[0738] 37. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 22 or 36, wherein the antisense oligonucleotide is a mixed polymer or a homopolymer oligonucleotide.

[0739] 38. A single-stranded oligonucleotide according to embodiment 37, wherein the mixed polymer oligonucleotide comprises LNA nucleosides and DNA nucleosides, and optionally 2'-sugar modified nucleosides (e.g., see the list in embodiment 6), such as 2'-O-MOE nucleosides.

[0740] 39. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 38, wherein the antisense oligonucleotide comprises a region of 3 or more consecutive MOE nucleosides, and optionally wherein all nucleosides of the oligonucleotide are 2'-MOE nucleosides.

[0741] 40. A single-stranded antisense oligonucleotide according to any one of embodiments 1–39, wherein the target is an mRNA or a pre-mRNA target.

[0742] 41. A single-stranded antisense oligonucleotide according to any one of embodiments 1–40, wherein the oligonucleotide targets a pre-mRNA splice site or a pre-mRNA region that regulates splicing events at the pre-mRNA splice site.

[0743] 42. A single-stranded antisense oligonucleotide according to any one of embodiments 1–41, which is a splicing regulatory oligonucleotide capable of regulating the splicing of a pre-mRNA target.

[0744] 43. A single-stranded antisense oligonucleotide according to any one of embodiments 1–42, wherein the target is a microRNA.

[0745] 44. A single-stranded antisense oligonucleotide according to any one of embodiments 1–42, wherein the antisense oligonucleotide has a length of 10–20 nucleotides, such as 12–24 nucleotides.

[0746] 45. A single-stranded antisense oligonucleotide according to embodiment 43, wherein the length of the antisense oligonucleotide is 7–30, such as 8–12 or 12 to 23 nucleotides.

[0747] 46. A single-stranded antisense oligonucleotide comprising an antisense oligonucleotide according to any one of embodiments 1–45, wherein the oligonucleotide further has a 5′ region that is 5′ relative to a contiguous nucleotide sequence, and wherein the 5′ nucleoside region comprises at least one phosphodiester linkage.

[0748] 47. The single-stranded antisense oligonucleotide according to embodiment 46, wherein the 5′ region comprises 1–5 DNA nucleosides with phosphodiester linkages, and optionally the oligonucleotide or its contiguous nucleotide sequence can be linked to a conjugate moiety.

[0749] 48. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 47, wherein one or more nucleosides are nucleobase-modified nucleosides.

[0750] 49. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 48, wherein one or more nucleosides are 5-methylcytosines, such as LNA 5-methylcytosine or DNA 5-methylcytosine.

[0751] 50. A pharmaceutically acceptable salt of the single-stranded antisense oligonucleotide according to any one of embodiments 1 to 49, especially a sodium salt, potassium salt or ammonium salt.

[0752] 51. A conjugate comprising a single-stranded antisense oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 49 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0753] 52. A pharmaceutical composition comprising a single-stranded antisense oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 51 and a therapeutically inert carrier.

[0754] 53. The single-stranded antisense oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 52, which is used as a therapeutic active substance.

[0755] 54. The single-stranded antisense oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of embodiments 1 to 53, which is for treatment and is administered to a subject by parenteral administration (such as intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intraventricular or intrathecal administration).

[0756] 55. The in vitro use of the single-stranded antisense oligonucleotide, salt or composition according to any of the foregoing embodiments for inhibiting a target RNA in a cell, wherein the single-stranded antisense oligonucleotide is complementary to, such as fully complementary to, the target RNA.

[0757] 56. A method, in vivo or in vitro, for inhibiting a target RNA in a cell that is positively expressing the target RNA, the method comprising: administering to the cell an effective amount of an antisense oligonucleotide, salt, conjugate, or composition according to any one of the preceding embodiments, thereby aiming to inhibit the target RNA.

[0758] 57. Use, in vitro or in vivo, of a single-stranded antisense oligonucleotide, salt, or composition according to any one of the preceding embodiments for modulating the splicing of a target pre-mRNA in a cell.

[0759] 58. A method, in vivo or in vitro, for modulating the splicing of a target pre-RNA in a cell that is positively expressing the target pre-RNA, the method comprising: administering to the cell an effective amount of an antisense oligonucleotide, salt, conjugate, or composition according to any one of the preceding embodiments, thereby aiming to modulate the splicing of the target RNA.

[0760] The antisense oligonucleotide of the present invention that targets Htra-1

[0761] In some embodiments, the antisense oligonucleotides of the present invention are complementary, for example, to the mRNA or pre-mRNA encoding human high temperature requirement A1 Serine protease (Htra1) – see, for example, WO 2018 / 002105. Inhibiting Htra1 expression using the antisense oligonucleotides of the present invention that target Htra1 mRNA or pre-mRNA is beneficial for treating a range of medical conditions such as macular degeneration, for example age-related macular degeneration (geographic atrophy). The human Htra1 pre-mRNA and mRNA target sequences are available as follows:

[0762]

[0763] Listed as Htra1#1–38 in the examples are compounds of the present invention that target Htra-1.

[0764] 1. An antisense oligonucleotide of the present invention having a length of 10–30 nucleotides, wherein the antisense oligonucleotide targets human HTRA1 mRNA or pre-mRNA, wherein the antisense oligonucleotide comprises a contiguous nucleotide region of 10–22 nucleotides that is at least 90% and as high as 100% complementary to SEQ ID NO 1 or 2 of WO 2018 / 002105, which are disclosed as SEQ ID NO 9 and 10 in the sequence listing, and wherein the antisense oligonucleotide comprises at least one phosphorothioate internucleoside linkage of formula IA or formula IB.

[0765] 2. The antisense oligonucleotide according to embodiment 1 or 2, wherein the contiguous nucleotide region is identical to the sequence present in the sequences selected from the following SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, and 18:

[0766] SEQ ID NO 11: CAAATATTTACCTGGTTG

[0767] SEQ ID NO 12: TTTACCTGGTTGTTGG

[0768] SEQ ID NO 13: CCAAATATTTACCTGGTT

[0769] SEQ ID NO 14: CCAAATATTTACCTGGTTGT

[0770] SEQ ID NO 15: ATATTTACCTGGTTGTTG

[0771] SEQ ID NO 16: TATTTACCTGGTTGTT

[0772] SEQ ID NO 17: ATATTTACCTGGTTGT

[0773] SEQ ID NO 18: ATATTTACCTGGTTGTT

[0774] 3. The antisense oligonucleotide according to any one of embodiments 1 - 3, wherein the contiguous nucleotide region comprises the sequence SEQ ID NO 146:

[0775] SEQ ID NO 19: TTTACCTGGTT

[0776] 4. The antisense oligonucleotide according to any one of embodiments 1–4, wherein the contiguous nucleotide region of the oligonucleotide consists of or comprises a sequence selected from any one of SEQ ID NOs: 11, 12, 13, 14, 15, 16, 17, and 18.

[0777] 5. The antisense oligonucleotide according to any one of embodiments 1–5, wherein the contiguous nucleotide region of the oligonucleotide comprises one or more 2'-sugar modified nucleosides, such as one or more 2'-sugar modified nucleosides independently selected from 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.

[0778] 6. An antisense oligonucleotide according to any one of embodiments 1-5, wherein the contiguous nucleotide region of the oligonucleotide comprises at least one modified internucleoside linkage, such as one or more phosphorothioate internucleoside linkages, or such that all internucleoside linkages within the contiguous nucleotide region are phosphorothioate internucleoside linkages.

[0779] 7. An antisense oligonucleotide according to any one of embodiments 1-6, wherein the oligonucleotide or its contiguous nucleotide sequence is or comprises a gapmer, such as a gapmer of formula 5'-F-G-F'-3', wherein regions F and F' independently comprise 1-7 sugar-modified nucleosides and G is a region of 6-16 nucleosides capable of recruiting RNase H, wherein the nucleosides of regions F and F' adjacent to region G are sugar-modified nucleosides.

[0780] 8. An antisense oligonucleotide according to embodiment 7, wherein at least one or both of regions F and F' each comprise at least one LNA nucleoside.

[0781] 9. An antisense oligonucleotide according to any one of embodiments 1–8, selected from: Htra1#1–38, wherein uppercase letters represent β-D-oxy-LNA nucleoside units, lowercase letters represent DNA nucleoside units, subscript s represents a phosphorothioate internucleoside linkage, wherein all LNA cytosines are 5-methylcytosines, P represents a dithiophosphonate internucleoside linkage of formula IB, S represents a Sp-defined stereogenic phosphorothioate internucleoside linkage, R represents an Rp-defined stereogenic phosphorothioate internucleoside linkage, and X represents a stereorandom phosphorothioate linkage.

[0782] 10. An antisense oligonucleotide according to any of the foregoing embodiments, which is in salt form, such as a sodium salt, potassium salt or ammonium salt (e.g., a pharmaceutically acceptable salt).

[0783] 11. A conjugate comprising an oligonucleotide according to any one of embodiments 1–10 and at least one conjugate moiety covalently linked to the oligonucleotide, or a salt thereof.

[0784] 12. A pharmaceutical composition comprising an oligonucleotide of embodiments 1-10 or a conjugate of embodiment 11 and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0785] 13. An in vivo or in vitro method of modulating HTRA1 expression in a target cell that positively expresses HTRA1, the method comprising administering to the cell, in an effective amount, an oligonucleotide according to any one of embodiments 1–10 or a conjugate according to embodiment 11 or a pharmaceutical composition according to embodiment 12.

[0786] 14. A method for treating or preventing a disease, which comprises administering to a subject suffering from or susceptible to a disease a therapeutically effective amount or a prophylactically effective amount of an oligonucleotide of any one of embodiments 1–10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12.

[0787] 15. An oligonucleotide of any one of embodiments 1–10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12, for use in a medicament.

[0788] 16. An oligonucleotide of any one of embodiments 1–10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12, for use in the treatment or prevention of a disease selected from macular degeneration (such as wet AMD, dry AMD, geographic atrophy, intermediate dAMD, diabetic retinopathy), Parkinson's disease, Alzheimer's disease, Duchenne muscular dystrophy, arthritis (such as osteoarthritis), and familial ischemic cerebral small vessel disease.

[0789] 17. Use of an oligonucleotide of embodiments 1–10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12, for the preparation of a medicament for the treatment or prevention of a disease selected from macular degeneration (such as wet AMD, dry AMD, geographic atrophy, intermediate dAMD, diabetic retinopathy), Parkinson's disease, Alzheimer's disease, Duchenne muscular dystrophy, arthritis (such as osteoarthritis), and familial ischemic cerebral small vessel disease.

[0790] 18. An oligonucleotide, conjugate, salt or composition or use according to any of the preceding embodiments, for use in the treatment of geographic atrophy.

[0791] Other embodiments of the present invention

[0792] The present invention thus particularly relates to:

[0793] An oligonucleotide of the present invention, wherein the oligonucleotide is an antisense oligonucleotide capable of regulating the expression of a target RNA in a cell expressing the target RNA;

[0794] An oligonucleotide of the present invention, wherein the oligonucleotide is an antisense oligonucleotide capable of inhibiting the expression of a target RNA in a cell expressing the target RNA;

[0795] An oligonucleotide of the present invention, wherein one of (A 1 ) and (A 2 ) is an LNA nucleoside and the other is a DNA nucleoside, an RNA nucleoside or a sugar-modified nucleoside;

[0796] An oligonucleotide of the present invention, wherein one of (A 1 ) and (A 2)One of them is an LNA nucleoside and the other is a DNA nucleoside or a sugar-modified nucleoside;

[0797] The oligonucleotide of the present invention, wherein (A 1 ) and (A 2 )One of them is an LNA nucleoside and the other is a DNA nucleoside;

[0798] The oligonucleotide of the present invention, wherein (A 1 ) and (A 2 )One of them is an LNA nucleoside and the other is a sugar-modified nucleoside;

[0799] The oligonucleotide of the present invention, wherein the sugar-modified nucleoside is a 2'-sugar-modified nucleoside;

[0800] The oligonucleotide of the present invention, wherein the 2'-sugar-modified nucleoside is 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or an LNA nucleoside;

[0801] The oligonucleotide of the present invention, wherein the 2'-sugar-modified nucleoside is an LNA nucleoside;

[0802] The oligonucleotide of the present invention, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA and ENA;

[0803] The oligonucleotide of the present invention, wherein the LNA nucleosides are all β-D-oxy-LNA;

[0804] The oligonucleotide of the present invention, wherein the 2'-sugar-modified nucleoside is 2'-alkoxyalkoxy-RNA;

[0805] The oligonucleotide of the present invention, wherein 2'-alkoxy-RNA is 2'-methoxy-RNA;

[0806] The oligonucleotide of the present invention, wherein 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA;

[0807] The oligonucleotide of the present invention comprises between 1 and 15, especially between 1 and 5, more specifically 1, 2, 3, 4 or 5 phosphorodithioate nucleoside internucleotide linkages of formula (I) as defined above.

[0808] The oligonucleotide of the present invention comprises other internucleotide linkages, which are independently selected from phosphodiester nucleoside internucleotide linkages, phosphorothioate nucleoside internucleotide linkages and phosphorodithioate nucleoside internucleotide linkages of formula (I) as defined above;

[0809] The oligonucleotides of the present invention, wherein the other internucleoside linkages are independently selected from phosphorothioate internucleoside linkages and dithiophosphonate internucleoside linkages of formula (I) as defined above.

[0810] The oligonucleotides of the present invention, wherein the other internucleoside linkages are all phosphorothioate internucleoside linkages;

[0811] The oligonucleotides of the present invention, wherein the other internucleoside linkages are all dithiophosphonate internucleoside linkages of formula (I) as defined above;

[0812] The oligonucleotides of the present invention, wherein the oligonucleotide is a gapmer, in particular an LNA gapmer, a hybrid flank gapmer, an alternating flank gapmer, a splice-switching oligomer, a mixmer or a fullmer;

[0813] The oligonucleotides of the present invention, which are gapmers and wherein at least one dithiophosphonate internucleoside linkage of formula (I) is comprised in the gap region of the gapmer and / or in one or more flank regions;

[0814] The oligonucleotides of the present invention, wherein a continuous nucleotide sequence, such as the gapmer region F-G-F', is flanked by flank regions D' or D" or D' and D", said flank regions comprising one or more DNA nucleotides linked to the rest of the oligonucleotide by phosphodiester internucleoside linkages;

[0815] The oligonucleotides of the present invention, which are gapmers, wherein one or both of the flank regions F and F', in particular one, are further flanked by phosphodiester-linked DNA nucleotides, in particular 1 to 5 phosphodiester-linked DNA nucleotides (regions D' and D");

[0816] The oligonucleotides of the present invention, wherein the oligonucleotide has a length of 7 to 30 nucleotides.

[0817] When the oligonucleotides of the present invention are gapmers, they advantageously have a length of 12 to 26 nucleotides. 16 nucleotides is a particularly advantageous gapmer oligonucleotide length.

[0818] When the oligonucleotide is a fully LNA oligonucleotide, it advantageously has a length of 7 to 10 nucleotides.

[0819] When the oligonucleotide is a mixmer oligonucleotide, it advantageously has a length of 8 to 30 nucleotides.

[0820] The present invention particularly relates to:

[0821] The oligonucleotides of the present invention, wherein one or more nucleotides are nucleobase-modified nucleotides;

[0822] The oligonucleotides of the present invention, wherein the oligonucleotides are antisense oligonucleotides, siRNAs, microRNA mimics or ribozymes;

[0823] Pharmaceutically acceptable salts of the oligonucleotides of the present invention, in particular sodium salts or potassium salts;

[0824] Conjugates comprising an oligonucleotide or a pharmaceutically acceptable salt of the present invention and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety;

[0825] Pharmaceutical compositions comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate of the present invention and a therapeutically inert carrier;

[0826] The oligonucleotides, pharmaceutically acceptable salts or conjugates of the present invention for use as a therapeutically active substance; and

[0827] Use of the oligonucleotides, pharmaceutically acceptable salts or conjugates of the present invention as a medicament.

[0828] In some embodiments, the oligonucleotides of the present invention have higher activity in modulating their target nucleic acids compared to the corresponding fully phosphorothioate-linked oligonucleotides. In some embodiments, the present invention provides oligonucleotides with enhanced activity, enhanced potency, enhanced specific activity or enhanced cellular uptake. In some embodiments, the present invention provides oligonucleotides with an altered duration of action in vitro or in vivo, such as an extended duration of action in vitro or in vivo. In some embodiments, higher activity in modulating the target nucleic acid is determined in vitro or in vivo in cells expressing the target nucleic acid.

[0829] In some embodiments, the oligonucleotides of the present invention have altered pharmacological properties, such as reduced toxicity, for example reduced nephrotoxicity, reduced hepatotoxicity or reduced immunostimulatory effects. Hepatotoxicity can be determined, for example, in vivo or by using the in vitro assay disclosed in WO2017 / 067970, which is hereby incorporated by reference in its entirety. Nephrotoxicity can be determined, for example, in vitro or by using the assay disclosed in PCT / EP2017 / 064770, which is hereby incorporated by reference in its entirety. In some embodiments, the oligonucleotides of the present invention comprise a 5’CG3’ dinucleotide, such as a DNA 5’CG 3’ dinucleotide, wherein the internucleoside linkage between C and G is a dithiophosphate internucleoside linkage of formula (I) as defined above.

[0830] In some embodiments, the oligonucleotides of the invention have improved nuclease resistance, such as improved biostability in serum. In some embodiments, the 3'-terminal nucleoside of the oligonucleotides of the invention has an A or G base, such as a 3'-terminal LNA-A or LNA-G nucleoside. Suitably, the internucleoside linkage between the two 3'-terminal most nucleosides of the oligonucleotide can be a phosphorothioate internucleoside linkage according to formula (I) as defined above.

[0831] In some embodiments, the oligonucleotides of the invention have enhanced bioavailability. In some embodiments, the oligonucleotides of the invention have a greater blood exposure, such as a longer retention time in blood.

[0832] The phosphorothioate modification is introduced into the oligonucleotide by solid-phase synthesis using the phosphoramidite method. The synthesis is carried out using controlled pore glass (CPG) equipped with a universal linker as a support. On this solid support, the oligonucleotide is generally built in the 3'-to-5' direction by sequential cycles consisting of coupling of 5'-O-DMT-protected nucleoside phosphoramidite building blocks, subsequent (thio)oxidation, capping, and deprotection of the DMT group. The introduction of the non-bridging phosphorothioate is achieved using a suitable thiophosphoramidite building block and subsequent sulfur oxidation of the main intermediate.

[0833] Although the corresponding DNA thiophosphoramidite is commercially available, the corresponding LNA building blocks have not been described previously. They can be prepared, for example, from 5'-O-DMT-protected nucleoside 3'-alcohols by reaction with monobenzoyl-protected ethanedithiol and tripyrrolidin-1-ylphosphine.

[0834] The oligonucleotides of the invention can thus be manufactured, for example, according to Scheme 2, where R 1 、R 2a 、R 2b 、R 4a 、R 4b 、R 5 、R x 、R y and V are defined below.

[0835] Scheme 2

[0836]

[0837] The invention thus also relates to a method for manufacturing the oligonucleotides of the invention, the method comprising the following steps:

[0838] (a) Coupling a phosphorothioamidite nucleoside to the terminal 5'-oxygen atom of a nucleotide or oligonucleotide to produce a phosphorothioate triester intermediate;

[0839] (b) Sulfur-oxidizing the phosphorothioate triester intermediate obtained in step (a); and

[0840] (c) Optionally further extending the oligonucleotide.

[0841] The present invention particularly relates to a method for manufacturing the oligonucleotides of the present invention, the method comprising the following steps:

[0842] (a1) Coupling a compound of formula (A)

[0843]

[0844] to the 5'-oxygen atom of a nucleotide or oligonucleotide of formula (B)

[0845]

[0846] (b1) Sulfur-oxidizing the phosphorothioate triester intermediate obtained in step (a1); and

[0847] (c1) Optionally further extending the oligonucleotide;

[0848] wherein

[0849] R 2a and R 4a together form -X-Y- as defined above; or

[0850] R 4a is hydrogen and R 2a is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy, and aminoalkoxy, especially aminoethoxy;

[0851] R 2b and R 4b together form -X-Y- as defined above; or

[0852] R 2b and R 4b are both hydrogen at the same time; or

[0853] R 4b is hydrogen and R 2b is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy, and aminoalkoxy, especially aminoethoxy;

[0854] V is oxygen or sulfur; and

[0855] wherein R5 , R x , R y and Nu are defined below.

[0856] The present invention particularly relates to a method for manufacturing the oligonucleotides of the present invention, said method comprising the following steps:

[0857] (a2) coupling a compound of formula (II)

[0858]

[0859] to the 5'-oxygen atom of a nucleotide or oligonucleotide of formula (IV)

[0860]

[0861] (b2) sulfur-oxidizing the phosphorothioate triester intermediate obtained in step (a2); and

[0862] (c2) optionally further extending the oligonucleotide;

[0863] wherein

[0864] R 2b and R 4b together form -X-Y- as defined above; or

[0865] R 2b and R 4b are both hydrogen at the same time; or

[0866] R 4b is hydrogen and R 2b is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy, and aminoalkoxy, especially aminoethoxy; and

[0867] wherein R 5 , R x , R y and Nu are defined below.

[0868] The present invention also relates to oligonucleotides manufactured according to the method of the present invention.

[0869] The present invention also relates to:

[0870] a nicked polymer oligonucleotide comprising at least one phosphorodithioate internucleoside linkage of formula (I)

[0871]

[0872] wherein R is hydrogen or a phosphate protecting group;

[0873] A nicked polymer oligonucleotide as defined above, wherein the oligonucleotide is an antisense oligonucleotide capable of regulating the expression of a target RNA in a cell expressing the target RNA;

[0874] A nicked polymer oligonucleotide as defined above, wherein the oligonucleotide is an antisense oligonucleotide capable of inhibiting the expression of a target RNA in a cell expressing the target RNA;

[0875] A nicked polymer oligonucleotide as defined above, which is capable of recruiting ribonucleases, such as human ribonuclease H1;

[0876] The nicked polymer oligonucleotide of the present invention, wherein one of the two oxygen atoms of the at least one internucleoside linkage of formula (I) is linked to the 3'-carbon atom of an adjacent nucleoside (A 1 ) and the other oxygen atom is linked to the 5'-carbon atom of another nucleoside (A 2 ), wherein at least one of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside;

[0877] The nicked polymer oligonucleotide of the present invention, wherein one of (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside and the other is a DNA nucleoside;

[0878] The nicked polymer oligonucleotide of the present invention, wherein both of (A 1 ) and (A 2 ) are 2'-modified nucleosides;

[0879] The nicked polymer oligonucleotide of the present invention, wherein both of (A 1 ) and (A 2 ) are DNA nucleosides;

[0880] The nicked polymer oligonucleotide of the present invention, wherein the nicked polymer oligonucleotide comprises a continuous nucleotide sequence of formula 5'-F-G-F'-3', wherein G is a region having 5 to 18 nucleosides capable of recruiting ribonuclease H, and the region G is flanked by flanking regions F and F' at the 5' and 3' sides respectively, wherein the regions F and F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, wherein the nucleoside of region F adjacent to region G is a 2'-sugar modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar modified nucleoside;

[0881] The nicked polymer oligonucleotide of the present invention, wherein the 2'-sugar modified nucleosides are independently selected from 2'-alkoxy-RNA nucleosides, 2'-alkoxyalkoxy-RNA nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, 2'-fluoro-ANA nucleosides and LNA nucleosides;

[0882] The nicked polymeric oligonucleotide of the present invention, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA (2'-O-MOE);

[0883] The nicked polymeric oligonucleotide of the present invention, wherein regions F and F' comprise or consist of 2'-methoxyethoxy-RNA nucleotides;

[0884] The nicked polymeric oligonucleotide of the present invention, wherein both regions F and F' consist of 2'-methoxyethoxy-RNA nucleotides, such as comprising the formula [MOE] 3-8 [DNA] 8-16 [MOE] 3-8 (e.g., [MOE]5[DNA] 10 [MOE]5) of the F-G-F', i.e., wherein regions F and F' each consist of five 2'-methoxyethoxy-RNA nucleotides, and region G consists of 10 DNA nucleotides;

[0885] The nicked polymeric oligonucleotide of the present invention, wherein at least one or all of the 2'-sugar modified nucleosides in region F or region F' or both regions F and F' are LNA nucleosides;

[0886] The nicked polymeric oligonucleotide of the present invention, wherein region F or region F' or both regions F and F' contain at least one LNA nucleoside and at least one DNA nucleoside;

[0887] The nicked polymeric oligonucleotide of the present invention, wherein region F or region F' or both regions F and F' contain at least one LNA nucleoside and at least one non-LNA 2'-sugar modified nucleoside, such as at least one 2'-methoxyethoxy-RNA nucleoside;

[0888] The nicked polymeric oligonucleotide of the present invention, wherein the nicked region contains 5 to 16, particularly 8 to 16, more specifically 8, 9, 10, 11, 12, 13 or 14 consecutive DNA nucleosides;

[0889] The nicked polymeric oligonucleotide of the present invention, wherein regions F and F' independently have a length of 1, 2, 3, 4, 5, 6, 7 or 8 nucleosides;

[0890] The nicked polymeric oligonucleotide of the present invention, wherein regions F and F' each independently contain 1, 2, 3 or 4 LNA nucleosides;

[0891] The nicked polymeric oligonucleotide of the present invention, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA and ENA;

[0892] The nicked polymeric oligonucleotide of the present invention, wherein the LNA nucleoside is β-D-oxy-LNA;

[0893] The nicked polymeric oligonucleotide of the present invention, wherein the oligonucleotide or its continuous nucleotide sequence (F-G-F’) has a length of 10 to 30 nucleotides, particularly 12 to 22 nucleotides, more particularly 14 to 20 nucleotides;

[0894] The nicked polymeric oligonucleotide of the present invention, wherein the nicked polymeric oligonucleotide comprises a continuous nucleotide sequence of formula 5’-D’-F-G-F’-D”-3’, where F, G and F’ are as defined in any one of claims 4 to 17 and wherein the regions D’ and D” each independently consist of 0 to 5 nucleotides, particularly 2, 3 or 4 nucleotides, particularly DNA nucleotides (such as phosphodiester-linked DNA nucleosides);

[0895] The nicked polymeric oligonucleotide of the present invention, wherein the nicked polymeric oligonucleotide is capable of recruiting human RNase H1;

[0896] The nicked polymeric oligonucleotide of the present invention, wherein at least one phosphorodithioate internucleoside linkage of formula (I) as defined above is located between adjacent nucleosides in region F or region F’, between region F and region G or between region G and region F’;

[0897] The nicked polymeric oligonucleotide of the present invention, which further comprises a phosphorothioate internucleoside linkage;

[0898] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region G are independently selected from phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I) as defined above;

[0899] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside linkages of formula (I) as defined above;

[0900] The nicked polymeric oligonucleotide of the present invention, wherein the remaining internucleoside linkages are independently selected from phosphorothioate internucleoside linkages, phosphodiester internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I) as defined above;

[0901] The nicked polymeric oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region F and the internucleoside linkages between the nucleosides in region F’ are independently selected from phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I) as defined above;

[0902] The nicked polymer oligonucleotide of the present invention, wherein each of the flanking regions F and F' independently comprises 1, 2, 3, 4, 5, 6 or 7 phosphorothioate internucleoside linkages of formula (I) as defined above.

[0903] The nicked polymer oligonucleotide of the present invention, wherein the flanking regions F and F' together or separately comprise 1, 2, 3, 4, 5 or 6 phosphorothioate internucleoside linkages of formula (I) as defined above, or all of the internucleoside linkages in region F and / or region F' are phosphorothioate internucleoside linkages of formula (I) as defined above;

[0904] The nicked polymer oligonucleotide of the present invention, wherein the flanking regions F and F' together comprise 1, 2, 3 or 4 phosphorothioate internucleoside linkages of formula (I) as defined above;

[0905] The nicked polymer oligonucleotide of the present invention, wherein each of the flanking regions F and F' comprises 2 phosphorothioate internucleoside linkages of formula (I) as defined above;

[0906] The nicked polymer oligonucleotide of the present invention, wherein all of the internucleoside linkages in the flanking region F and / or F' are phosphorothioate internucleoside linkages of formula (I) as defined above;

[0907] The nicked polymer oligonucleotide of the present invention, wherein the nicked polymer oligonucleotide comprises at least one stereodefined internucleoside linkage, such as at least one stereodefined phosphorothioate internucleoside linkage;

[0908] The nicked polymer oligonucleotide of the present invention, wherein the nicked region comprises 1, 2, 3, 4 or 5 stereodefined phosphorothioate internucleoside linkages;

[0909] The nicked polymer oligonucleotide of the present invention, wherein all of the internucleoside linkages between the nucleosides in the nicked region are stereodefined phosphorothioate internucleoside linkages;

[0910] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorothioate internucleoside linkage of formula (I) as defined above is located between the nucleosides in region F, or between the nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages within regions F and F', between region F and region G and between region G and region F' are independently selected from stereodefined phosphorothioate internucleoside linkages, stereorandom internucleoside linkages, phosphorothioate internucleoside linkages of formula (I) and phosphodiester internucleoside linkages;

[0911] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorodithioate internucleoside linkage of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages between the nucleotides in regions F and F' are independently selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages of formula (I), and phosphodiester internucleoside linkages. The phosphorothioate internucleoside linkages in regions F and F' may be atactic or stereodefined, or may independently be selected from atactic and stereodefined;

[0912] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorodithioate internucleoside linkage of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between at least two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages between the nucleotides in regions F and F' are independently selected from phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I). The phosphorothioate internucleoside linkages in regions F and F' may be atactic or stereodefined, or may independently be selected from atactic and stereodefined;

[0913] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorodithioate internucleoside linkage of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between at least two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages between the nucleotides in regions F and F', between region F and region G, and between region G and region F' are independently selected from phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I); the phosphorothioate internucleoside linkages in regions F and F' may be atactic or stereodefined, or may independently be selected from atactic and stereodefined;

[0914] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorodithioate internucleoside linkage of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between at least two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages between the nucleotides in regions F and F', between region F and region G, and between region G and region F' are independently selected from stereodefined phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I);

[0915] The nicked polymer oligonucleotide of the present invention, wherein at least one phosphorodithioate internucleoside linkage of formula (I) as defined above is located between at least two adjacent nucleosides in region F, or between at least two adjacent nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside linkages within region F and F', between region F and region G, and between region G and region F' are phosphorothioate internucleoside linkages, which may be all atactic phosphorothioate internucleoside linkages, all stereodefined phosphorothioate internucleoside linkages, or may independently be selected from atactic phosphorothioate internucleoside linkages and stereodefined phosphorothioate internucleoside linkages;

[0916] The nicked polymer oligonucleotide of the present invention, wherein the remaining internucleoside linkages within region F, within region F', or within both region F and region F' are all phosphorodithioate internucleoside linkages of formula (I) as defined above;

[0917] The nicked polymer oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region G contain 0, 1, 2, or 3 phosphorodithioate internucleoside linkages of formula (I) as defined above and the remaining internucleoside linkages within region G are independently selected from stereodefined phosphorothioate internucleoside linkages and atactic phosphorothioate internucleoside linkages;

[0918] The nicked polymer oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region G contain 0, 1, 2, or 3 phosphorodithioate internucleoside linkages of formula (I) as defined above and at least one or all of the remaining internucleoside linkages within region G are stereodefined phosphorothioate internucleoside linkages;

[0919] The nicked polymer oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides in region G contain 0, 1, 2, or 3 phosphorodithioate internucleoside linkages of formula (I) as defined above and the remaining internucleoside linkages within region G are phosphorothioate internucleoside linkages, such as atactic phosphorothioate internucleoside linkages;

[0920] The nicked polymer oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorodithioate internucleoside linkage of formula (I) as defined above and all of the internucleoside linkages within region G are phosphorothioate internucleoside linkages, such as atactic phosphorothioate internucleoside linkages;

[0921] The nicked polymer oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorodithioate internucleoside linkage of formula (I) as defined above and all internucleoside linkages within region G are phosphorothioate internucleoside linkages, wherein at least one of the phosphorothioate internucleoside linkages within region G is a stereodefined phosphorothioate internucleoside linkage;

[0922] The nicked polymer oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorodithioate internucleoside linkage of formula (I) as defined above and all internucleoside linkages within region G are stereodefined phosphorothioate internucleoside linkages;

[0923] The nicked polymer oligonucleotide of the present invention, wherein the internucleoside linkage between region F and G, or between region G and F', or between region F and G and between region G and F' is a phosphorodithioate internucleoside linkage of formula (I) as defined above, and wherein if only one of the internucleoside linkages between region F and G and between region G and F' is a phosphorodithioate internucleoside linkage of formula (I) as defined above, then the other internucleoside linkage between region F and G or between region G and F' is a phosphorothioate internucleoside linkage;

[0924] The nicked polymer oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorodithioate internucleoside linkage of formula (I) as defined above, wherein the internucleoside linkage between region F and G, or between region G and F', or between region F and G and between region G and F' is a phosphorodithioate internucleoside linkage of formula (I) as defined above and wherein if only one of the internucleoside linkages between region F and G and between region G and F' is a phosphorodithioate internucleoside linkage of formula (I) as defined above, then the other internucleoside linkage between region F and G or between region G and F' is a phosphorothioate internucleoside linkage;

[0925] The nicked polymer oligonucleotide of the present invention, wherein the internucleoside linkages between the nucleosides of region G contain 0, 1, 2 or 3 phosphorodithioate internucleoside linkages of formula (I) as defined above and the remaining internucleoside linkages within region G are phosphorothioate internucleoside linkages, wherein the internucleoside linkage between region F and G, or between region G and F', or between region F and G and between region G and F' is a phosphorodithioate internucleoside linkage of formula (I) as defined above and wherein if only one of the internucleoside linkages between region F and G and between region G and F' is a phosphorodithioate internucleoside linkage of formula (I) as defined above, then the other internucleoside linkage between region F and G or between region G and F' is a phosphorothioate internucleoside linkage;

[0926] The nicked polymer oligonucleotide of the present invention, wherein at least one of region F or region F' comprises at least one phosphorodithioate internucleoside linkage of formula (I) as defined above, wherein the internucleoside linkages between the nucleosides in region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside linkages of formula (I) as defined above and the remaining internucleoside linkages within region G are phosphorothioate internucleoside linkages, wherein the internucleoside linkage between region F and G, or between region G and F', or between region F and G and between region G and F' is a phosphorodithioate internucleoside linkage of formula (I) as defined above, and wherein, if only one of the internucleoside linkages between region F and G and between region G and F' is a phosphorodithioate internucleoside linkage of formula (I) as defined above, the other internucleoside linkage between region F and G or between region G and F' is a phosphorothioate internucleoside linkage;

[0927] The nicked polymer oligonucleotide of the present invention, wherein region F or region F' comprises at least one phosphorodithioate internucleoside linkage of formula (I) as defined above, or wherein the internucleoside linkage between region F and region G or between region G and region F' comprises at least one phosphorodithioate internucleoside linkage of formula (I) as defined above, region G comprises 1, 2 or 3 phosphorodithioate internucleoside linkages of formula (I) as defined above, and the remaining internucleoside linkages within region G are phosphorothioate internucleoside linkages;

[0928] The nicked polymer oligonucleotide of the present invention, wherein region F or region F' comprises at least one phosphorodithioate internucleoside linkage of formula (I) as defined above, or wherein the internucleoside linkage between region F and region G or between region G and region F' comprises at least one phosphorodithioate internucleoside linkage of formula (I) as defined above, all of the internucleoside linkages within region G are phosphorothioate internucleoside linkages, and wherein at least one of the phosphorothioate internucleoside linkages within region G is a stereodefined phosphorothioate internucleoside linkage;

[0929] The nicked polymer oligonucleotide of the present invention, wherein region F or region F' comprises at least one phosphorodithioate internucleoside linkage of formula (I) as defined above, or wherein the internucleoside linkage between region F and region G or between region G and region F' comprises at least one phosphorodithioate internucleoside linkage of formula (I) as defined above, all of the internucleoside linkages within region G are phosphorothioate internucleoside linkages, and wherein all of the phosphorothioate internucleoside linkages within region G are stereodefined phosphorothioate internucleoside linkages;

[0930] The nicked polymer oligonucleotide of the present invention, wherein all the remaining internucleoside linkages within the nicked polymer region F-G-F' are phosphorothioate internucleoside linkages except for the at least one phosphorodithioate internucleoside linkage of formula (I) as defined above;

[0931] The nicked polymer oligonucleotide of the present invention, wherein at least one of region F or region F' contains at least one phosphorodithioate internucleoside linkage of formula (I) as defined above and all the internucleoside linkages within region G are stereodefined phosphorothioate internucleoside linkages;

[0932] The nicked polymer oligonucleotide of the present invention, wherein all the remaining internucleoside linkages within the nicked polymer region F-G-F' are stereodefined phosphorothioate internucleoside linkages except for the at least one phosphorodithioate internucleoside linkage of formula (I);

[0933] The nicked polymer oligonucleotide of the present invention, which is an LNA nicked polymer, a hybridized flanking nicked polymer, an alternating flanking nicked polymer or a nicking breaker nicked polymer.

[0934] A pharmaceutically acceptable salt of the nicked polymer oligonucleotide of the present invention, especially a sodium salt or a potassium salt;

[0935] A conjugate, which comprises the nicked polymer oligonucleotide or pharmaceutically acceptable salt of the present invention and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety, especially via a biocleavable linker, particularly via 2 to 4 phosphodiester-linked DNA nucleosides (such as region D' or D'') covalently linked;

[0936] A pharmaceutical composition, which comprises the nicked polymer oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention and a therapeutically inert carrier;

[0937] The nicked polymer oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention, used as a therapeutic active substance;

[0938] Use of the nicked polymer oligonucleotide, pharmaceutically acceptable salt or conjugate as a medicine;

[0939] A method for regulating the expression of a target RNA in a cell, the method comprising administering to the cell expressing the target RNA the oligonucleotide or nicked polymer oligonucleotide of the present invention so as to regulate the expression of the target RNA;

[0940] A method for inhibiting the expression of a target RNA in a cell, the method comprising administering to the cell expressing the target RNA the oligonucleotide or nicked polymer oligonucleotide of the present invention so as to inhibit the expression of the target RNA; and

[0941] An in vitro method of modulating or inhibiting a target RNA in a cell, the method comprising administering to the cell expressing the target RNA an oligonucleotide or a nicked polymer oligonucleotide of the present invention, thereby modulating or inhibiting the target RNA in the cell.

[0942] The target RNA can be, for example, a mammalian mRNA, such as pre-mRNA or mature mRNA, a human mRNA, a viral RNA, or a non-coding RNA, such as a microRNA or a long non-coding RNA.

[0943] In some embodiments, the modulating effect is a pre-mRNA splicing modulation effect that results in a change in the splicing pattern of the target pre-mRNA.

[0944] In some embodiments, the modulating effect is an inhibitory effect that can occur through target degradation (e.g., by recruiting RNase H, such as RNase H1 or RISC), or the inhibitory effect can occur through an occupancy-mediated mechanism that inhibits the normal biological function of the target RNA (e.g., inhibition of microRNA or long non-coding RNA by a mixed polymer or a homopolymer).

[0945] The human mRNA can be mature RNA or pre-mRNA.

[0946] The present invention further relates to a compound of formula (II)

[0947]

[0948] wherein

[0949] X is oxygen, sulfur, -CR a R b -, -C(R a )=C(R b )-, -C(=CR a R b )-, -C(R a )=N-, -Si(R a )2-, -SO2-, -NR a -; -O-NR a -, -NR a -O-, -C(=J)-, Se, -O-NR a -, -NR a -CR a R b -, -N(R a )-O- or -O-CR a R b -;

[0950] Y is oxygen, sulfur, -(CR a R b ) n -, -CRa R b -O-CR a R b -、-C(R a )=C(R b )-、-C(R a )=N-、-Si(R a )2-、-SO2-、-NR a -, -C(=J)-, Se, -O-NR a -、-NR a -CR a R b -、-N(R a )-O-or-O-CR a R b -;

[0951] The condition is that -XY- is not -OO-, Si(R a )2-Si(R a )2-、-SO2-SO2-、-C(R a )=C(R b )-C(R a )=C(R b )、-C(R a )=NC(R a )=N-、-C(R a )=NC(R a )=C(R b )、-C(R a )=C(R b )-C(R a )=N- or -Se-Se-;

[0952] J is oxygen, sulfur, =CH2 or =N(R a );

[0953] R a and R b independently selected from hydrogen, halogen, hydroxy, cyano, mercapto, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocyclyl, amino, alkylamino, carbamoyl, alkylaminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, alkylcarbonylamino, ureido, alkanoyloxy, sulfonyl, alkylsulfonyloxy, nitro, azido, mercaptosulfurized alkylthio, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, -OC(=X a )R c 、-OC(=Xa )NR c R d and -NR e C(=X a )NR c R d ;

[0954] or two geminal Rs a and R b together form an optionally substituted methylene group;

[0955] or two geminal Rs a and R b together with the carbon atom to which they are attached form a cycloalkyl or halocycloalkyl group having only one -X-Y- carbon atom;

[0956] wherein the substituted alkyl, substituted alkenyl, substituted alkynyl, substituted alkoxy and substituted methylene groups are alkyl, alkenyl, alkynyl and methylene groups substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl, formyl, heterocyclic, aryl and heteroaryl;

[0957] X a is oxygen, sulfur or -NR c ;

[0958] R c 、R d and R e are independently selected from hydrogen and alkyl;

[0959] n is 1, 2 or 3.

[0960] R 5 is a hydroxy protecting group;

[0961] R x is phenyl, nitrophenyl, phenylalkyl, halophenylalkyl, cyanoalkyl, phenylcarbonylthioalkyl, halophenylcarbonylthioalkyl, alkylcarbonylthioalkyl or alkylcarbonylcarbonylthioalkyl;

[0962] R y is dialkylamino or pyrrolidino; and

[0963] Nu is a nucleobase or a protected nucleobase.

[0964] The present invention also relates to:

[0965] a compound of formula (II) wherein -X-Y- is -CH2-O-, -CH(CH3)-O- or -CH2CH2-O-;

[0966] The present invention also provides a compound of formula (IIb)

[0967]

[0968] wherein

[0969] R 5 is a hydroxyl protecting group,

[0970] R x is phenyl, nitrophenyl, phenylalkyl, halophenylalkyl, cyanoalkyl, phenylcarbonylthioalkyl, halophenylcarbonylthioalkyl, alkylcarbonylthioalkyl or alkylcarbonylcarbonylthioalkyl;

[0971] R y is dialkylamino or pyrrolidino; and

[0972] Nu is a nucleobase or a protected nucleobase;

[0973] A compound of formula (II) which has formula (III) or (IV)

[0974]

[0975] wherein R 5 、R x 、R y and Nu are as defined above.

[0976] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenyl, nitrophenyl, phenylmethyl, dichlorophenylmethyl, cyanoethyl, methylcarbonylthioethyl, ethylcarbonylthioethyl, isopropylcarbonylthioethyl, tert-butylcarbonylthioethyl, methylcarbonylcarbonylthioethyl or difluorophenylcarbonylthioethyl;

[0977] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenyl, 4-nitrophenyl, 2,4-dichlorophenylmethyl, cyanoethyl, methylcarbonylthioethyl, ethylcarbonylthioethyl, isopropylcarbonylthioethyl, tert-butylcarbonylthioethyl, methylcarbonylcarbonylthioethyl or 2,4-difluorophenylcarbonylthioethyl;

[0978] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenylcarbonylthioalkyl;

[0979] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenylcarbonylthioethyl;

[0980] A compound of formula (II), (IIb), (III) or (IV), wherein R y is diisopropylamino or pyrrolidino;

[0981] A compound of formula (II), (IIb), (III) or (IV), wherein R y is pyrrolidino;

[0982] A compound of formula (II) having the formula (V)

[0983]

[0984] wherein R 5 and Nu are as defined above;

[0985] A compound of formula (IIb) having the formula (Vb)

[0986]

[0987] wherein R 5 and Nu are as defined above;

[0988] A compound of formula (II), (IIb), (III), (IV) or (V) or (Vb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracil or protected uracil;

[0989] A compound of formula (IIb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracil or protected uracil;

[0990] A compound of formula (Vb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracil or protected uracil;

[0991] A compound of formula (II) selected from

[0992]

[0993]

[0994] A compound of formula (IIb) selected from

[0995]

[0996]

[0997] The presence of impurities in the compounds of formula (II) and (IIb) results in by-products during the manufacture of oligonucleotides and hinders the success of the synthesis. Additionally, in the presence of impurities, the compounds of formula (II) or (IIb) are unstable upon storage.

[0998] Compounds of formula (X1), (X2), X(11) and (X21)

[0999]

[1000] In particular, examples of such impurities.

[1001] Therefore, for storage and oligonucleotide manufacturing purposes, compounds of formula (II) or (IIb) in a sufficiently pure form are required.

[1002] The present invention thus also relates to compounds of formula (II)(IIb) having a purity of at least 98%, specifically 99%, more specifically 100%.

[1003] The present invention thus particularly relates to compounds of formula (II) comprising less than 1%, specifically 0% of compounds of formula (X1) and / or (X2) as impurities.

[1004] The present invention also relates to a method for manufacturing a compound of formula (II) as defined above, the method comprising reacting a 5'-protected LNA nucleoside with a phosphine and a mono-protected dithiol in the presence of an acidic coupling agent and a silylating agent.

[1005] The present invention also relates to a method for manufacturing a compound of formula (IIb) as defined above, the method comprising reacting a 5'-protected MOE nucleoside with a phosphine and a mono-protected dithiol in the presence of an acidic coupling agent and a silylating agent.

[1006] The present invention relates to a method for manufacturing a compound of formula (II), the method comprising reacting a compound of formula (C)

[1007]

[1008] with a compound of formula P(R y )3 and a compound of formula HSR x in the presence of an acidic coupling agent and a silylating agent, wherein X, Y, R 5 , Nu, R x and R y are as defined above.

[1009] The present invention also relates to a method for preparing a compound of formula (II), said method comprising reacting a compound of formula (C1)

[1010]

[1011] with a compound of formula P(R y )3 and a compound of formula HSR x in the presence of an acidic coupling agent and a silylating agent, wherein R 5 , Nu, R x and R y are as defined above.

[1012] The present invention also relates to a method for preparing a compound of formula (IIb), said method comprising reacting a compound of formula (Cb)

[1013]

[1014] with a compound of formula P(R y )3 and a compound of formula HSR x in the presence of an acidic coupling agent and a silylating agent, wherein R 5 , Nu, R x and R y are as defined above.

[1015] Examples of acidic coupling agents (also referred to as acidic activators) are azole-based activators such as tetrazole, 5-nitrophenyl-1H-tetrazole (NPT), 5-ethylthio-1H-tetrazole (ETT), 5-benzylthio-1H-tetrazole (BTT), 5-methylthio-1H-tetrazole (MTT), 5-mercapto-tetrazoles (MCT), 5-(3,5-bis(trifluoromethyl)phenyl)-1H-tetrazole and 4,5-dicyanoimidazole (DCI), or acidic salts such as pyridinium chloride, imidazolium trifluoromethanesulfonate, benzimidazolium trifluoromethanesulfonate, 5-nitrobenzimidazolium trifluoromethanesulfonate, or weak acids such as 2,4-dinitrobenzoic acid or 2,4-dinitrophenol. Tetrazole is a specific acidic coupling agent.

[1016] Examples of silylating agents (also known as hydroxyl quenchers) are bis(dimethylamino)dimethylsilane, N,O-bis(trimethylsilyl)acetamide (BSA), N,O-bis(trimethylsilyl)carbamate (BSC), N,N-bis(trimethylsilyl)methylamine, N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA), N,N′-bis(trimethylsilyl)urea (BSU), bromotrimethylsilane (TMBS), N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA), chlorodimethyl(pentafluorophenyl)silane, chlorotriethylsilane (TESCI), chlorotrimethylsilane (TMCS), 1,3-dimethyl-1,1,3,3-tetraphenyldisilazane (TPDMDS), N,N-dimethyltrimethylsilylamine (TMSDMA), hexamethyldisilazane (HMDS), hexamethyldisiloxane (HMDSO), N-methyl-N-trimethylsilylacetamide (MSA), N-methyl-N-trimethylsilylheptafluorobutamide (MSHFA), N-methyl-N-(trimethylsilyl)trifluoroacetamide (MSTFA), 1,1,3,3-tetramethyl-1,3-diphenyldisilazane (DPTMDS), 4-(trimethylsiloxy)-3-penten-2-one (TMS acac), 1-(trimethylsilyl)imidazole (TMSI) or trimethylsilylmethallylsulfinate (SILMAS-TMS). 1-(Trimethylsilyl)imidazole is a specific silylating agent.

[1017] The invention also relates to a process for preparing a compound of formula (II), (IIb) or (III), wherein the crude compound of formula (II) or (IIb) is purified by preparative HPLC.

[1018] The invention also relates to a process for preparing a compound of formula (II), (IIb) or (III), wherein the crude compound of formula (II), (IIb) or (III) is purified by preparative HPLC and eluted with a gradient of acetonitrile vs. aqueous ammonium hydroxide.

[1019] The ammonium hydroxide content in water is in particular at least about 0.05% v / v, in particular between about 0.05% and 1% v / v, more specifically between about 0.05% and 0.5% v / v, more specifically about 0.05% v / v.

[1020] The acetonitrile gradient is in particular from 0% to 25% to 75% to 100% acetonitrile, in particular in the range from 20 minutes to 120 minutes, more specifically from 10% to 20% to 75% to 90% acetonitrile, in particular in the range from 25 minutes to 60 minutes, more specifically about 25% to 75% acetonitrile, in particular in 30 minutes.

[1021] The present invention also relates to the use of the compounds of formula (II), (IIb) or (III) in the manufacture of oligonucleotides, in particular the oligonucleotides of the present invention or nicked polymer oligonucleotides.

[1022] The present invention will now be illustrated by the following examples, which are not limiting. Examples

[1023] Example 1: Monomer synthesis

[1024] 1.1: S-(2-Thioethyl) phenylthiocarbonate

[1025]

[1026] To a solution of 1,2-ethanedithiol (133.57 mL, 1592 mmol, 1 equiv) and pyridine (64.4 mL, 796 mmol, 0.5 equiv) in chloroform (200 mL) was added dropwise benzoyl chloride (92.4 mL, 796 mmol, 0.5 equiv) in chloroform (200 mL) over 1 hour, and the reaction was stirred at 0 °C for 1 hour. The mixture was washed with water (300 mL) and brine (300 mL). The organic phase was dried over Na2SO4 and concentrated to a yellow oil. The oil was distilled (135 - 145 °C) to afford S-(2-thioethyl) phenylthiocarbonate as a colorless oil (40 g, 202 mmol, 13% yield). 1 1H NMR (400 MHz, CDCl3) δ 7.97 (d, J = 7.34 Hz, 2H), 7.53 - 7.64 (m, 1H), 7.47 (t, J = 7.58 Hz, 2H), 3.31 (t, J = 7.34 Hz, 2H), 2.77 - 2.86 (m, 2H), 1.70 (t, J = 8.56 Hz, 1H).

[1027] 1.2: S-[2-[[(1R,3R,4R,7S)-1-[[Bis(4-methoxyphenyl)phenylmethoxy]methyl]-3-(5-methyl-2,4-dioxo-pyrimidin-1-yl)-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphanyl]thioethyl] phenylthiocarbonate

[1028]

[1029] 1-[(1R,4R,6R,7S)-4-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]-5-methylpyrimidine-2,4-dione (2.29 g, 4.00 mmol, 1.0 equiv) was dissolved in 60 mL of anhydrous dichloromethane and a spatula tip of molecular sieve was added. Tripyrrolidin-1-ylphosphine (960 mg, 3.98 mmol, 0.99 equiv) was added via syringe, and then seven equal portions of 0.1 mmol of tetrazole (7 * 0.4 mL of a 0.5 M anhydrous acetonitrile solution stored on molecular sieve) were added at 2-minute intervals. Subsequently, N-trimethylsilylimidazole (56.0 mg, 0.400 mmol, 0.1 equiv) was added to the reaction. After 5 minutes, tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) was added, and then S-(2-thioethyl)phenyl thioformate (1.04 g, 5.24 mmol, 1.31 equiv) was added immediately. The reaction was allowed to proceed for 120 seconds. Four identical batches of the reaction were combined and quenched by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. The mixture was washed immediately with saturated sodium bicarbonate (800 mL), followed by 10% sodium carbonate (2 * 800 mL) and brine (800 mL). The organic layer was dried over Na2SO4. After 10 - 15 minutes, the drying agent was removed by filtration. Triethylamine (40 mL) was added to the solution, and the solution was concentrated to a slurry using a rotary evaporator. The slurry was dissolved in toluene (200 mL) and triethylamine (40 mL), and this solution was drawn into 4500 mL of vigorously stirred heptane to precipitate a fluffy white product. After decanting most of the heptane, the white precipitate was collected by filtration through a medium sintered glass funnel and then dried under vacuum to give a white solid. The solid was purified by preparative HPLC (Phenomenex Gemini C18, 250 x 50 mm, 10 mm column, 0.05% ammonium hydroxide in water / CH3CN) and lyophilized to afford 4.58 g of the target compound as a white solid. 31 P NMR (162 MHz, CD3CN) δ 167.6, 164.2. 11H NMR (400 MHz, CD3CN) δ 9.16 (br s, 1H), 7.93 (t, J = 7.41 Hz, 2H), 7.60 - 7.71 (m, 1H), 7.45 - 7.57 (m, 4H), 7.24 - 7.45 (m, 7H), 6.90 (d, J = 8.93 Hz, 4H), 5.53 - 5.63 (m, 1H), 4.41 - 4.64 (m, 2H), 3.74 - 3.88 (m, 8H), 3.39 - 3.63 (m, 2H), 3.03 - 3.32 (m, 5H), 2.77 - 2.94 (m, 2H), 1.66 - 1.84 (m, 4H), 1.54 - 1.66 (m, 3H).

[1030] 1.3: S-[2-[[(1R,3R,4R,7S)-3-(6-Benzamido-9H-purin-9-yl)-1-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphanyl]sulfanyl-ethyl] phenylcarbamothioate

[1031]

[1032] Dissolve N-[9-[(1R,4R,6R,7S)-4-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]purin-6-yl]benzamide (2.74 g, 4.00 mmol, 1.0 equivalent) in 60 mL of anhydrous dichloromethane, and add a spatula tip of molecular sieve. Add tripyrrolidin-1-ylphosphine (960 mg, 3.98 mmol, 0.99 equivalent) by syringe, and then add seven equal portions of 0.1 mmol of tetrazole at 2-minute intervals (in 7 * 0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored on the molecular sieve). Subsequently, 1-(trimethylsilyl)-1H-imidazole (56.0 mg, 0.400 mmol, 0.1 equivalent) was added to the reaction. After 5 minutes, tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) was added, and immediately thereafter, S-(2-thioethyl) phenylthiocarbonate (1.04 g, 5.24 mmol, 1.31 equivalents) was added. The reaction was allowed to proceed for 120 seconds. The reactions of four identical batches were combined and quenched by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. The mixture was immediately washed with saturated sodium bicarbonate (800 mL), followed by washing with 10% sodium carbonate (2 * 800 mL) and brine (800 mL). The organic layer was dried over Na2SO4. After 10 - 15 minutes, the desiccant was removed by filtration. Triethylamine (10 mL) was added to the solution, and the solution was concentrated to a slurry using a rotary evaporator. The slurry was dissolved in toluene (100 mL) and triethylamine (20 mL), and this solution was suctioned into 4500 mL of vigorously stirred heptane to precipitate a fluffy white product. After decanting most of the heptane, the white precipitate was collected by filtration through a medium sintered glass funnel and then dried under vacuum to yield a white solid. The solid was purified by preparative HPLC (Phenomenex Gemini C18, 250 x 50 mm, 10 mm column, 0.05% ammonium hydroxide in water / CH3CN) and lyophilized to afford 5.26 g of the target compound as a white solid. 31 P NMR (162 MHz, CD3CN) δ 165.6, 164.7. 1 H NMR (400 MHz, CD3CN) δ 8.56 (d, J = 10.76 Hz, 1H), 8.24 (d, J = 10.27 Hz, 1H), 7.82 - 7.93 (m, 2H), 7.71 - 7.80 (m, 2H), 6.92 - 7.54 (m, 14H), 6.68 - 6.83 (m, 4H), 6.03 (d, J = 6.48 Hz, 1H), 4.70 - 4.90 (m, 2H), 3.81 - 3.98 (m, 2H), 3.59 - 3.68 (m, 7H), 3.25 - 3.47 (m, 2H), 2.81 - 3.02 (m, 6H), 2.56 - 2.81 (m, 2H), 1.44 - 1.72 (m, 4H).

[1033] 1.4: S-[2-[[(1R,3R,4R,7S)-3-(4-benzamido-5-methyl-2-oxopyrimidin-1-yl)-1-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphanyl]sulfanylethyl] phenylthiocarbonate

[1034]

[1035] Dissolve N-[1-[(1R,4R,6R,7S)-4-[[bis(4-methoxyphenyl)phenylmethoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]-5-methyl-2-oxopyrimidin-4-yl]benzamide (2.70 g, 4.00 mmol, 1.0 eq) in 60 mL of anhydrous dichloromethane and add to it a spatula tip of molecular sieve. Add tripyrrolidin-1-ylphosphine (965 mg, 4.00 mmol, 1.0 eq) via syringe and then add seven equal portions of 0.1 mmol of tetrazole (7 * 0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored on molecular sieve) at 2-minute intervals. Subsequently add 1-(trimethylsilyl)-1H-imidazole (56.0 mg, 0.400 mmol, 0.1 eq) to the reaction. After 5 minutes, add tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) and then immediately add S-(2-sulfanylethyl) phenylthiocarbonate (1.04 g, 5.24 mmol, 1.31 eq). Allow the reaction to proceed for 120 seconds. Quench and combine four identical batches of the reaction by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. Wash the mixture immediately with saturated sodium bicarbonate (800 mL), then with 10% sodium carbonate (2 * 800 mL) and brine (800 mL). Dry the organic layer over Na2SO4. After 10 - 15 minutes, remove the drying agent by filtration. Add triethylamine (40 mL) to the solution and concentrate the solution to a paste using a rotary evaporator. Dissolve the paste in toluene (100 mL) and triethylamine (30 mL) and suction this solution into 4500 mL of vigorously stirred heptane to precipitate a fluffy white product. After decanting most of the heptane, filter through a medium sintered glass funnel, collect the white precipitate and then dry it under vacuum to yield a white solid. Purify the solid by preparative HPLC (Phenomenex Gemini C18, 250 x 50 mm, 10 mm column, 0.05% ammonium hydroxide in water / CH3CN) and lyophilize to afford 2.05 g of the target compound as a white solid. 31P NMR (162 MHz, CD3CN) δ 171.2, 167.4. 1 H NMR (400 MHz, CD3CN) δ 8.18 - 8.32 (m, 2H), 7.81 - 7.93 (m, 3H), 7.35 - 7.60 (m, 14H), 7.17 - 7.35 (m, 2H), 6.93 (d, J = 8.93 Hz, 4H), 5.65 (d, J = 15.04 Hz, 1H), 4.56 - 4.72 (m, 2H), 3.69 - 3.90 (m, 8H), 3.45 - 3.61 (m, 2H), 3.03 - 3.26 (m, 6H), 2.76 - 3.02 (m, 2H), 1.65 - 1.93 (m, 7H).

[1036] 1.5: S - [2 - [[(1R,3R,4R,7S) - 1 - [[bis(4 - methoxyphenyl)phenyl - methoxy]methyl] - 3 - [2 - [(E) - dimethylaminomethyleneamino] - 6 - oxo - 1H - purin - 9 - yl] - 2,5 - dioxabicyclo[2.2.1]hept - 7 - yl]oxy - pyrrolidin - 1 - yl - phosphinothioyl]sulfanylethyl]phenylthiocarbonate

[1037]

[1038] Dissolve N'-[9 - [(1R,4R,6R,7S) - 4 - [[bis(4 - methoxyphenyl)phenyl - methoxy]methyl] - 7 - hydroxy - 2,5 - dioxabicyclo[2.2.1]hept - 6 - yl] - 6 - oxo - 1H - purin - 2 - yl] - N,N - dimethyl - formamidine (2.62 mg, 4.00 mmol, 1.0 equivalent) in 200 mL of anhydrous dichloromethane, and add to it a spatula - tip of molecular sieve. Add tripyrrolidin - 1 - ylphosphine (965 mg, 4.00 mmol, 1.0 equivalent) by syringe, and then add seven equal portions of 0.1 mmol of tetrazole at 2 - minute intervals (7 * 0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored on molecular sieve). Subsequently, add 1 - (trimethylsilyl) - 1H - imidazole (56.0 mg, 0.400 mmol, 0.1 equivalent) to the reaction. After 5 minutes, add tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile), and then immediately add S - (2 - sulfanylethyl)phenylthiocarbonate (1.04 g, 5.24 mmol, 1.31 equivalents). Allow the reaction to proceed for 180 seconds.

[1039] Four identical batches were combined and quenched by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. The mixture was immediately washed with saturated sodium bicarbonate (800 mL), followed by washing with 10% sodium carbonate (2 * 800 mL) and brine (800 mL). The organic layer was dried over Na2SO4. After 10 - 15 minutes, the desiccant was removed by filtration. Triethylamine (40 mL) was added to the solution, and the solution was concentrated to a paste using a rotary evaporator. The paste was dissolved in toluene (100 mL) and triethylamine (30 mL), and this solution was aspirated into 4500 mL of vigorously stirred heptane to precipitate a fluffy white product. After decanting most of the heptane, the white precipitate was collected by filtration through a medium sintered glass funnel and then dried under vacuum to yield a white solid. The solid was purified by preparative HPLC (Phenomenex Gemini C18, 250 x 50 mm, 10 mm column, 0.05% ammonium hydroxide in water / CH3CN) and lyophilized to afford 3.82 g of the target compound as a yellow solid. 31 13C NMR (162 MHz, CD3CN) δ 167.1, 162.2. 1 1H NMR (400 MHz, CD3CN) δ 9.36 (br s, 1H), 8.63 (d, J = 16.51 Hz, 1H), 7.78 - 8.00 (m, 3H), 7.66 (t, J = 7.62 Hz, 1H), 7.42 - 7.57 (m, 4H), 7.24 - 7.40 (m, 7H), 6.89 (d, J = 8.68 Hz, 4H), 5.92 - 5.98 (m, 1H), 4.72 - 4.97 (m, 2H), 3.86 - 4.05 (m, 2H), 3.78 (2s, 6H), 3.27 - 3.70 (m, 3H), 2.87 - 3.20 (m, 12H), 2.67 - 2.82 (m, 2H), 1.54 - 1.79 (m, 4H).

[1040] Example 2: Oligonucleotide Synthesis

[1041] Oligonucleotides were synthesized using a MerMade 12 automated DNA synthesizer from Bioautomation. Controlled pore glass supports carrying universal linkers The synthesis was carried out on a 1 μmol scale.

[1042] In the standard cycle program for coupling DNA and LNA phosphoramidites, DMT deprotection was carried out by applying 200 μL of 3% (w / v) trichloroacetic acid in CH2Cl2 three times for 30 seconds. 100 μL of a 0.1 M solution in acetonitrile (or for LNA - MeThe C building block, as a solution in acetonitrile / CH2Cl2 1:1) and 110 μL of a 0.1 M solution of 5-(3,5-bis(trifluoromethyl)phenyl)-1H-tetrazole in acetonitrile as the activator and a coupling time of 180 seconds, the corresponding phosphoramidite was coupled three times. For thiooxidation, a 0.1 m solution of 3-amino-1,2,4-dithiazole-5-thione in acetonitrile / pyridine 1:1 (3 x 190 μL, 55 seconds) was used. Capping was carried out using THF / lutidine / Ac2O 8:1:1 (CapA, 75 μmol) and THF / N-methylimidazole 8:2 (CapB, 75 μmol) for 55 seconds.

[1043] The synthetic cycle for introducing phosphorothioamidites includes: Deprotecting DMT was applied three times with 200 μL of 3% (w / v) trichloroacetic acid in CH2Cl2 for 30 seconds each. Coupling of commercially available DNA phosphorothioamidites or freshly prepared LNA phosphorothioamidites was carried out three times using 100 μL of a 0.15 M solution in 10% (v / v) CH2Cl2 in acetonitrile and 110 μL of a 0.1 M solution of 5-(3,5-bis(trifluoromethyl)phenyl)-1H-tetrazole in acetonitrile as the activator with a coupling time of 600 seconds each time. Thiooxidation was carried out by applying a solution of 0.1 M 3-amino-1,2,4-dithiazole-5-thione in acetonitrile / pyridine three times for 55 seconds. Capping was carried out using THF / lutidine / Ac2O 8:1:1 (CapA, 75 μmol) and THF / N-methylimidazole 8:2 (CapB, 75 μmol) for 55 seconds.

[1044] Once automated synthesis was completed, removal of the nucleobase protecting groups and cleavage from the solid support were carried out using a mixture of ammonia (32%): ethanol (3:1, v:v) containing 20 mM DTT at 55 °C for 15 - 16 hours.

[1045] The crude DMT-bearing oligonucleotide was purified using a solid-phase extraction cartridge column and re-purified by ion-exchange chromatography or by RP-HPLC purification method using a C18 column, followed by removal of DMT by precipitation with 80% aqueous acetic acid and ethanol.

[1046] In the following examples, we have used the following thio-linkage chemistry

[1047]

[1048] In the following examples, unless otherwise stated, the achiral dithiophosphate linkage (also referred to as P2S) is a non-bridging dithioester (as shown in formula (IA) or (IB)) and is labeled with *. Compounds used in the examples include compounds having the following nucleobase sequences:

[1049] SEQ ID NO 1: GCATTGGTATTCA

[1050] SEQ ID NO 2: TCTCCCAGCGTGCGCCAT

[1051] SEQ ID NO 3: GAGTTACTTGCCAACT

[1052] SEQ ID NO 4: TATTTACCTGGTTGTT

[1053] SEQ ID NO 5: CAATCAGTCCTAG

[1054] The following molecules have been prepared according to the above procedure.

[1055]

[1056]

[1057] *Dithioester modification between adjacent nucleotides

[1058] A, G, m C, T represent LNA nucleotides

[1059] a, g, c, t represent DNA nucleotides

[1060] All other linkages are prepared as phosphorothioates

[1061] Example 3: In vitro efficacy experiment and cell uptake experiment

[1062] Primary rat hepatocytes were seeded in 96-well plates and treated in Williams medium E containing 10% FCS without antibiotics. The cells were treated with the LNA solution at the indicated concentrations in complete cell medium. After incubation times of 24 hours and 72 hours respectively, the cells were washed 3 times with PBS containing Ca 2+ and Mg 2+ and lysed with 165 uL of PureLink Pro lysis buffer. Total RNA was isolated using the PureLink PRO 96 RNA kit from Thermo Fisher according to the manufacturer's instructions, and RT-qPCR was performed using the LightCycler Multiplex RNA Virus Master Mix (Roche) in combination with the primer-probe set for RnApoB (Invitrogen). The data obtained were normalized to Ribogreen.

[1063] The intracellular concentration of the LNA oligonucleotides was determined using a hybridization-based ELISA assay for multiple compounds. All data points were performed in triplicate and the data are given as their mean.

[1064] Figures 1 to 4 The results are shown in

[1065] Example 4: Thermal Melting (Tm) of Oligonucleotides Containing Phosphorodithioate Internucleoside Linkages Hybridized to RNA and DNA

[1066] The following oligonucleotides were prepared. The phosphorothioate linkages are denoted by an S subscript; the phosphorodithioate linkages of the present invention are denoted by a PS2 subscript.

[1067]

[1068]

[1069] Compounds 1–6 have the sequence motif SEQ ID NO 1.

[1070] The thermal melting (Tm) of Compounds 1-6 hybridized to RNA and DNA was measured according to the following procedure.

[1071] Solutions of equimolar amounts of RNA or DNA and LNA oligonucleotide (1.5 μM) in buffer (100 mM NaCl, 0.1 mM EDTA, 10 mM Na2HPO4, pH 7) were heated to 90 °C for 1 minute and then allowed to cool to room temperature. The UV absorbance at 260 nm was recorded using a CarySeries UV-Vis spectrophotometer (heating rate: 1 °C / minute; read rate: once / minute). The absorbance was plotted against temperature and the Tm value was calculated by obtaining the first derivative of each curve.

[1072] The following table and Figure 5 summarize the results.

[1073]

[1074] Td: dissociation temperature (denaturation); Ta: binding temperature (renaturation)

[1075] The compounds of the present invention retain a high affinity for RNA and DNA controls.

[1076] Example 5: Serum Stability of Oligonucleotides Containing Phosphorodithioate Internucleoside Linkages

[1077] The stability of oligonucleotides 1-6 in serum from male Sprague-Dawling rats was measured according to the following procedure.

[1078] A 25 μM oligonucleotide solution in rat serum was mixed with nuclease buffer (30 mM sodium acetate, 1 mM zinc sulfate, 300 mM NaCl, pH 4.6) at a ratio of 3:1 and incubated at 37 °C for 0, 5, 25, 52, or 74 hours. 2 μL of the sample was injected for UPLC-MS analysis on a Waters Acquity UPLC equipped with a Waters Acquity BEH C 18 , 1.7 μm column. The percentage of uncleaved oligonucleotide was established using the analogue peak areas measured at 260 nm compensated with the extension constants for different degradation lengths.

[1079] UPLC eluents: A: 2.5% MeOH, 0.2 M HEP, 16.3 mM TEA B: 60% MeOH, 0.2 M HEP, 16.3 mM TEA

[1080]

[1081]

[1082] Figure 6 The results are summarized.

[1083] Compounds having at least one phosphorodithioate internucleoside linkage of the present invention have superior nuclease resistance compared to compounds having only phosphorothioate internucleoside linkages.

[1084] It was found that the initial oligonucleotide degradation seen after 5 hours in Compounds 1-6 was caused by the presence of monothioester impurities.

[1085] Example 7: Dithioester-modified gapmers: Exploration of dithioesters in the gap region of LNA gapmers.

[1086] Test compounds

[1087]

[1088] Experiment: The above compounds targeting ApoB mRNA were tested in primary rat hepatocytes using the gymnotic uptake method, incubated for 72 hours at a compound concentration of 2 μM. Subsequently, the target mRNA levels were measured using RT-PCR. Figure 7 The results are shown.

[1089] Figure 7 The results shown indicate that single and multiple achiral phosphorodithioates are compatible in the gap and flanking regions. Using more than 3 or 4 achiral phosphorodithioates in the gap region may tend to reduce potency compared to using multiple achiral phosphorodithioates in the flanking region.

[1090] Example 8: Position-dependence of Activity – Design Optimization

[1091] Test compound

[1092]

[1093]

[1094] Experiment: The above compounds targeting ApoB mRNA were tested in primary rat hepatocytes using the naked uptake method, incubated for 72 hours at a compound concentration of 2 μM. Subsequently, the target mRNA level was measured using RT-PCR. Figure 8 The results are shown in

[1095] Example 9: Cellular Uptake of Achiral Dithiophosphate Gapmers

[1096] Test compound

[1097]

[1098] Compounds #1-#16 and the reference have the sequence motif shown in SEQ ID NO 1.

[1099] Uppercase letters: β-D-oxy-LNA nucleosides; lowercase letters: DNA nucleosides;

[1100] * = Achiral dithiophosphate-modified linkage; all other linkages are phosphorothioates

[1101] Experiment: The above compounds targeting ApoB mRNA were tested in primary rat hepatocytes using the naked uptake method, incubated for 72 hours at a compound concentration of 2 μM. The oligonucleotide content was determined using a hybridization-based ELISA assay. Figure 9A and Figure 9B The results are shown in

[1102] Without exception, the incorporation of achiral dithiophosphate provides enhanced cellular uptake. However, depending on the position of the achiral dithiophosphate linkage, there is diversity in the uptake improvement.

[1103] Example 10: Increasing the Achiral Dithiophosphate Loading in the Flanking Regions of Gapmers

[1104] Test compounds (sequence motif = SEQ ID NO 1)

[1105]

[1106] Uppercase letters: β-D-oxy-LNA nucleosides; lowercase letters: DNA nucleosides;

[1107] * = Linkage modified with achiral dithiophosphate; all other linkages are thiophosphate

[1108] Experiment: The above compounds targeting ApoB mRNA were tested in primary rat hepatocytes using the gymnotic uptake method, incubated for 72 hours at a compound concentration of 2 μM. Subsequently, the target mRNA levels were measured using RT-PCR. Figure 10A and Figure 10B The results are shown in

[1109] Introduction of an achiral dithiophosphate modification in the flanking region of the gapmer invariably caused a significant increase in potency, with a 3–7x decrease in IC 50 Interestingly, an increase in the number of chiral dithiophosphate modifications in the flanks led to a lower IC 50 .

[1110] Example 11: Effect of Achiral Dithiophosphate Linkage In Vitro in Different Cell Types

[1111] Test compound (sequence motif = SEQ ID NO 3)

[1112]

[1113] Uppercase letters: β-D-oxy-LNA nucleosides; lowercase letters: DNA nucleosides;

[1114] * = Linkage modified with achiral dithiophosphate; all other linkages are thiophosphate

[1115] The above compounds targeting Malat-1 were tested in three in vitro cell systems: human primary skeletal muscle, human primary bronchial epithelial cells, and mouse fibroblasts (LTK cells) using gymnotic uptake for 72 hours at a series of concentrations to determine compound potency (IC 50 ).

[1116] Concentration range for LTK cells: 50 μM, 1 / 2 log dilution, 8 concentrations.

[1117] Using qPCR (normalized to GAPDH levels), the RNA levels of Malat1 were quantified and the IC 50 values were determined.

[1118] Figure 11 The IC 50 results are shown in. Introduction of an achiral dithiophosphate provided a reliable potency enhancement in skeletal muscle cells and generally gave improved potency to mouse fibroblasts. The effect in human bronchial epithelial cells was more compound-specific; however, some compounds (#5) were significantly more potent than the reference compound.

[1119] Example 12: In vitro serum stability of 5' and 3'-end protected LNA oligonucleotides in rats.

[1120] Test compound (sequence motif = SEQ ID NO 1)

[1121]

[1122]

[1123] Uppercase letters: β-D-oxy-LNA nucleosides; lowercase letters: DNA nucleosides;

[1124] * = achiral phosphorodithioate-modified linkage; all other linkages are phosphorothioates

[1125] Experiment – see Example 5.

[1126] Figure 12 Results are shown. We determined that the 3'-end of LNA phosphorothioate oligonucleotides is more susceptible to serum nucleases than previously thought, and this appears to be related to the chirality of the phosphorothioate linkages at the 3'-end of the oligonucleotide – as shown by the rapid cleavage of 50% of the parent oligonucleotide #1. 5'-end protection with achiral phosphorodithioates provided improved protection. 3'-end protection with achiral phosphorodithioates provided complete protection against rat serum exonucleases – the slight reduction seen for compounds #4-#8 was associated with monothioester impurities.

[1127] Therefore, 5' and / or 3'-end protection of antisense oligonucleotides with achiral phosphorothioate linkages is considered to provide a solution to the significant instability problems associated with both racemic and defined phosphorothioates.

[1128] Example 13: In vivo evaluation of gapmers with achiral phosphorodithioate linkages in the flanks.

[1129] Test compound (sequence motif = SEQ ID NO 1)

[1130]

[1131]

[1132] Uppercase letters: β-D-oxy-LNA nucleosides; lowercase letters: DNA nucleosides;

[1133] * = achiral dithiophosphate-modified linkage; all other linkages are thiophosphates. Note that the underlined bold nucleosides are linked at the 3'-position by a stereodefined thiophosphate internucleoside linkage. Compound #7 has a stereodefined motif (S = Sp, R = Rp) in the gap region of SSRSSRSR. The backbone motif of compound #9 = RRSPRSSPSPSS, where S = Sp, R = Rp, and P = achiral PS2 linkage (*).

[1134] Experiment: The above compounds targeting ApoB were administered to female C57BL / 6JBom mice by a single intravenous dose of 1 mg / kg, and the mice were sacrificed on day 7, n = 5. Reduced mRNA in the liver was measured using RT-PCR and Figure 13 the results are shown in.

[1135] The results showed that overall, the introduction of an achiral dithiophosphate internucleoside linkage provided improved potency, and notably, all compounds with an achiral dithiophosphate linkage in the flanking region showed improved potency. As illustrated in in vitro experiments, the use of multiple dithiophosphate linkages (#8) in the gap region was tolerated with no significant loss of potency. Of particular significance was the combined effect of the gapmer design with stereodefined thiophosphate linkages in the gap region and achiral dithiophosphate linkages in the flanks, which demonstrated the synergy of these linkage technologies in combination with antisense oligonucleotides.

[1136] Example 14: In vivo tissue content of gapmers with achiral dithiophosphates having modified flanking and gap regions in the liver.

[1137] Compounds and experiments – See Example 13. Figure 14A and the results of tissue content are shown in A and B (determined by hybridization-based ELISA to measure the content in liver and kidney samples from sacrificed animals). Note the experimental error for compound #1 – See Figure 14B the data.

[1138] Results: Figure 14A As compared to the reference compound, all antisense oligonucleotides containing an achiral dithiophosphate linkage had higher tissue uptake / content. Figure 14B The introduction of an achiral dithiophosphate linkage was shown to enhance the biodistribution of all tested compounds (as determined by the liver / kidney ratio).

[1139] Example 15: Metabolite analysis from in vivo experiments

[1140] Compounds and experiments – See Example 13. Metabolite analysis was performed using the method disclosed in C. Husser et al., Anal. Chem. 2017, 89, 6821.

[1141] Figure 15A and 15B The results are shown in 15B . The phosphorodithioate modification effectively prevents 3'-exonuclease degradation in vivo. Some endonuclease cleavage still occurs (note that test compounds #1-6 all have DNA phosphorothioate gap regions and thus this is expected). Given the significant exonuclease protection, it is believed that the use of achiral phosphorodithioate linkages within antisense oligonucleotides can be used to prevent or limit endonuclease cleavage. The enhanced nuclease resistance of achiral phosphorodithioates is expected to provide significant pharmacological benefits such as enhanced activity and extended duration of action, and may avoid toxic degradation products.

[1142] Example 16: In Vivo - Long-Term Liver Activity (ApoB)

[1143] Test compounds (sequence motif = SEQ ID NO 1):

[1144]

[1145]

[1146] Uppercase letters: β-D-oxy-LNA nucleosides; lowercase letters: DNA nucleosides;

[1147] * = achiral phosphorodithioate-modified linkage; all other linkages are phosphorothioates. Note that the underlined bold nucleosides are linked at the 3'-position by a stereodefined phosphorothioate internucleoside linkage. Compound #3 has a stereodefined motif (S = Sp, R = Rp) in the gap region of SSRSSRSR. The backbone motif of compound #2 = RRSSRSSRSRSS, where S = Sp, R = Rp, and P = achiral PS2 linkage (*).

[1148] Experiment: As in Example 13, but sacrificed on day 7 or day 21.

[1149] Figure 16 The results are shown in Figure 16 . The introduction of achiral phosphorodithioates provides an extended duration of action in the liver compared to the phosphorothioate reference compound, and this is associated with a higher tissue content at day 21. Notably, the combination of the flanking regions of the phosphorodithioate linkages with the stereodefined phosphorothioate linkages in the gap region provides further benefits in terms of extended potency and duration of action, again highlighting the significant synergistic effect of the combination of achiral phosphorodithioate internucleoside linkages and stereodefined phosphorothioate linkages in antisense oligonucleotides.

[1150] Example 17: In vivo study using a gapmer modified with achiral phosphorodithioate targeting Malat-1.

[1151] Test compound (sequence motif = SEQ ID NO 3)

[1152]

[1153] Uppercase letters: β-D-oxy-LNA nucleosides; lowercase letters: DNA nucleosides;

[1154] * = achiral phosphorodithioate-modified linkage; all other linkages are phosphorothioates.

[1155] Experiment:

[1156] In vitro: Mouse LTK cells were used to determine the in vitro concentration–dose response curve – MALAT-1 mRNA inhibition was measured.

[1157] In vivo: On days 1, 2, and 3, a dose of 15 mg / kg of the oligonucleotide (n = 5) was administered subcutaneously to mice (C57 / BL6) in three doses. The mice were sacrificed on day 8, and the reduction of MALAT-1 RNA and tissue content in the liver, heart, kidney, spleen, and lung were measured. The parent compound was administered in two doses: 3 * 15 mg / kg and 3 * 30 mg / kg.

[1158] Results: The in vitro results are shown in Figure 17 – compounds with 1, 2, 3, and 4 achiral phosphorodithioates in the flanks were found to be highly effective in vitro. The compound #7 with 5 achiral phosphorodithioates in the flanks was found to be less potent compared to those compounds with 1–4 achiral phosphorodithioates i...

Claims

1. An oligonucleotide comprising at least one phosphorothioate internucleoside linkage of formula (IA) or (IB) One of the two oxygen atoms is linked to the 3'-carbon atom of the adjacent nucleoside A 1 and the other oxygen atom is linked to the 5'-carbon atom of another adjacent nucleoside A 2 wherein at least one of the two nucleosides A 1 and A 2 is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation; wherein the oligonucleotide comprises a nicked polymer region of formula 5'-F-G-F'-3', wherein G is a region of 5 to 18 nucleosides capable of recruiting RNase H, and said region G is flanked on the 5' and 3' sides by flanking regions F and F' respectively, wherein regions F and F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, and the nucleoside of region F adjacent to region G is a 2'-sugar modified nucleoside and the nucleoside of region F' adjacent to region G is a 2'-sugar modified nucleoside; wherein the oligonucleotide comprises 1 to 5 internucleoside linkages of formula (IA) or (IB), and wherein the other internucleoside linkages are all phosphorothioate internucleoside linkages.

2. The oligonucleotide according to claim 1, wherein M+ is a metal cation, or M+ is an ammonium cation.

3. The oligonucleotide according to claim 2, wherein M+ is an alkali metal cation.

4. The oligonucleotide according to claim 3, wherein M+ is a Na+ or K+ cation.

5. The oligonucleotide according to claim 1, wherein the oligonucleotide comprises 1 to 4 internucleoside linkages of formula (IA) or (IB).

6. The oligonucleotide according to any one of claims 1-5, wherein said region G consists of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive DNA nucleosides, region F has a length of 2-6 consecutive nucleotides, and region F' has a length of 3-6 consecutive nucleotides.

7. The oligonucleotide according to claim 6, wherein said G consists of 6, 7, 8, 9, 10, 11, 12, 13 or 14 consecutive DNA nucleosides, region F has a length of 3-4 consecutive nucleotides, and region F' has a length of 4-5 consecutive nucleotides.

8. The oligonucleotide according to any one of claims 1-7, wherein one of A 1 and A 2 is a LNA nucleoside and the other is a DNA nucleoside, an RNA nucleoside or a 2'-sugar modified nucleoside.

9. The oligonucleotide according to any one of claims 1-8, wherein A 1 and A 2 one of them is an LNA nucleoside and the other is a DNA nucleoside or a 2'-sugar modified nucleoside.

10. The oligonucleotide according to any one of claims 1-9, wherein one of A 1 and A 2 is an LNA nucleoside and the other is a DNA nucleoside.

11. The oligonucleotide according to any one of claims 1-9, wherein one of A 1 and A 2 is a LNA nucleoside and the other is a 2'-sugar modified nucleoside.

12. The oligonucleotide according to any one of claims 8-11, wherein said 2'-sugar modified nucleoside is 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleoside.

13. The oligonucleotide according to any one of claims 8-12, wherein said 2'-sugar modified nucleoside is an LNA nucleoside.

14. The oligonucleotide according to any one of claims 1-13, wherein the LNA nucleosides are independently selected from β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA and ENA.

15. The oligonucleotide according to claim 13 or 14, wherein the LNA nucleosides are all β-D-oxy-LNA.

16. The oligonucleotide according to claim 12, wherein said 2'-sugar modified nucleoside is 2'-alkoxyalkoxy-RNA.

17. The oligonucleotide according to claim 12, wherein 2'-alkoxy-RNA is 2'-methoxy-RNA.

18. The oligonucleotide according to claim 12 or 16, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA.

19. The oligonucleotide according to any one of claims 1-18, wherein the oligonucleotide has a length of 7 to 30 nucleotides.

20. The oligonucleotide according to any one of claims 1-19, wherein one or more nucleosides are nucleobase-modified nucleosides.

21. The oligonucleotide according to any one of claims 1-20, wherein the oligonucleotide is an antisense oligonucleotide, siRNA or ribozyme.

22. The oligonucleotide according to claims 1-20, wherein all of the nucleosides in region F or region F', or all of the nucleosides in region F and region F' are LNA nucleosides.

23. The oligonucleotide according to claims 1-22, wherein the oligonucleotide is an antisense gapmer oligonucleotide for inhibiting target RNA in cells.

24. A pharmaceutically acceptable salt of the oligonucleotide according to any one of claims 1-23.

25. The pharmaceutically acceptable salt of the oligonucleotide according to claim 24, which is a sodium salt or a potassium salt or an ammonium salt.

26. A conjugate comprising the oligonucleotide or pharmaceutically acceptable salt according to any one of claims 1-25 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt.

27. The conjugate according to claim 26, which comprises the oligonucleotide or pharmaceutically acceptable salt according to any one of claims 1-25 and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt via a linker moiety.

28. A pharmaceutical composition comprising the oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of claims 1-27 and a therapeutically inert carrier.

29. The oligonucleotide, pharmaceutically acceptable salt or conjugate according to any one of claims 1-27 for use as a therapeutically active substance.

30. A method for manufacturing the oligonucleotide according to any one of claims 1-23, the method comprising the following steps: (a) coupling a phosphorothioamidite nucleoside to the terminal 5'-oxygen atom of a nucleotide or oligonucleotide to produce a phosphorothioate triester intermediate; and (b) sulfurizing the phosphorothioate triester intermediate obtained in step (a).

31. The method according to claim 30, the method further comprising the following steps: (c) further extending the oligonucleotide.

32. The oligonucleotide prepared by the method according to claim 30 or 31.

Images