Antibody library and antibody screening method using the antibody library

Abstract

The present invention relates to a novel antibody library and an antibody screening method using the novel antibody library. The antibody library according to the present invention having a specific VH or VL scaffold derived from a human sequence exhibits high thermodynamic stability and has the advantages of allowing high soluble expression and reversible folding. In addition, the antibody according to the present invention comprises a variety of rationally controlled CDRs to exhibit high specificity and high affinity for all antigens, and can therefore be advantageously used to select appropriate candidate antibodies for target antigens.

Description

Technical Field

[0001] The present invention relates to a novel antibody library and an antibody screening method using the antibody library, wherein the antibody library according to the present invention has certain VH or VL scaffolds derived from human sequences, and thus has the advantages of exhibiting high thermodynamic stability and achieving high soluble expression and reversible folding.

[0002] In addition, the antibody library according to the present invention contains a variety of CDRs that are rationally controlled to have high specificity and high affinity for all antigens and can thus be used to select candidate antibodies. Background Art

[0003] Antibodies are proteins produced by stimulating antigens in B cells (B lymphocytes), white blood cells in the immune system. When an antibody encounters an antigen, it recognizes the antigen through receptors present in the cell and binds to the antigen using the receptors. Such antibodies are considered as candidates for new protein drugs for treating diseases, and a variety of antibody libraries are generated and antibodies are screened from the antibody libraries to find the functional antibodies of interest.

[0004] This antibody library uses genetic recombination technology. Genes encoding antibody proteins are extracted from B cells present in the human body to produce antibody gene libraries, and antibodies with desired antigen binding specificity are selected from these libraries. Antibody library technology has revolutionized the production of antibodies (such as human antibodies). The most prominent feature of the antibody immune response is that no matter what the type or shape of the external antigen invading the body is, if the antigen is a foreign substance different from the components in the body, antibodies that specifically bind to the antigen will be produced within a week.

[0005] Antibodies are produced by B lymphocytes, and one B lymphocyte produces only one type of antibody. In fact, there are many types of B lymphocytes in the human body, each type of B lymphocyte expresses antibodies with its own unique antigen binding specificity on the cell membrane, and it is known that there are about 108 antigen binding diversity in the human body. When an antigen invades, only B lymphocytes expressing antibodies that specifically bind to the antigen proliferate rapidly and produce a large number of antibodies. As a result, the concentration of this specific antibody in the serum increases rapidly, and performs the function of quickly removing the invading antigen. Therefore, there are hundreds of millions of antibody diversity in the human body, and this antibody diversity is called "antibody library".

[0006] Therefore, a sufficient number of B lymphocytes are obtained from the human body by blood sampling, mRNA is isolated from these cells, and then the cDNA encoding the heavy chain and light chain variable region of the antibody is obtained by RT-PCR (reverse transcription polymerase chain reaction). As a result, the antibody library in the human body can be obtained in vitro in the form of gene in a relatively simple manner. The core of antibody library technology is that this human antibody gene library is expressed (or displayed) as protein, and the gene encoding the antibody protein is connected by any means, i.e., so-called genotype-phenotype connection, and on this basis, the antibody combined with the specific antigen is selected from the antibody library, and the gene encoding the specific antibody is obtained simultaneously.

[0007] Here, complete immunization is not required, and the Fab form of an antibody having an antigen binding function is expressed, or an antibody fragment called "scFv (single chain variable fragment)" is expressed, in which the heavy chain and light chain variable domains (VH and VL) are connected by a short peptide linker of about 15 amino acids. In this case, the antibody library technology is divided into phage display, ribosome display, yeast display, etc. according to the medium with a surface, and the antibody is expressed on the surface of the medium for genotype-phenotype connection, and an antibody with a desired antigen binding property can be obtained without inducing an immune response (such as antigen administration).

[0008] However, the disadvantages are that antibody library production and antibody screening require a lot of expertise, and because it is difficult to obtain high-affinity antibodies, antibody optimization processes (such as affinity maturation) are often performed after antibody screening, and disadvantageously, functional analysis cannot be performed directly in mammalian cells due to problems such as toxicity during the initial screening. In the case of therapeutic antibodies, antibodies that do not simply bind to the antigen but have actual therapeutic functions should be selected, and therefore this disadvantage has become an obstacle to the development of therapeutic antibodies.

[0009] Phage display antibody libraries are the most widely used antibody libraries. In fact, the currently commercially available Humira (anti-TNF-α human monoclonal antibody) is a therapeutic antibody produced using phage display technology. An ideal antibody library exhibits a wide range of antibody diversity and enables the ready availability of high-affinity antibody clones with the desired antigen binding specificity. For this purpose, a library with about 10 10 to about 10 11 However, it is difficult to generate a library of this size by antibody gene cloning, and this is the most difficult challenge in generating phage display antibody libraries. In addition, there is the disadvantage that the phage itself acts as a toxin, so functional analysis cannot be performed immediately.

[0010] The biggest advantage of ribosome display is that it is a cell-free system and therefore can easily generate libraries large enough to theoretically generate libraries of size 10 13 This is beneficial for obtaining high-affinity antibodies (generally, as the size of the antibody library increases, the probability of containing high-affinity antibodies in the library also increases), and because of the PCR amplification process, error-prone polymerases can be used, so it is very simple to introduce mutations to artificially induce molecular evolution. However, due to toxicity issues and various experimental problems, in fact, phage display technology is mainly used to generate natural antibody libraries.

[0011] Due to the process of inserting the recombinant vector into the S. cerevisiae strain and the large size of the yeast cell, yeast display technology is very useful for constructing proteins with 10 9 There are many technical limitations in the construction of antibody libraries with higher diversity. Therefore, it is mainly used to construct mutant libraries of antigen-specific antibodies that have been ensured by taking advantage of the selection process, and to select high-affinity antibodies from the library.

[0012] Among them, phage display is a technology for screening antibodies by expressing antibody fragments on the surface of bacterial phages, and has the advantage of identifying antigen-specific antibodies in a short time compared to conventionally developed antibody technologies (using hybridomas to develop chimeric / humanized antibodies or using transgenic mice to develop antibodies). The disadvantage of phage display is that effective antibodies can only be identified when a highly diverse library is ensured. However, the recent development of gene amplification and cloning technology has solved the problem of ensuring large libraries.

[0013] Compared with the natural library based on human genes, synthetic antibody library refers to the antibody library that is endowed with diversity by introducing random synthetic sequences into the complementary determining region (CDR) of antibody. However, compared with the natural human library, due to the influence of mutation or frameshift, synthetic antibody library has a lower proportion of normally functioning antibody fragments. In recent years, the strategy of identifying novel target antigens using antibody library has become diversified, and representatively, primary cells derived from tumors have been used to identify novel antigen-specific antibodies by cell panning (Zhu X. et al., Mol. Cancer Res. 2010).

[0014] As described above, phage display is an efficient method strategy because of the possibility of various method strategies that can ensure continuous antibody candidates and antibodies can be produced by cloning. Candidate antibody drugs targeting various types of cancer identified using this phage display technology are in clinical trials. In order to identify the desired antibodies to utilize phage display technology, it is necessary to generate a library from the antibody variable region gene, and the construction of various libraries is essential.

[0015] Although various antibody libraries are currently under development, there is an increasing demand for antibody libraries capable of selecting antibodies with high specificity and high affinity for various antigens because the antibody libraries have high thermodynamic stability, enable high soluble expression, and have high diversity.

[0016] Under this technical background, as a result of great efforts, the inventors found that when a common sequence is extracted from cDNA of Asian and Caucasian races and an antibody library based on a combination of specific VH and / or VL scaffolds is used based on the common sequence, the selected antibody has high thermodynamic stability and can achieve high soluble expression and reversible folding. Based on this discovery, the present invention has been completed.

[0017] In addition, the antibody library according to the present invention contains a variety of CDRs that are rationally controlled and designed to have high specificity and high affinity for all antigens, thereby exhibiting excellent diversity and lower repeat sequence ratios compared to natural antibody libraries, and can be effectively used to select suitable candidate antibodies against target antigens.

[0018] The information disclosed in this Background section is only provided for better understanding of the background of the invention and therefore it may not contain information that forms the prior art that is already clear to a person skilled in the art. Summary of the invention

[0019] Therefore, the present invention has been completed in view of the above problems, and an object of the present invention is to provide an antibody library for screening human antibodies that can be effectively used for treating or diagnosing diseases, and a method for screening antibodies using the antibody library.

[0020] According to one aspect of the present invention, the above and other objects can be achieved by providing a collection of antibodies or fragments thereof, wherein each antibody or fragment thereof comprises a heavy chain variable region and a light chain variable region pair, wherein the heavy chain variable region comprises a framework region contained in a heavy chain variable region selected from VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) and VH1-69 (SEQ ID NO: 11); and a combination of a heavy chain complementary determining region 1 (CDRH1), a heavy chain complementary determining region 2 (CDRH2) and a heavy chain complementary determining region 3 (CDRH3) that are different for each heavy chain variable region; and the light chain variable region comprises a framework region contained in a heavy chain variable region selected from Vκ1-39 (SEQ ID NO: 16), Vκ3-20 (SEQ ID NO: 21), Vκ3-20-2 (SEQ ID NO: 26) and Vλ1-51 (SEQ ID NO: 17). NO:31); and a combination of a light chain complementary determining region 1 (CDRL1), a light chain complementary determining region 2 (CDRL2), and a light chain complementary determining region 3 (CDRL3) that is different for each light chain variable region.

[0021] Nucleic acids encoding individual antibodies or fragments thereof contained in the collection of antibodies or fragments thereof are individually contained in separate phages or host cells, and the antibodies or fragments thereof are preferably each expressed on the surface of the phage or host cell, but the present invention is not limited thereto.

[0022] According to another aspect of the present invention, a nucleic acid encoding the antibody or fragment thereof is provided. The nucleic acid encoding the antibody or fragment thereof is preferably contained in separate phages or host cells, but the present invention is not limited thereto.

[0023] According to another aspect of the present invention, a method for identifying antibodies or fragments thereof specific for an antigen is provided, the method comprising: (a) contacting the antigen with the antibody collection, and (b) selecting one or more antibodies or antibody fragments that bind to the antigen. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is a schematic diagram showing the process of constructing a library vector according to the present invention.

[0025] Figure 2 is a diagram showing the distribution of amino acids at different positions of the heavy chain complementarity determining region (CDRH3) of the library constructed in an embodiment of the present invention.

[0026] Figure 3 It is a graph showing the analysis results of the ratio of repeated sequences of the library sequences constructed in the embodiment of the present invention.

[0027] Figure 4 Shown are the results of analyzing the distribution of the lengths of the heavy chain complementarity determining region (CDRH3) of the library constructed in the embodiment of the present invention. DETAILED DESCRIPTION

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as understood by those skilled in the art to which the invention belongs. Generally speaking, the terms used herein are those well known and commonly used in the art.

[0029] In the present invention, it was found that when the antibody library was constructed using trimer codons to ensure that the VH and VL clones had framework regions with high stability, minimized post-translational modifications (PTMs), and only accurately synthesized amino acids that minimized immunogenicity, an antibody library with high diversity and high stability could be constructed.

[0030] That is, in one embodiment of the present invention, VH1 and VH3 genes of the heavy chain variable region and Vκ1, Vκ3 and Vλ1 genes of the light chain variable region are obtained from the human variable region of Asian and Caucasian cDNA, and the combination of amino acids of the complementary determining region (CDR) contained in the human antibody variable region is analyzed, and in particular, the heavy chain complementary determining region 3 (CDRH3) each having a length of 9-14 is analyzed. The amino acid combinations of the Asian and Caucasian variable regions obtained after the analysis showed similarity, no significant difference, and the average value of the fixed Asian and Caucasian combination was calculated, and then reflected in the library primer design. In the case of the heavy chain complementary determining region 2 (CDRH2), it was found that the probability of the occurrence of N-glycosylation sites was 5% due to the NXS / T amino acids in the analyzed combination, and the probability of the occurrence of N-glycosylation sites was adjusted to 1% or less to prevent PTM from inhibiting antibody binding ability and stability in the future. By the above method, primers for constructing a library with high diversity were designed. As a result of constructing a Fab library based on the primers, a Fab library with 1.54×10 11 The diversity of the library ( Figure 1 ).

[0031] In one aspect, the present invention relates to a collection of antibodies or fragments thereof, wherein each antibody or fragment thereof comprises a heavy chain variable region and a light chain variable region pair, wherein the heavy chain variable region comprises a framework region contained in a heavy chain variable region selected from the group consisting of VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) and VH1-69 (SEQ ID NO: 11); and a combination of a heavy chain complementary determining region 1 (CDRH1), a heavy chain complementary determining region 2 (CDRH2) and a heavy chain complementary determining region 3 (CDRH3) that are different for each heavy chain variable region; and the light chain variable region comprises a framework region contained in a heavy chain variable region selected from the group consisting of Vκ1-39 (SEQ ID NO: 16), Vκ3-20 (SEQ ID NO: 21), Vκ3-20-2 (SEQ ID NO: 26) and Vλ1-51 (SEQ ID NO: 17). NO:31); and a combination of a light chain complementary determining region 1 (CDRL1), a light chain complementary determining region 2 (CDRL2), and a light chain complementary determining region 3 (CDRL3) that is different for each light chain variable region.

[0032] Preferably, the collection of antibodies or fragments thereof according to the present invention comprises:

[0033] A framework region, the framework region is contained in a VH3-15 (SEQ ID NO: 1) / Vκ1-39 (SEQ ID NO: 16), VH3-15 (SEQ ID NO: 1) / Vκ3-20 (SEQ ID NO: 21), VH3-15 (SEQ ID NO: 1) / Vκ3-20-2 (SEQ ID NO: 26), VH3-15 (SEQ ID NO: 1) / Vλ1-51 (SEQ ID NO: 31), VH3-23 (SEQ ID NO: 6) / Vκ1-39 (SEQ ID NO: 16), VH3-23 (SEQ ID NO: 6) / Vκ3-20 (SEQ ID NO: 21), VH3-23 (SEQ ID NO: 6) / Vκ3-20-2 (SEQ ID NO: 26), VH3-23 (SEQ ID NO: 6) / Vλ1-51 (SEQ ID NO: 31), VH1-6 ... The heavy and light chain variable region pairs of VH1-69 (SEQ ID NO: 11) / Vκ1-39 (SEQ ID NO: 16), VH1-69 (SEQ ID NO: 11) / Vκ3-20 (SEQ ID NO: 21), VH1-69 (SEQ ID NO: 11) / Vκ3-20-2 (SEQ ID NO: 26), and VH1-69 (SEQ ID NO: 11) / Vλ1-51 (SEQ ID NO: 31), and

[0034] The combination of CDRH1, CDRH2 and CDRH3 is different for each heavy chain variable region and the combination of CDRL1, CDRL2 and CDRL3 is different for each light chain variable region.

[0035] In addition, in the collection of antibodies or fragments thereof according to the present invention,

[0036] The framework region in the heavy chain variable region having the sequence VH3-15 (SEQ ID NO: 1) comprises FR1 (SEQ ID NO: 2), FR2 (SEQ ID NO: 3), FR3 (SEQ ID NO: 4) and FR4 (SEQ ID NO: 5),

[0037] The framework region in the heavy chain variable region having the sequence VH3-23 (SEQ ID NO:6) comprises FR1 (SEQ ID NO:7), FR2 (SEQ ID NO:8), FR3 (SEQ ID NO:9) and FR4 (SEQ ID NO:10),

[0038] The framework region in the heavy chain variable region having the sequence VH1-69 (SEQ ID NO: 11) comprises FR1 (SEQ ID NO: 12), FR2 (SEQ ID NO: 13), FR3 (SEQ ID NO: 14) and FR4 (SEQ ID NO: 15),

[0039] The framework region in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) comprises FR1 (SEQ ID NO: 17), FR2 (SEQ ID NO: 18), FR3 (SEQ ID NO: 19) and FR4 (SEQ ID NO: 20),

[0040] The framework region in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO:21) comprises FR1 (SEQ ID NO:22), FR2 (SEQ ID NO:23), FR3 (SEQ ID NO:24) and FR4 (SEQ ID NO:25),

[0041] The framework region in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) comprises FR1 (SEQ ID NO: 27), FR2 (SEQ ID NO: 28), FR3 (SEQ ID NO: 29) and FR4 (SEQ ID NO: 30), and

[0042] The framework region in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO:31) includes FR1 (SEQ ID NO:32), FR2 (SEQ ID NO:33), FR3 (SEQ ID NO:34) and FR4 (SEQ ID NO:35).

[0043] The antibody or fragment thereof may be characterized in that the complementarity determining region (CDR) comprised in each variable region of the pair of the heavy chain variable region and the light chain variable region is designed to prevent post-translational modification (PTM) by changing amino acids with potential for post-translational modification (PTM).

[0044] In particular, with regard to the CDR sequences comprised in the collection of antibodies or fragments thereof according to the present invention,

[0045] The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1) include the ranges of Table 3,

[0046] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1) include the ranges of Table 4,

[0047] The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH3-23 (SEQ ID NO:6) include the ranges of Table 3,

[0048] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH3-23 (SEQ ID NO: 6) include the ranges of Table 4,

[0049] The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH1-69 (SEQ ID NO: 11) include the ranges of Table 5,

[0050] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH1-69 (SEQ ID NO: 11) include the ranges of Table 6,

[0051] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 9 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 7,

[0052] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 10 amino acids, the amino acid ratios at each position in the CDRH3 include the range of Table 8,

[0053] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 11 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 9,

[0054] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 12 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 10,

[0055] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 13 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 11,

[0056] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 14 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 12,

[0057] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 13,

[0058] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 14,

[0059] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 15,

[0060] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 16,

[0061] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 17,

[0062] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 18,

[0063] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 19,

[0064] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 17,

[0065] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 18,

[0066] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 20,

[0067] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 21, and

[0068] The amino acid ratios at each position in the light chain complementarity determining region 3 (CDRL3) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 22.

[0069] In particular, the collection of antibodies or fragments thereof according to the present invention have one or more characteristics selected from the following i) to iv):

[0070] i) 10% or less redundancy (percentage of repeated sequences);

[0071] ii) p value of CDR composition>0.05;

[0072] iii) thermal stability of 70°C or higher; and

[0073] iv)10 7 or higher diversity (library size).

[0074] As used herein, the term "antibody" means an immunoglobulin selected from IgA, IgE, IgM, IgD, IgY and IgG and capable of specific binding to a target antigen. It consists of two light chains and two heavy chains, and each chain comprises a variable domain with a variable amino acid sequence and a constant domain with a constant amino acid sequence. The antigen binding site is located at the end of the three-dimensional structure of the variable domain, and this site is formed by combining the three complementary determining regions present in each light chain and heavy chain. The complementary determining region is a part with particularly high variability in the amino acid sequence between the variable domains, and due to this high variability, antibodies specific to various antigens can be found. The scope of the present invention includes not only complete antibody forms, but also antigen-binding fragments of antibody molecules.

[0075] The term "complete antibody" refers to a structure with two full-length light chains and two full-length heavy chains, wherein each light chain is connected to the corresponding heavy chain by a disulfide bond. The heavy chain constant domain has gamma (γ), muon (μ), alpha (α), delta (δ) and epsilon (ε) types, and is divided into the following subclasses: gamma 1 (γ1), gamma 2 (γ2), gamma 3 (γ3), gamma 4 (γ4), alpha 1 (α1) and alpha 2 (α2). The constant domain of the light chain has kappa (κ) and lambda (λ) types.

[0076] The term "antigen-binding fragment" according to the present invention refers to an antibody fragment having the ability to bind to an antigen, and includes Fab, Fab', F(ab')2, scFv(scFv)2, scFv-Fc, Fv, etc. In this specification, the term "antigen-binding fragment" can be used interchangeably with "antibody fragment" and has the same meaning.

[0077] Among these antibody fragments, Fab refers to a structure comprising the variable domains of each of the heavy and light chains, the constant domain of the light chain, and the first constant domain (CH1) of the heavy chain, each Fab having one antigen binding site. Fab' differs from Fab in that it also comprises a hinge region comprising at least one cysteine ​​residue at the C-terminus of the heavy chain CH1 domain. F(ab')2 is produced by disulfide bonds between the cysteine ​​residues in the Fab' hinge region. Fv is the smallest antibody fragment having only a heavy chain variable domain and a light chain variable domain, and recombinant techniques for producing Fv are disclosed in PCT international publications, such as WO 88 / 10649, WO 88 / 106630, WO 88 / 07085, WO 88 / 07086, and WO 88 / 09344. A two-chain Fv is a fragment in which a heavy chain variable domain and a light chain variable domain are linked by a non-covalent bond, and a single-chain Fv (scFv) is a fragment in which a heavy chain variable domain and a light chain variable domain are usually linked by a covalent bond via a peptide linker therebetween, or directly linked at the C-terminus, forming a dimer-like structure like a two-chain Fv. Antibody fragments can be obtained using proteases (e.g., Fab can be obtained by limited cleavage of an intact antibody with papain, and F(ab')2 fragments can be obtained by limited cleavage of an intact antibody with pepsin), and can be produced using genetic recombination techniques.

[0078] As used herein, the term "ScFv" (single-chain Fv, single-chain fragment antibody or antibody fragment) refers to an antibody in which the variable domains of the light chain and the heavy chain are connected. In some cases, the ScFv may include a linker (connection site) consisting of a peptide chain with about 15 connected amino acids, and in this case, the ScFv may have a structure comprising a light chain variable domain, a connection site and a heavy chain variable domain, or a structure comprising a heavy chain variable domain, a connection site and a heavy chain variable domain, and has the same or similar antigenic specificity as the original antibody.

[0079] As used herein, the term "antibody library" refers to a combination of a plurality of antibodies having different sequences, and in the present invention means a collection of combinations of specific heavy chain variable region and light chain variable region pairs.

[0080] Nucleic acids encoding each antibody or fragment thereof contained in the antibody library are individually contained in separate phages or host cells, and the antibodies or fragments thereof are preferably each expressed (displayed) on the surface of the phage or host cell, but the present invention is not limited thereto.

[0081] Examples of host cells used for surface expression (display) of the antibody or fragment thereof according to the present invention include yeasts such as Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, and human and mouse B cells, but are not limited thereto.

[0082] Depending on the type of antibodies or fragments thereof expressed on the surface of the phage or host cell, the library according to the invention may be called a "Fab library" or a "scFv library".

[0083] In addition, as used herein, the term "antibody library" means not only the combination of specific heavy chain variable region and light chain variable region pairs at the protein level, but also means the combination at the gene level encoding each specific heavy chain variable region and light chain variable region pair.

[0084] In order to separate the antibody that has specificity to antigen from the antibody library, very high diversity is required, and the library consisting of different antibody clones is constructed and used. The antibody gene constituting this antibody library can be cloned into, for example, a phagemid vector and transformed into a transformant (host cell, such as Escherichia coli).

[0085] As used herein, the term "nucleic acid" may be used interchangeably with "gene" or "nucleotide", and may be, for example, selected from natural / synthetic DNA, genomic DNA, natural / synthetic RNA, cDNA and cRNA, but is not limited thereto.

[0086] As used herein, the term "phagemid" vector refers to a plasmid DNA used for phage display and having a phage replication origin, and generally has an antibiotic resistance gene as a selection marker. The phagemid vector used for phage display comprises the gIII gene of M13 phage or a portion thereof, and the ScFv gene is linked to the 5' end of the gIII gene and expressed by a transformant.

[0087] As used herein, the term "helper phage" refers to a phage that provides necessary genetic information so that phagemid is packaged into phage particles. Since only gIII or a portion of the phage gene is present in the phagemid, the host cell (transformant) transformed with the phagemid is infected by the helper phage, thereby providing the remaining phage genes. There are types (such as M13K07 or VCSM13), and most of them include antibiotic resistance genes (such as kanamycin), thereby the transformant infected with the helper phage can be selected. In addition, because the packaging signal is defective, the phagemid gene rather than the helper phage gene is selectively packaged into the phage particle.

[0088] As used herein, the term "signal sequence" refers to a base sequence or an amino acid sequence corresponding thereto, which is located at the 5' end of a gene and functions as an essential signal when a protein encoded from the gene is secreted to the outside.

[0089] As used herein, "phage display" is a technique for displaying mutant polypeptides as fusion proteins with at least a portion of a coat protein on the surface of, for example, a phage (e.g., a fibrous phage) particle. The usefulness of phage display is that sequences that bind to a target antigen with high affinity are quickly and efficiently sorted in large libraries of randomized protein mutants. Display of peptide and protein libraries on phage has been used to screen millions of polypeptides to identify polypeptides with specific binding properties.

[0090] Phage display technology has provided an effective tool for producing and screening novel proteins combined with specific ligands (e.g., antigens). Using phage display technology, large protein mutant libraries can be produced, and sequences that bind to target antigens with high affinity can be rapidly classified. Nucleic acid encoding mutant polypeptides is fused to the nucleic acid sequence encoding viral coat protein (e.g., gene III or gene VIII protein). A single-phase phage display system has been developed, in which the nucleic acid sequence encoding a protein or polypeptide is fused to the nucleic acid sequence encoding a part of gene III protein. In a single-phase display system, the fusion gene is expressed at a low level, and wild-type gene III protein is also expressed, and particle infectivity is maintained thus.

[0091] For the development of antibody phage display libraries, it is important to demonstrate the expression of peptides on the surface of fibrous phages and the expression of functional antibody fragments in the peripheral cytoplasm of E. coli. Libraries of antibody-binding polypeptides or antigen-binding polypeptides are prepared by a variety of methods (e.g., by inserting random DNA sequences or cloning related gene sequences to modify a single gene). Libraries can be screened for the expression of antibody-binding proteins or antigen-binding proteins with desired characteristics.

[0092] Phage display technology has several advantages over conventional hybridoma and recombinant methods for producing antibodies with desired characteristics. This technology can produce large antibody libraries with multiple sequences in a short period of time without the use of animals. The production of hybridomas and the production of humanized antibodies may require several months of production time. In addition, since immunity is not required, phage antibody libraries are able to produce antibodies against antigens with unsensitized toxicity or low antigenicity. Phage antibody libraries can also be used to produce and identify new therapeutic antibodies.

[0093] Techniques for generating human antibodies using phage display libraries from immunized humans, unimmunized humans, germline sequences, or unsensitized B cell Ig repertoires can be used. Unsensitized or non-immunogenic antigen binding libraries can be generated using various lymphoid tissues.

[0094] The technology for identifying and separating high-affinity antibodies from phage display libraries is important for separating new therapeutic antibodies. Separating high-affinity antibodies from libraries depends on the production efficiency in library size, bacterial cells and the diversity of the library. The size of the library can be reduced due to the improper folding of antibody-binding proteins or antigen-binding proteins and the invalid production due to the presence of stop codons. When the antibody binding domain or antigen-binding domain is not correctly folded, the expression in bacterial cells can be suppressed. Expression can be improved by making the residues on the variable / constant interface surface or the selected CDR residues alternately mutated. When producing antibody phage libraries in bacterial cells, the framework region sequence is an element that provides appropriate folding.

[0095] In the isolation of high affinity antibodies, it is important to generate multiple libraries of antibody binding proteins or antigen binding proteins. It is found that the CDR3 region is often involved in antigen binding. Since the CDR3 region on the heavy chain varies significantly in size, sequence and structural / dimensional morphology, it can be used to prepare multiple libraries.

[0096] Diversity can also be generated by randomizing the CDR regions of the variable heavy and light chains using all 20 amino acids at each position. Using all 20 amino acids results in antibody sequences with great diversity and increases the chance of identifying new antibodies.

[0097] As used herein, the term "antibody variable domain" refers to the light chain region and the heavy chain region of the antibody molecule, which contain the amino acid sequences of the complementary determining regions (CDRs; i.e., CDR1, CDR2, and CDR3) and the framework regions (FRs). VH refers to the variable domain of the heavy chain. VL refers to the variable domain of the light chain.

[0098] The term "complementarity determining region" (CDR; ie, CDR1, CDR2 and CDR3) refers to the amino acid residues of an antibody variable domain that are essential for antigen binding. Each variable domain typically has three CDR regions, identified as CDR1, CDR2 and CDR3.

[0099] The term "framework region" (FR) refers to the variable domain residues other than the CDR residues. Each variable domain generally has four FRs, identified as FR1, FR2, FR3, and FR4.

[0100] Preferably, the collection of antibodies or fragments thereof according to the present invention comprises:

[0101] A framework region, the framework region is contained in a VH3-15 (SEQ ID NO: 1) / Vκ1-39 (SEQ ID NO: 16), VH3-15 (SEQ ID NO: 1) / Vκ3-20 (SEQ ID NO: 21), VH3-15 (SEQ ID NO: 1) / Vκ3-20-2 (SEQ ID NO: 26), VH3-15 (SEQ ID NO: 1) / Vλ1-51 (SEQ ID NO: 31), VH3-23 (SEQ ID NO: 6) / Vκ1-39 (SEQ ID NO: 16), VH3-23 (SEQ ID NO: 6) / Vκ3-20 (SEQ ID NO: 21), VH3-23 (SEQ ID NO: 6) / Vκ3-20-2 (SEQ ID NO: 26), VH3-23 (SEQ ID NO: 6) / Vλ1-51 (SEQ ID NO: 31), VH1-6 ... The invention relates to the heavy and light chain variable region pairs of VH1-69 (SEQ ID NO: 11) / Vκ1-39 (SEQ ID NO: 16), VH1-69 (SEQ ID NO: 11) / Vκ3-20 (SEQ ID NO: 21), VH1-69 (SEQ ID NO: 11) / Vκ3-20-2 (SEQ ID NO: 26) and VH1-69 (SEQ ID NO: 11) / Vλ1-51 (SEQ ID NO: 31), as well as a different combination of CDRH1, CDRH2 and CDRH3 for each heavy chain variable region and a different combination of CDRL1, CDRL2 and CDRL3 for each light chain variable region.

[0102] In the present invention, the framework region in the heavy chain variable region having the sequence VH3-15 (SEQ ID NO: 1) comprises FR1 (SEQ ID NO: 2), FR2 (SEQ ID NO: 3), FR3 (SEQ ID NO: 4) and FR4 (SEQ ID NO: 5),

[0103] The framework region in the heavy chain variable region having the sequence VH3-23 (SEQ ID NO:6) comprises FR1 (SEQ ID NO:7), FR2 (SEQ ID NO:8), FR3 (SEQ ID NO:9) and FR4 (SEQ ID NO:10),

[0104] The framework region in the heavy chain variable region having the sequence VH1-69 (SEQ ID NO: 11) comprises FR1 (SEQ ID NO: 12), FR2 (SEQ ID NO: 13), FR3 (SEQ ID NO: 14) and FR4 (SEQ ID NO: 15),

[0105] The framework region in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) comprises FR1 (SEQ ID NO: 17), FR2 (SEQ ID NO: 18), FR3 (SEQ ID NO: 19) and FR4 (SEQ ID NO: 20),

[0106] The framework region in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO:21) comprises FR1 (SEQ ID NO:22), FR2 (SEQ ID NO:23), FR3 (SEQ ID NO:24) and FR4 (SEQ ID NO:25),

[0107] The framework region in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) comprises FR1 (SEQ ID NO: 27), FR2 (SEQ ID NO: 28), FR3 (SEQ ID NO: 29) and FR4 (SEQ ID NO: 30), and

[0108] The framework region in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO:31) includes FR1 (SEQ ID NO:32), FR2 (SEQ ID NO:33), FR3 (SEQ ID NO:34) and FR4 (SEQ ID NO:35).

[0109] The sequences of the heavy chain variable region, light chain variable region and framework regions within each variable region of the present invention are summarized as follows:

[0110] [Table 1]

[0111] Amino acid sequences of variable and framework regions

[0112]

[0113]

[0114]

[0115] [Table 2]

[0116] Nucleic acid sequences encoding variable and framework regions

[0117]

[0118]

[0119]

[0120] In the present invention, the antibody or fragment thereof may be characterized in that the complementarity determining region (CDR) contained in each variable region of the pair of the heavy chain variable region and the light chain variable region is designed to prevent post-translational modification (PTM) by changing amino acids with potential for post-translational modification (PTM).

[0121] In the present invention, the amino acid ratio at each position in the heavy chain complementary determining region 1 (CDRH1) in the heavy chain variable region having the sequence VH3-15 (SEQ ID NO: 1) includes the range of Table 3,

[0122] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1) include the ranges of Table 4,

[0123] The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH3-23 (SEQ ID NO:6) include the ranges of Table 3,

[0124] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH3-23 (SEQ ID NO: 6) include the ranges of Table 4,

[0125] The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH1-69 (SEQ ID NO: 11) include the ranges of Table 5,

[0126] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH1-69 (SEQ ID NO: 11) include the ranges of Table 6,

[0127] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 9 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 7,

[0128] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 10 amino acids, the amino acid ratios at each position in the CDRH3 include the range of Table 8,

[0129] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 11 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 9,

[0130] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 12 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 10,

[0131] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 13 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 11,

[0132] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 14 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 12,

[0133] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 13,

[0134] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 14,

[0135] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 15,

[0136] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 16,

[0137] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 17,

[0138] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 18,

[0139] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 19,

[0140] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 17,

[0141] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 18,

[0142] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 20,

[0143] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 21, and

[0144] The amino acid ratio at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) includes the range of Table 22, but is not limited thereto.

[0145] [Table 3]

[0146]

[0147] [Table 4]

[0148]

[0149] [Table 5]

[0150]

[0151] [Table 6]

[0152]

[0153] [Table 7]

[0154]

[0155] [Table 8]

[0156]

[0157] [Table 9]

[0158]

[0159] [Table 10]

[0160]

[0161] [Table 11]

[0162]

[0163] [Table 12]

[0164]

[0165] [Table 13]

[0166]

[0167] [Table 14]

[0168]

[0169] [Table 15]

[0170]

[0171] [Table 16]

[0172]

[0173] [Table 17]

[0174]

[0175] [Table 18]

[0176]

[0177] [Table 19]

[0178]

[0179] [Table 20]

[0180]

[0181] [Table 21]

[0182]

[0183] [Table 22]

[0184]

[0185] In the present invention, the amino acid ratio at each position in the heavy chain complementary determining region 1 (CDRH1) in the heavy chain variable region having the sequence VH3-15 (SEQ ID NO: 1) includes the range of Table 23,

[0186] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1) include the ranges of Table 24,

[0187] The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH3-23 (SEQ ID NO:6) include the ranges of Table 23,

[0188] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH3-23 (SEQ ID NO: 6) include the ranges of Table 24,

[0189] The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH1-69 (SEQ ID NO: 11) include the ranges of Table 25,

[0190] The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH1-69 (SEQ ID NO: 11) include the ranges of Table 26,

[0191] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 9 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 27,

[0192] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 10 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 28,

[0193] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 11 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 29,

[0194] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 12 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 30,

[0195] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 13 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 31,

[0196] When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 14 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 32,

[0197] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 33,

[0198] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 34,

[0199] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 35,

[0200] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 36,

[0201] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 37,

[0202] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 38,

[0203] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 39,

[0204] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 37,

[0205] The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 38,

[0206] The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 40,

[0207] The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 41, and

[0208] The amino acid ratio at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) includes the range of Table 42, but is not limited thereto.

[0209] [Table 23]

[0210]

[0211] [Table 24]

[0212]

[0213] [Table 25]

[0214]

[0215] [Table 26]

[0216]

[0217] [Table 27]

[0218]

[0219] [Table 28]

[0220]

[0221] [Table 29]

[0222]

[0223] [Table 30]

[0224]

[0225] [Table 31]

[0226]

[0227] [Table 32]

[0228]

[0229] [Table 33]

[0230]

[0231] [Table 34]

[0232]

[0233] [Table 35]

[0234]

[0235] [Table 36]

[0236]

[0237] [Table 37]

[0238]

[0239] [Table 38]

[0240]

[0241] [Table 39]

[0242]

[0243] [Table 40]

[0244]

[0245] [Table 41]

[0246]

[0247] [Table 42]

[0248]

[0249] In the present invention, the antibody fragment may have one or more forms selected from Fab, F(ab')2, Fab', Fv and scFv, but is not limited thereto.

[0250] The antibodies or fragments thereof according to the present invention may have one or more characteristics selected from the group consisting of: i) 10% or less redundancy (percentage of repeated sequences); ii) p-value of CDR composition>0.05; iii) thermal stability of 70°C or more; and iv) 10 7 or higher diversity (library size).

[0251] In another aspect, the invention relates to nucleic acids encoding a collection of antibodies or fragments thereof.

[0252] In another aspect, the present invention relates to a method for identifying antibodies or fragments thereof specific for an antigen, the method comprising: (a) contacting the antigen with the antibody collection, and (b) selecting one or more antibodies or antibody fragments that bind to the antigen.

[0253] In the present invention, the antibody collection may be expressed on the surface of the bacteriophage contained in the transformant introduced with the nucleic acid encoding the antibody collection, but is not limited thereto.

[0254] In the present invention, the identification method may include: culturing transformants and phages of the library, binding the antibody expressed on the surface of the phage to the antigen, and screening and selecting transformants expressing the desired antibody. The screening and selection may be performed using various techniques in the art.

[0255] For example, antibodies that bind to a specific antigen can be produced by isolating from the library using a panning method, which includes binding phage to the target antigen, removing unbound phage, recovering bound phage, infecting host cells with the phage to amplify the number of phage, and repeating this process 2-4 times.

[0256] Example

[0257] Hereinafter, the present invention will be described in more detail with reference to Examples. However, it will be apparent to those skilled in the art that these Examples are provided only to illustrate the present invention and should not be construed as limiting the scope of the present invention.

[0258] Example 1) Acquisition of human variable region cDNAs from Asians and Caucasians.

[0259] In order to analyze the amino acid combination of the human antibody variable region CDR of Asians and Caucasians, the human messenger RNA of Asians was first obtained by differentiating B cells from PBMC by the blood donation of the researcher in the laboratory (before implementing IRB). The Caucasian messenger RNA used herein is the human spleen total RNA (catalog number 636525, lot number 1107171A) produced by Clontech Laboratories Inc. Using ImProm-II reverse transcription system (Promega, catalog number A3802), the Asians and Caucasians messenger RNA obtained are converted to cDNA. In order to obtain human variable region genes from the obtained cDNA, Asian and Caucasian cDNAs were used as templates, and a forward primer (Table 43: SEQ ID NO: 71) and a reverse primer (Table 43: SEQ ID NO: 72) were added to the VH1 type, a forward primer (Table 43: SEQ ID NO: 73) and a reverse primer (Table 43: SEQ ID NO: 72) were added to the VH3 type, a forward primer (Table 43: SEQ ID NO: 74) and a reverse primer (Table 43: SEQ ID NO: 75) were added to the Vκ1 type, a forward primer (Table 43: SEQ ID NO: 76) and a reverse primer (Table 43: SEQ ID NO: 75) were added to the Vκ3 type, and a forward primer (Table 43: SEQ ID NO: 77) and a reverse primer (Table 43: SEQ ID NO: 78) were added to the Vκ3 type. NO:78) was added to the Vλ1 type, and then platinum mixed polymerase (Invitrogen, catalog number 11306) was used to perform PCR for each mixture of cDNA and primers. PCR conditions are as follows: exposure at 94°C for 3 minutes, followed by 25 cycles, each cycle including: exposure at 94°C for 1 minute, exposure at 55°C for 1 minute and exposure at 72°C for 2 minutes, and then reacting at 72°C for 10 minutes. The amplified genes were identified as DNA bands with expected sizes in 1% agarose gels and separated using gel extraction kits (QIAquick gel extraction kit, QIAGEN, catalog number 28706), respectively.

[0260] [Table 43]

[0261] name sequence SEQ ID NO VH1 Fo CARGTGCAGCTKGTGCAGTCTGG 71 JH Re_cDNA TGAGGAGACGGTGACCAGGGTGCC 72 VH3 GARGTGCAGCTGGTGGAGTCTGG 73 Vκ1Fo GACATCCAGATGACCCAGTCTCC 74 Jk Re_cDNA ACGTTTGATTTCCACCTTGGTCCC 75 Vκ3F GAAATWGTGWTGACRCAGTCTCC 76 VλFo CAGTCTGTGYTGACKCAGCCGCC 77 JλRe_cDNA ACCTAGGACGGTCAGCTTGGTCCC 78

[0262] Example 2) Construction of human antibody variable region libraries of Asians and Caucasians for high-throughput sequencing.

[0263] In order to perform high-throughput sequencing on the Asian and Caucasian cDNAs obtained in Example 1, PCR was performed to connect the barcodes for identifying each type. First, regarding Asian cDNA, a forward primer (Table 44: SEQ ID NO: 79) and a reverse primer (Table 44: SEQ ID NO: 89) were added as templates to Asian VH1 cDNA, a forward primer (Table 44: SEQ ID NO: 80) and a reverse primer (Table 44: SEQ ID NO: 89) were added to the VH3 type, a forward primer (Table 44: SEQ ID NO: 81) and a reverse primer (Table 44: SEQ ID NO: 90) were added to the Vκ1 type, a forward primer (Table 44: SEQ ID NO: 81) and a reverse primer (Table 44: SEQ ID NO: 90) were added to the Vκ3 type, a forward primer (Table 44: SEQ ID NO: 83) and a reverse primer (Table 44: SEQ ID NO: 91) were added to the Vλ1 type, and then PCR was performed on each mixture of cDNA and primers using prime star mixture (Takara, catalog number R040B). PCR conditions were as follows: 2 minutes exposure at 94° C., followed by 10 cycles, each cycle including: 15 minutes exposure at 94° C., 15 minutes exposure at 55° C. and 30 minutes exposure at 72° C., and 5 minutes reaction at 72° C. The amplified gene was identified as a DNA band of the expected size in a 1% agarose gel and was separated using a gel extraction kit (QIAquick Gel Extraction Kit, QIAGEN, catalog number 28706) alone. Regarding Caucasian cDNA, a forward primer (Table 44: SEQ ID NO: 84) and a reverse primer (Table 44: SEQ ID NO: 89) were added as a template to Caucasian VH1 cDNA, a forward primer (Table 44: SEQ ID NO: 85) and a reverse primer (Table 44: SEQ ID NO: 89) were added to the VH3 type, a forward primer (Table 44: SEQ ID NO: 86) and a reverse primer (Table 44: SEQ ID NO: 90) were added to the Vκ1 type, a forward primer (Table 44: SEQ ID NO: 87) and a reverse primer (Table 44: SEQ ID NO: 90) were added to the Vκ3 type, and a forward primer (Table 44: SEQ ID NO: 88) and a reverse primer (Table 44: SEQ ID NO: 91) were added to the Vλ1 type, and then PCR was performed on each mixture of cDNA and primers using prime star mixture (Takara, catalog number R040B).PCR conditions were as follows: 2 minutes exposure at 94° C., followed by 10 cycles, each cycle comprising: 15 minutes exposure at 94° C., 15 minutes exposure at 55° C. and 30 minutes exposure at 72° C., and then 5 minutes reaction at 72° C. The amplified genes were identified as DNA bands of expected sizes in 1% agarose gel and were each separated using a gel extraction kit (QIAquick Gel Extraction Kit, QIAGEN, catalog number 28706).

[0264] The obtained Asian and Caucasian genes were sequenced by Macrogen (Guro-gu, Seoul, Korea) using the 454 sequencing (GS FLX Titanium, Roche) method in the numbers shown in Table 45. Based on the amino acids shown in Table 46, the composition ratios of the CDR amino acids of the sequences were analyzed for CDR1, CDR2, and CDR3.

[0265] [Table 44]

[0266]

[0267]

[0268] Example 3) High-throughput sequencing data analysis and primer design based thereon

[0269] By high-throughput sequencing, more than 10,000 human variable region sequences were obtained for each race and type (Table 45). In order to detect the amino acid combination of the CDR region between the obtained human variable region sequences, for the CDR1 of the VH1 type, the region between serine-cysteine ​​(Kabat numbering 22, 23) and tryptophan-valine (Kabat numbering 36, 37) was analyzed; for the CDR2 of the VH1 type, the region between glutamic acid-tryptophan (Kabat numbering 47, 48) and arginine-random-threonine (Kabat numbering 67, 68, 69) was analyzed; and for the CDR3 of the VH1 type, the region between tyrosine-tyrosine-cysteine ​​(Kabat numbering 90, 91, 92) and glycine-threonine-leucine (Kabat numbering 103, 104, 105) was analyzed. For the CDR1 of the VH3 type, the region between serine-cysteine ​​(Kabat numbers 22, 23) and tryptophan-valine (Kabat numbers 36, 37) was analyzed; for the CDR2 of the VH3 type, the region between glutamic acid-tryptophan (Kabat numbers 47, 48) and lysine-glycine-arginine (Kabat numbers 67, 68, 69) was analyzed; and for the CDR3 of the VH3 type, the region between tyrosine-tyrosine-cysteine ​​(Kabat numbers 90, 91, 92) and glycine-threonine-leucine (Kabat numbers 103, 104, 105) was analyzed. For CDR1 of Vκ1 type, the region between isoleucine-random-cysteine ​​(Kabat numbers 21, 22, 23) and tryptophan-tyrosine (Kabat numbers 35, 36) was analyzed; for CDR2 of Vκ1 type, the region between isoleucine-tyrosine (Kabat numbers 48, 49) and glycine-valine (Kabat numbers 57, 58) was analyzed; and for CDR3 of Vκ1 type, the region between tyrosine-tyrosine-cysteine ​​(Kabat numbers 86, 87, 88) and glycine-threonine-lysine (Kabat numbers 101, 102, 103) was analyzed. For CDR1 of Vκ3, the region between serine-cysteine ​​(Kabat numbers 22, 23) and tryptophan-tyrosine (Kabat numbers 35, 36) was analyzed; for CDR2 of Vκ3, the region between leucine-isoleucine (Kabat numbers 47, 48) and isoleucine-proline (Kabat numbers 58, 59) was analyzed; and for CDR3 of Vκ3, the region between tyrosine-tyrosine-cysteine ​​(Kabat numbers 86, 87, 88) and glycine-threonine-lysine (Kabat numbers 101, 102, 103) was analyzed.For the CDR1 of Vλ1, the region between serine-cysteine ​​(Kabat numbering 22, 23) and tryptophan-tyrosine (Kabat numbering 35, 36) was analyzed; for the CDR2 of Vλ1, the region between leucine-isoleucine (Kabat numbering 47, 48) and serine-glycine (Kabat numbering 56, 57) was analyzed; and for the CDR3 of Vλ1, the region between tyrosine-tyrosine-cysteine ​​(Kabat numbering 86, 87, 88) and glycine-threonine-lysine (Kabat numbering 101, 102, 103) was analyzed (Table 46). VH1 type and VH3 type have CDR3 of various lengths, so after analyzing each of 9 to 14 amino acids, an amino acid combination was identified, and the 9 to 14 amino acids are the lengths that can achieve the most efficient antibody selection when generating synthetic libraries based on conventional literature.

[0270] The analysis results showed that no significant differences were found between Asian and Caucasian CDR amino acid combinations, i.e., they were very similar. CDR1 and CDR2 of VH have a variety of amino acid combinations, but contain amino acids at a higher conservation rate than CDR3. This is because these are V gene regions without VDJ joining, so the possibility of introducing mutations is lower than that of CDR3, and there are amino acids that should be retained due to the presence of residue numbers that affect structural stability. No significant differences were found between CDR3 of VH1 and CDR3 of VH3, and they were found to have similar amino acid combinations. This is because the V gene ends of VH1 and VH3 are usually retained as tyrosine-tyrosine-cysteine-alanine-arginine / lysine, and the same genes are applied to D genes and J genes during VDJ joining.

[0271] Based on the analysis results, the average value of the combination of Asian and Caucasian CDR amino acids was calculated and reflected in the primer codon design. In addition, since the CDR3 of VH1 and VH3 is similar, the primers constituting CDR3 are shared. In addition, due to N-glycosylation, there is a risk of reduced antibody titer because the amino acid NXS / T ratio of the CDR2 of VH1 with Kabat numbering 52-52a-53 and the CDR2 of VH3 with Kabat numbering 52a-53-54 is about 5%. For this reason, the possibility of N-glycosylation was eliminated by reducing the ratio of asparagine at 52 of VH1 and 52a of VH3 to 0%.

[0272] [Table 45]

[0273]

[0274]

[0275] [Table 46]

[0276] 1 2 3 Asian VH1 SC-WV EW-RXT YYC-GTL Asian VH3 SC-WV EW-KGR YYC-GTL Asian Vκ1 IXC-WY IY-GV YYC-GTK Asian Vκ3 SC-WY LI-IP YYC-GTK Asian Vλ1 SC-WY LI-SG YYC-GTK Caucasian VH1 SC-WV EW-RXT YYC-GTL Caucasian VH3 SC-WV EW-KGR YYC-GTL Caucasian Vκ1 IXC-WY IY-GV YYC-GTK Caucasian Vκ3 SC-WY LI-IP YYC-GTK Caucasian Vλ1 SC-WY LI-SG YYC-GTK

[0277] Example 4) Construction of Fab library

[0278] 4-1) Construction of light chain variable region library

[0279] 1) VL framework sequence synthesis: The sequences of framework 1 to framework 3 of human VLκ1-39, VLκ3-20 and VLλ1-51 (Table 47) were synthesized by Bioneer (http: / / www.bioneer.co.kr) upon request and obtained therefrom.

[0280] [Table 47]

[0281]

[0282]

[0283] 2) Primary PCR amplification (fragment PCR): Using each framework sequence as a template (5ng / reaction), VLCDR1 to CDR3 fragments (fragments 1 to 3) were amplified by PCR. The primer sequences used in PCR are shown in Table 48. In the above sequence, the number X means 3 bases, and in the sequence table file, this is indicated as "NNN". AccuPower Pfu PCR PreMix (Bioneer, K-2025) was used to react for 30 cycles (30 seconds at 95°C, 30 seconds at 50°C to 58°C, and 1 minute at 72°C). Each PCR product was electrophoresed and then purified using a QIAquick gel extraction kit (QIAGEN, catalog number 28706).

[0284] [Table 48]

[0285]

[0286]

[0287]

[0288] N1 to N8 of SEQ ID NO:93 (Vκ1-39-F1), SEQ ID NO:98 (Vκ3-20-F1), and SEQ ID NO:103 (Vκ3-20-2-F1) were designed to have the base ratios shown in Table 49 below, and PCR was performed.

[0289] [Table 49]

[0290]

[0291] X1 to X16 of SEQ ID NO:93 (Vκ1-39-F1), SEQ ID NO:98 (Vκ3-20-F1), and SEQ ID NO:103 (Vκ3-20-2-F1) were designed to have the codon ratios shown in Table 50 below, and PCR was performed.

[0292] [Table 50]

[0293]

[0294] N of SEQ ID NO: 95 (Vκ1-39-F2) was designed to have the base ratio shown in Table 51 below, and PCR was performed.

[0295] [Table 51]

[0296]

[0297] X of SEQ ID NO: 95 (Vκ1-39-F2) was designed to have the codon ratios shown in Table 52 below, and PCR was performed.

[0298] [Table 52]

[0299]

[0300] N of SEQ ID NO: 100 (Vκ3-20-F2) was designed to have the base ratio shown in Table 53 below, and PCR was performed.

[0301] [Table 53]

[0302]

[0303] X of SEQ ID NO: 100 (Vκ3-20-F2) was designed to have the codon ratios shown in Table 54 below, and PCR was performed.

[0304] [Table 54]

[0305]

[0306] N of SEQ ID NO: 97 (VLκ1-39_F3) and SEQ ID NO: 102 (VLκ3-20_F3) was designed to have the base ratios shown in Table 55 below, and PCR was performed.

[0307] [Table 55]

[0308]

[0309] X of SEQ ID NO: 97 (VLκ1-39_F3) and SEQ ID NO: 102 (VLκ3-20_F3) was designed to have the codon ratios shown in Table 56 below, and PCR was performed.

[0310] [Table 56]

[0311]

[0312] N of SEQ ID NO: 104 (VLλ1-51_F1) was designed to have the base ratio shown in Table 57 below, and PCR was performed.

[0313] [Table 57]

[0314]

[0315] X of SEQ ID NO: 104 (VLλ1-51_F1) was designed to have the codon ratios shown in Table 58 below, and PCR was performed.

[0316] [Table 58]

[0317]

[0318] X of SEQ ID NO: 106 (VLλ1-51_F2) was designed to have the codon ratios shown in Table 59 below, and PCR was performed.

[0319] [Table 59]

[0320]

[0321] X of SEQ ID NO: 108 (VLλ1-51_F3) was designed to have the codon ratios shown in Table 60 below, and PCR was performed.

[0322] [Table 60]

[0323]

[0324] 3) Second PCR amplification (1st overlapping PCR): The primary PCR product (fragments 1 to 3) was added as a template (20 ng / reaction for each fragment), and the reaction was performed for 16 cycles (30 seconds at 95°C, 30 seconds at 55°C, and 1 minute at 72°C). The primer sequences used for PCR are shown in Table 61. Each PCR product (variable light chain) was subjected to electrophoresis and then purified using a QIAquick gel extraction kit (QIAGEN, catalog number 28706).

[0325] [Table 61]

[0326]

[0327]

[0328] 4) The third PCR amplification (the second overlapping PCR): Weigh the purified first overlapping PCR product and use it as a template (10 mg / reaction for each product) together with CLκ (fragment PCR product) of VLκ1-39, VLκ3-20 and VLκ3-20-2 and CLλ (fragment PCR product) of VLλ1-51, and react for 15 cycles (1 minute at 95°C, 1 minute at 55°C, 1 minute at 72°C). The primer sequences used in PCR are shown in Table 62. Each PCR product was subjected to electrophoresis and then purified using a QIAquick gel extraction kit (QIAGEN, catalog number 28706).

[0329] [Table 62]

[0330]

[0331] 5) VL library transformation

[0332] 5-a) Connect: EcoRI (NEB, catalog number R0101L) is added to the overlapping PCR products of variable light chain (VL) and constant light chain (CL) regions, reacted overnight (O / N) at 37°C, and then the resultant is purified using QIAquick PCR purification kit (QIAGEN, catalog number 28106). XbaI (NEB, catalog number R0145L) is added thereto, then reacted overnight (O / N) at 37°C and purified using QIAquick PCR purification kit (QIAGEN, catalog number 28106). T4 DNA ligase (NEB, catalog number M0203S) is added to 20 μg of the inserted DNA fragment cut with EcoRI and XbaI and 40 μg of linearized pComb3XTT vector (EcoRI, XbaI cut), then reacted overnight (O / N) at 25°C.

[0333] 5-b) transformation: QIAquick PCR purification kit (QIAGEN, catalog number 28106) is used to purify the connected reaction product. For each light chain subtype, 1mL MC1061F '(SS320) competent cells (Lucigen, catalog number 60512-1) are divided into 10 cuvettes (100 μl / cuvette) and electroporated. SB liquid medium is added to adjust the total volume to 500mL, the resulting product is incubated for 1 hour at 37°C and 200rpm shaking, and 100 μL of culture supernatant is coated on LB agar folding plate (agar lop plate) + carbenicillin (NaraeBiotech, catalog number LN004CA) by serial dilution, and then incubated overnight at 37°C to determine the size of pComb3XTT-synthetic VL library. 500 μL of carbenicillin (100 mg / mL) was added to 500 mL of the culture, followed by incubation at 37° C. (200 rpm) overnight.

[0334] 4-2) Construction of heavy chain variable region library

[0335] 1) VH framework sequence synthesis: The sequences of frame 1 to frame 3 of human VH1-69, VH3-15 and VH3-23 (Table 63) were synthesized by Bioneer (http: / / www.bioneer.co.kr) upon request and obtained therefrom.

[0336] [Table 63]

[0337]

[0338] 2) Primary PCR amplification (fragment PCR): Using each framework sequence as a template (5ng / reaction), VLCDR1 to CDR3 fragments (fragments 1 to 3) were amplified by PCR. The primer sequences used for PCR are shown in Table 64. AccuPower Pfu PCRPreMix (Bioneer, K-2025) was used for the reaction for 30 cycles (30 seconds at 95°C, 30 seconds at 50°C to 55°C, and 1 minute at 72°C). Each PCR product was subjected to electrophoresis and then purified using a QIAquick gel extraction kit (QIAGEN, catalog number 28706).

[0339] [Table 64]

[0340]

[0341]

[0342]

[0343]

[0344] N of SEQ ID NO: 116 (VH1-69_F1) and SEQ ID NO: 126 (VH3-15_F) was designed to have the base ratios shown in Table 65 below, and PCR was performed.

[0345] [Table 65]

[0346]

[0347] X of SEQ ID NO: 116 (VH1-69_F1) and SEQ ID NO: 126 (VH3-15_F) was designed to have the codon ratios shown in Table 66 below, and PCR was performed.

[0348] [Table 66]

[0349]

[0350] X of SEQ ID NO: 118 (VH1-69_F2) was designed to have the codon ratios shown in Table 67 below, and PCR was performed.

[0351] [Table 67]

[0352]

[0353] N of SEQ ID NO: 128 (VH3-15_F2) was designed to have the base ratio shown in Table 68 below, and PCR was performed.

[0354] [Table 68]

[0355]

[0356] X of SEQ ID NO: 128 (VH3-15_F2) was designed to have the codon ratios shown in Table 69 below, and PCR was performed.

[0357] [Table 69]

[0358]

[0359] N of SEQ ID NO: 130 (VH3-23_F2) was designed to have the base ratio shown in Table 70 below, and PCR was performed.

[0360] [Table 70]

[0361]

[0362] X of SEQ ID NO: 130 (VH3-23_F2) was designed to have the codon ratios shown in Table 71 below, and PCR was performed.

[0363] [Table 71]

[0364]

[0365] X of SEQ ID NO: 120 (VH1-69_F3_CDR9, VH3-15_F3_CDR9, VH3-23_F3_CDR9) was designed to have the codon ratios shown in Table 72 below, and PCR was performed.

[0366] [Table 72]

[0367]

[0368] Change SEQ ID NO:121(VH1-69_F3_CDR10, VH3-15_F3_CDR10, VH3-23_F3_CDR10), SEQ ID NO:122(VH1-69_F3_CDR11, VH3-15_F3_CDR11, VH3-23_F3_CDR11), SEQ ID NO:123(VH1-69_F3_CDR12, VH3-15_F3_CDR12, VH3-23_F3_CDR12), SEQ ID NO:124(VH1-69_F3_CDR13, VH3-15_F3_CDR13, VH3-23_F3_CDR13) and SEQ ID X of NO: 125 (VH1-69_F3_CDR14, VH3-15_F3_CDR14, VH3-23_F3_CDR14) was designed to have the codon ratios shown in Table 73 below, and PCR was performed.

[0369] [Table 73]

[0370]

[0371] 3) Second PCR amplification (1st overlapping PCR): The primary PCR product (fragments 1 to 3) was added as a template (40 ng / reaction for each fragment), and the reaction was performed for 16 cycles (30 seconds at 95°C, 30 seconds at 50°C to 55°C, and 1 minute at 72°C). The primer sequences used in PCR are shown in Table 74. Each PCR product (variable heavy chain) was subjected to electrophoresis and then purified using a QIAquick gel extraction kit (QIAGEN, catalog number 28706).

[0372] [Table 74]

[0373]

[0374] 4) Fab library transformation

[0375] 4-a) Connect: XbaI (NEB, catalog number R0145L) is added to the PCR product of the variable heavy chain (VH), reacted at 37°C for 6 hours, and then the resultant is purified using a QIAquick PCR purification kit (QIAGEN, catalog number 28106). ApaI (NEB, catalog number R0114L) is added thereto, followed by reaction at 25°C for 6 hours and purification using a QIAquick PCR purification kit (QIAGEN, catalog number 28106). T4 DNA ligase (NEB, catalog number M0203S) is added to 10 μg of the inserted DNA fragment cut with XbaI and apaI and 40 μg of the linearized pComb3XTT vector (EcoRI, XbaI cut), and reacted overnight (O / N) at 25°C. At this time, as the ratio of the length of CDR3 to the total amount of DNA, the percentage of CDR3_9AA (amino acid) length is adjusted to 12%, the percentage of CDR3_10AA length is adjusted to 14%, the percentage of CDR3_11AA length is adjusted to 17%, the percentage of CDR3_12AA length is adjusted to 22%, the percentage of CDR3_13AA length is adjusted to 19%, and the percentage of CDR3_14AA length is adjusted to 16%.

[0376] 4-b) transformation: the reaction product connected is purified using QIAquick PCR purification kit (QIAGEN, catalog number 28106). For each heavy chain subtype, 1mL XL1-Blue electroporation competent cells (Stratagene, catalog number 200228) are divided into 10 cuvettes (100 μl / cuvette) and electroporated. SB liquid medium is added to adjust the total volume to 500mL, and the resulting product is incubated for 1 hour at 37°C and 200rpm shaking. 100 μL culture supernatants are coated on LB agar folding plates + carbenicillin (NaraeBiotech, catalog number LN004CA) by serial dilution, and then incubated overnight at 37°C to determine the size of the pComb3XTT-synthetic VL library. 500 μL of carbenicillin (100 mg / mL) was added to 500 mL of the culture, followed by incubation at 37° C. (200 rpm) overnight.

[0377] Example 5) Detection of Fab library performance

[0378] 5-1) Determination of library size

[0379] For the Fab library, 3 VH types and 4 VL types were used to construct a total of 12 Fab libraries of 10 10 or larger to obtain a total library size of 1.52 × 10 11 For the scFv library, a total of 8 Fab libraries of 10 cells / mL were constructed using 2 VH types and 4 VL types. 11 or larger to obtain a total library size of 1.27x10 12 scFv library.

[0380] [Table 75]

[0381]

[0382] Unit: CFU (colony forming unit)

[0383] 5-2) Detection of library CDR amino acid distribution

[0384] Reproducibility was analyzed by comparing the human germline CDR sequences obtained using HT sequencing with the CDR sequences of the actual constructed libraries.

[0385] The results showed that the designed amino acid diversity was obtained, such as Figure 2 shown.

[0386] For quantitative analysis, paired T test was used.

[0387] The results showed that the significance level of all library introduced sites was 5% or lower, indicating that the mutant sequences of the actual libraries were identical to the sequences designed based on human germline CDRs.

[0388] [Table 76]

[0389]

[0390] ＊ Significance level (α): 5%

[0391] 5-3) Detection of redundant (repeated) sequence distribution

[0392] The ratio of duplicate sequences was obtained by analyzing approximately 10,000 duplicate sequences of each library sequence using HT sequencing.

[0393] The results showed that the repeat ratio of VH3-15 and VH3-23 types was 10% or less, the repeat ratio of VH1-69 was 13% to 21%, and the overall average repeat ratio was 10.5% (Table 77). Figure 3 As can be seen, since most of the repeat sequences are repeated twice, the effect of reducing the library quality is not significant.

[0394] [Table 77]

[0395] type ％ VH3-15 / Vk1-39 8.6 VH3-15 / Vk3-20 9.1 VH3-15 / Vk3-20-2 6.4 VH3-15 / Vλ1-51 6.6 VH3-23 / Vk1-39 8.3 VH3-23 / Vk3-20 6.8 VH3-23 / Vk3-20-2 7.7 VH3-23 / Vλ1-51 7.5 VH1-69 / Vk1-39 18 VH1-69 / Vk3-20 13 VH1-69 / Vk3-20-2 13.7 VH1-69 / Vλ1-51 21 total 10.5

[0396] 5-4) CDR length analysis

[0397] The distribution of human germline VH CDR3 sequences for each length was detected by HT sequencing, which was replicated in the library, compared and analyzed by HT sequencing.

[0398] from Figure 4 As can be seen in the figure, the distribution of human germline sequences for each length is similar to the CDR lengths of the library.

[0399] Although the specific configuration of the present invention has been described in detail, it will be appreciated by those skilled in the art that this description is provided for illustrative purposes to set forth preferred embodiments and should not be construed as limiting the scope of the present invention. Therefore, the essential scope of the present invention is defined by the appended claims and their equivalents.

[0400] Industrial Applicability

[0401] Advantageously, the antibody library according to the present invention has high thermodynamic stability and enables highly soluble expression as well as reversible folding.

[0402] Furthermore, the antibody library according to the present invention comprises a variety of CDRs that are rationally controlled to have high specificity and high affinity for all antigens and thus have a high level of diversity, and can therefore be effectively used to select suitable candidate antibodies against desired antigens.

[0403] In addition, the antibody library according to the present invention is based on human antibody sequences, and thus can be used to screen antibodies with minimal immunogenicity when administered to humans, and can be used to develop antibodies that can be effectively used to treat or diagnose diseases.

[0404] Sequence Listing Free Text

[0405] Electronic files are attached.

Claims

1. A collection of antibodies or fragments thereof, Each antibody or fragment thereof comprises a heavy chain variable region and a light chain variable region pair, comprising A framework region, the framework region is contained in a VH3-15 (SEQ ID NO: 1) / Vκ1-39 (SEQ ID NO: 16), VH3-15 (SEQ ID NO: 1) / Vκ3-20 (SEQ ID NO: 21), VH3-15 (SEQ ID NO: 1) / Vκ3-20-2 (SEQ ID NO: 26), VH3-15 (SEQ ID NO: 1) / Vλ1-51 (SEQ ID NO: 31), VH3-23 (SEQ ID NO: 6) / Vκ1-39 (SEQ ID NO: 16), VH3-23 (SEQ ID NO: 6) / Vκ3-20 (SEQ ID NO: 21), VH3-23 (SEQ ID NO: 6) / Vκ3-20-2 (SEQ ID NO: 26), VH3-23 (SEQ ID NO: 6) / Vλ1-51 (SEQ ID NO: 31), VH1-6 ... The heavy and light chain variable region pairs of VH1-69 (SEQ ID NO: 11) / Vκ1-39 (SEQ ID NO: 16), VH1-69 (SEQ ID NO: 11) / Vκ3-20 (SEQ ID NO: 21), VH1-69 (SEQ ID NO: 11) / Vκ3-20-2 (SEQ ID NO: 26), and VH1-69 (SEQ ID NO: 11) / Vλ1-51 (SEQ ID NO: 31); and For each heavy chain variable region, a different combination of CDRH1, CDRH2 and CDRH3 is present, and for each light chain variable region, a different combination of CDRL1, CDRL2 and CDRL3 is present. wherein the amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1) include the ranges of Table 3, The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1) include the ranges of Table 4, The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH3-23 (SEQ ID NO:6) include the ranges of Table 3, The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH3-23 (SEQ ID NO: 6) include the ranges of Table 4, The amino acid ratios at each position in the heavy chain complementarity determining region 1 (CDRH1) in the heavy chain variable region having sequence VH1-69 (SEQ ID NO: 11) include the ranges of Table 5, The amino acid ratios at each position in the heavy chain complementarity determining region 2 (CDRH2) in the heavy chain variable region having sequence VH1-69 (SEQ ID NO: 11) include the ranges of Table 6, When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 9 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 7, When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 10 amino acids, the amino acid ratios at each position in the CDRH3 include the range of Table 8, When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 11 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 9, When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 12 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 10, When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 13 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 11, When the heavy chain complementarity determining region 3 (CDRH3) in the heavy chain variable region having sequence VH3-15 (SEQ ID NO: 1), VH3-23 (SEQ ID NO: 6) or VH1-69 (SEQ ID NO: 11) has 14 amino acids, the amino acid ratios at each position in the CDRH3 include the ranges of Table 12, The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 13, The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 14, The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) include the ranges of Table 15, The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 16, The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 17, The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO: 21) include the ranges of Table 18, The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 19, The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 17, The amino acid ratios at each position in the light chain complementary determining region 3 (CDRL3) in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) include the ranges of Table 18, The amino acid ratios at each position in the light chain complementary determining region 1 (CDRL1) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 20, The amino acid ratios at each position in the light chain complementary determining region 2 (CDRL2) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 21, and The amino acid ratios at each position in the light chain complementarity determining region 3 (CDRL3) in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO: 31) include the range of Table 22.

2. The antibody or fragment thereof collection according to claim 1, wherein the framework region in the heavy chain variable region having the sequence VH3-15 (SEQ ID NO: 1) comprises FR1 (SEQ ID NO: 2), FR2 (SEQ ID NO: 3), FR3 (SEQ ID NO: 4) and FR4 (SEQ ID NO: 5), The framework region in the heavy chain variable region having the sequence VH3-23 (SEQ ID NO:6) comprises FR1 (SEQ ID NO:7), FR2 (SEQ ID NO:8), FR3 (SEQ ID NO:9) and FR4 (SEQ ID NO:10), The framework region in the heavy chain variable region having the sequence VH1-69 (SEQ ID NO: 11) comprises FR1 (SEQ ID NO: 12), FR2 (SEQ ID NO: 13), FR3 (SEQ ID NO: 14) and FR4 (SEQ ID NO: 15), The framework region in the light chain variable region having the sequence Vκ1-39 (SEQ ID NO: 16) comprises FR1 (SEQ ID NO: 17), FR2 (SEQ ID NO: 18), FR3 (SEQ ID NO: 19) and FR4 (SEQ ID NO: 20), The framework region in the light chain variable region having the sequence Vκ3-20 (SEQ ID NO:21) comprises FR1 (SEQ ID NO:22), FR2 (SEQ ID NO:23), FR3 (SEQ ID NO:24) and FR4 (SEQ ID NO:25), The framework region in the light chain variable region having the sequence Vκ3-20-2 (SEQ ID NO: 26) comprises FR1 (SEQ ID NO: 27), FR2 (SEQ ID NO: 28), FR3 (SEQ ID NO: 29) and FR4 (SEQ ID NO: 30), and The framework region in the light chain variable region having the sequence Vλ1-51 (SEQ ID NO:31) comprises FR1 (SEQ ID NO:32), FR2 (SEQ ID NO:33), FR3 (SEQ ID NO:34) and FR4 (SEQ ID NO:35).

3. The antibody or fragment collection according to claim 1, wherein: In the antibody or fragment thereof, the complementarity determining region (CDR) contained in each variable region of the pair of the heavy chain variable region and the light chain variable region is designed to prevent post-translational modification by changing amino acids with potential for post-translational modification (PTM).

4. The collection of antibodies or fragments thereof according to claim 1, wherein the antibody fragments have one or more forms selected from Fab, Fab', F(ab')2, scFv (scFv)2, scFv-Fc, and Fv.

5. The collection of antibodies or fragments thereof according to claim 1, wherein the collection of antibodies or fragments thereof has one or more characteristics selected from the following i) to iv): i) 10% or less redundancy; ii) p value of CDR composition>0.05; iii) thermal stability of 70°C or higher; and iv)10 7 or higher diversity. 6 . The collection of antibodies or fragments thereof according to claim 1 , wherein the collection of antibodies or fragments thereof is expressed on the surface of a phage or host cell into which a nucleic acid encoding the collection of antibodies or fragments thereof has been introduced. The collection of antibodies or fragments thereof according to claim 6 , wherein the host cell is Escherichia coli or yeast.

8. A nucleic acid encoding a collection of antibodies or fragments thereof according to any one of claims 1 to 7.

9. A method for identifying an antibody or fragment thereof specific for an antigen, the method comprising: (a) contacting an antigen with a collection of antibodies or fragments thereof according to any one of claims 1 to 7; as well as (b) selecting one or more antibodies or antibody fragments that bind to the antigen.

10. The method of claim 9, wherein the collection of antibodies or fragments thereof is expressed on the surface of a bacteriophage or host cell into which a nucleic acid encoding the collection of antibodies or fragments thereof has been introduced.

Images