Live attenuated influenza B virus compositions and methods of preparation and use thereof

Abstract

The NS1 protein of influenza virus is a key virulence element, has multiple functions in viral replication, and acts as a strong interferon (IFN) antagonist. A live attenuated virus (LAIV) using a main skeleton is provided, which contains an influenza B (HK8038) virus and includes a deletion (DelNS1) in the NSI coding region. The LAIV is based on a novel adaptive mutation that supports the replication of the DelNS1 influenza B live attenuated virus (LAIV) in vaccine-producing cells. The DelNS1 influenza B LAIV shows spontaneous cold adaptation, with a preference for growth at 30 to 33°C but limited at 37 to 39°C. The LAIV can be used to protect subjects in need against lethal attacks of antigenically different influenza B viruses. The DelNS1‑LAIV with adaptive mutations for growth in a vaccine production system is an important strategy for preparing a highly attenuated and immunogenic live attenuated influenza vaccine, which has the ability to induce broad cross-protective immunity to seasonal influenza.

Description

Technical Field

[0001] The present invention generally relates to live attenuated influenza virus (LAIV) B and immunogenic compositions comprising LAIVB, and methods of using such compositions to induce immune responses to antigens encoded by the viral genome. Background Art

[0002] Based on differences in the viral nucleoprotein (NP) and matrix proteins, influenza viruses are classified into types A, B, and C. Type A viruses are further subdivided into different subtypes based on the presence of an envelope glycoprotein with hemagglutinin activity (HA) or neuraminidase activity (NA). There are 18 different hemagglutinin subtypes and 11 different neuraminidase subtypes. (H1 to H18 and N1 to N11, respectively.) Influenza B viruses are not divided into subtypes, but can be further divided into lineages and strains. Currently circulating influenza B viruses belong to one of two lineages: B / Yamagata and B / Victoria. Influenza B and C viruses primarily infect humans, whereas influenza A viruses infect a range of mammalian and avian species. Only types A and B cause any human disease of concern. Influenza occurs throughout the world, with an estimated annual global incidence of 5 to 10% in adults and 20 to 30% in children (Thompsom et al., JAMA 292, 1333-1340 (2004); WOrld Health Organization Influenza (seasonal) fact sheet. World Health Organization (online) http: / / www.who.int / mediacentre / factsheets / fs211 / en (2014)), causing 2 to 5 million severe illnesses and up to 650,000 deaths each year (Iuliano et al., Lancet 391, 1285-1300 (2018); Whord Health Organization, 2016 Influenza (seasonal) fact sheet 211). www.who.int. / mediacentre / factsheets / fs211 / en). Vaccination against influenza is considered to be the most effective way to reduce the disease burden and mortality caused by seasonal influenza and to prevent future pandemics in humans.

[0003] There are currently three types of inactivated vaccines available: whole virus vaccine, split virus vaccine and subunit vaccine. In the split virus vaccine, the virus has been destroyed with detergent. In the subunit vaccine, HA and NA are further purified by removing other viral components. Live attenuated influenza vaccines are based on cold-adapted and temperature-sensitive variant vaccine virus strains, which replicate well in the nasopharynx of the upper respiratory tract, but replicate poorly in the lower respiratory tract (Jin et al., Curr Top Microbiol Immunol 386, 181-204 (2015)). The currently licensed influenza vaccines are trivalent (three components) or quadrivalent (four components). Based on the monitoring data of the World Health Organization (WHO) influenza network laboratory, the trivalent influenza vaccine composed of antigens is derived from two influenza A H1N1 and H3N2 subtype viruses, and any strain of influenza B virus derived from Victoria or Yamagata pedigrees. The quadrivalent influenza vaccine was first licensed in the United States in 2012 and is available in the 2013 to 2014 flu season. WHO recommended quadrivalent vaccine in 2013, which contains antigens for preventing influenza A H1N1, H3N2 subtype virus and two lineages of influenza B virus, but let each country / state decide to use trivalent or quadrivalent vaccine. According to the data collected by the monitoring project of WHO influenza vaccine cooperation network laboratory, influenza vaccine strains are selected every year. There are differences in human diseases caused by different influenza virus strains, where influenza B is more common in children and H3N2 is more common in the elderly (Caini et al., BMC Infect Dis 18,269(2018)). Although it was previously believed that influenza B virus mainly causes diseases in older children, it has been noted that since 2005, the epidemic pattern of influenza B virus related to disease burden has gradually changed in all age groups (Glezen et al., Am J Public Health 103,e43-51(2013)). Since influenza B virus only spreads in humans, effective influenza B virus vaccine can eventually eradicate influenza B virus from humans. Similar to the spread of H1N1 and H3N2 subtypes, two antigenically distinct influenza B viruses (Yamagata and Victoria lineages) circulate alternately in humans, with annual trends difficult to accurately predict. Current seasonal influenza vaccines are suboptimal for the variable nature of influenza virus transmission each season. Further, although live attenuated influenza viruses (LAIV) have advantages because they can induce both humoral and cellular immunity, currently available LAIV vaccines are only licensed for use in the 2 to 49 age group due to safety concerns for young children and uncertain efficacy for older age groups. The influenza virus NS1 protein has multiple functions and is a determining factor for virulence, making its absence a focus of attention in live vaccine research.However, NS1 deletion severely affects viral replication, making it difficult to produce high-titer attenuated viruses for vaccine applications.

[0004] Talon et al., PNAS, 97 (8): 4309-1314 (2000) discloses the growth characteristics of influenza B / 201 and B / 234 virus variants. Influenza B / 201 and influenza B / AWBY / 234 (B / 234) viruses are laboratory variants of influenza B / Yamagata / 1 / 73, and these variants contain changes in NS1 ORF compared to the NS1 ORF of wild-type influenza B / Yamagata. Nucleotide deletions in the NS gene of B / 201 or B / 234 cause frame shifts, thereby resulting in the generation of shortened NS1 proteins. Influenza B / 201 and B / 234 virus NS1 proteins contain 110 and 89 amino acids corresponding to the N-terminal of B / Yamagata virus NS1 protein, respectively. Although the titer is lower than that of B / Yamagata virus, both B / 201 and B / 234 viruses grow in 6-day-old eggs. However, while B / Yamagata virus grew equally well in 8-day-old eggs, the growth of the other two viruses was significantly reduced in embryos of this age. Talon et al., PNAS, 97(8):4309-1314 (2000).

[0005] Hai et al., J. Virol., 82(21): 10580-10590 (2008) disclose influenza B virus truncated mutants of influenza B / Yamagata / 88. In order to generate different NS1 truncated mutants, a total of three influenza B / Yamagata / 88 virus NS1 mutants were constructed using pDZ plasmids: deltaNS1, NS1-80 and NS1-110. The length of the coding region of the influenza B / Yamagata / 88 virus NS1 gene is 846 nucleotides (corresponding to 282 amino acids). Deletions and sequence truncations corresponding to the NS1 C-terminus were performed in this fragment, thereby generating three constructs encoding amino acids 1 to 16 (deltaNS1), 1 to 80 (NS1-80) or 1 to 110 (NS1-110) of the NS1 protein. In these constructs, the open reading frame of NEP (nuclear export protein) was not changed. According to Hai et al., although the deltaNS1 virus grew more efficiently in Vero cells than in MDCK cells, the mutant virus exhibited lower peak titers than the rWT virus in IFN-deficient Vero cells as well as in MDCK cells.

[0006] Pica et al., J. Virol., 86(19): 10293-10301 (2012) disclosed recombinant virally expressed full-length NS1 protein (wild-type [WT] PR8) or the first 126 amino acids (NS1-126).

[0007] Novel strategies to develop more effective vaccines against influenza B viruses with the potential to provide broad cross-protective activity are needed.

[0008] It is an object of the present invention to provide a safer and more effective live attenuated influenza B vaccine.

[0009] It is also an object of the present invention to provide a method for generating mutant influenza B viruses with improved replication ability in an influenza vaccine production system.

[0010] It is a further object of the present invention to provide a method for replicating high titer live attenuated influenza B virus that can be used for vaccine applications.

[0011] It is a further object of the present invention to provide a method for eliciting an immune response against influenza B virus in a mammal.

[0012] Any discussion of documents, acts, materials, devices, articles or the like contained in this specification is not to be taken as an admission that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present disclosure as they existed before the priority date of each claim of this application.

[0013] Throughout this specification, the word "comprise" or variations such as "include" or "comprising" will be understood to imply the inclusion of stated elements, integers, steps or groups of elements, groups of integers or groups of steps, but not the exclusion of any other elements, integers, steps or groups of elements, groups of integers or groups of steps. Summary of the invention

[0014] Provided is a live attenuated influenza virus (LAIV) B "LAIVB"), i.e., LAVIB / DelNS1, from the Victoria lineage having a deletion of the viral virulence element NS1 (nonstructural protein 1). LAIVB / DelNS1 additionally includes adaptive nucleotide mutations (AM) in fragments 3 and 5-7, as described below: PA (T210C), NA T (1424C), NP (C182T), and M (A281G). These mutations are highlighted in the DNA sequence. LAIB / DelNS1 with adaptive mutations is referred to herein as AM / LAVIB / DelNS1. AM / LAVIB / DelNS1 preferably cannot replicate in interferon-competent cells such as A549 cells, and preferably replicates at a temperature such as below 37°C, more preferably between 30°C and 33°C, and most preferably at a low temperature of about 33°C. In particularly preferred embodiments, the disclosed LAIVB is characterized in that it replicates poorly in MDCK cells at 37°C when compared to its replication in MDCK cells at 33°C. In particularly preferred embodiments, the mutant LAIVB / DelLNS1 is capable of replicating at levels comparable to wild-type influenza virus of the same strain in a vaccine production system such as eggs or MDCK cells. For example, LAIVB / DelLNS1 is capable of replicating at greater than 10 7 Plaque forming units (pfu / ml) (e.g., at 10 7 -10 8 pfu / ml).

[0015] Also disclosed is a method for preparing LAIVB (i.e., AM / LAVIB / DelNS1) having a deletion of the viral virulence element NS1 protein and an adaptive mutation that allows the mutant strain to grow in a vaccine production system (such as eggs and MDCK cells). Preferred virus strains include B / Yamagata and B / Victoria. Preferred adaptive mutations are PA (T210C), NA T (1424C), NP (C182T) and M (A281G) in the Victoria strain. The method comprises (a) generating an influenza B virus having a deletion of the NS1 coding region by transfecting the DelNS1 influenza B virus into one or more vaccine production cells (b) rescuing LAVIB / DelNS1 and (c) passage the rescued virus in one or more vaccine production cells until the virus titer is stable to obtain AM / LAVIB / DelNS1.

[0016] The disclosed method preferably comprises reverse genetics. In a particularly preferred embodiment, a plasmid containing the deleted NS1 segment (DelNS1) and seven other genomic segments derived from an influenza B virus strain is transfected into a 293T / MDCK cell mixture. The rescued virus is passaged in MDCK cells until the virus titer stabilizes, wherein the virus titer remains unchanged for three consecutive passages. As used herein, no significant change refers to changes including no change or no statistically significant change. The full sequence of the growth-adapted DelNS1 influenza B virus is analyzed, and the acquired mutations are identified, such as Figure 1B The viruses were sequenced to identify adaptive mutations.

[0017] A pharmaceutical composition is also provided. The pharmaceutical composition includes the disclosed immunogenic AM / LAVIB / DelNS1 produced according to the disclosed method. The pharmaceutical composition generally includes an effective amount of virus to induce an immune response in the subject when administered to a subject in need. The pharmaceutical composition may include additional agents, such as adjuvants that enhance the immune response. In some embodiments, the pharmaceutical composition does not include an adjuvant. In one embodiment, the composition includes an effective amount of AM / LAVIB / DelNS1 from Victoria lineage influenza, with NS1 deletion and mutations in fragments 3 and 5-7 as follows: PA (T210C), NA T (1424C), NP (C182T) and M (A281G).

[0018] Also provided is a method for treating a subject by administering the pharmaceutical composition to a subject in need. The method can be a vaccine regimen. Therefore, in some embodiments, the pharmaceutical composition is administered to a subject to provide preventive or therapeutic protection against the virus itself (e.g., autoantigens) alone, or in combination with protection against infection from another virus, preferably another influenza virus A or B strain. The disclosed AM / LAVIB / DelNS1 generated according to the methods disclosed herein is administered to a mammal in need by subcutaneous (sc), intradermal (id), intramuscular (im), intravenous (iv), oral or intranasal administration; or by injection or by inhalation. In other aspects, the strain is administered intranasally. AM / LAVIB / DelNS1 is administered to a mammal in need of protective immunity against influenza infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1A and 1B The generation and characterization of the DelNS1 influenza B live attenuated virus vaccine is shown. Figure 1AIt is a diagram of the generation of DelNS1-8308B influenza B virus by reverse genetics. The pHW2000 plasmid containing the DelNS1 segment and the other seven genome segments derived from the B / Hong Kong / 8038 / 2011 (Victoria) virus was transfected into a 293T / MDCK cell mixture. The rescued virus was passaged in MDCK cells until the virus titer stabilized. Figure 1B Shown are the identified adaptive mutations in the growth-adapted DelNS1-8308B influenza B virus. Four mutations were identified in PA (T210C), NA T (1424C), NP (C182T) and M (A281G).

[0020] Figures 2A to 2D The results show that the DelNS1 virus was cultured at 37°C ( Figure 2A and 2C ) and 33℃( Figure 2B and 2D ) in MDCK( Figure 2A and 2B ) and A549( Figure 2C and 2D The growth kinetics in MDCK cells were estimated. DelNS1 influenza B virus was unable to replicate in A549 cells and replicated poorly in MDCK cells at 37°C. However, DelNS1 influenza B virus was able to replicate in MDCK cells at 33°C at levels comparable to wild-type influenza B virus.

[0021] Figure 3A and 3B Figure 2 shows protection of mice after lethal challenge with the DelNS1 influenza B vaccine, as measured by body weight after vaccination. 6 Mice were inoculated once via nasal drops with 5 × 10 pfu of influenza B virus. Three weeks later, mice were inoculated with mouse-adapted influenza B virus B / Florida / 4 / 2006 (Yamagata lineage, 5 × 10 5 TCID 50 )( Figure 3A ) or B / Brisbane / 60 / 2008 (Victoria pedigree, 5x10 6 TCID 50 )( Figure 3B The vaccinated mice were challenged with any of the above drugs. The body weight and survival rate of the mice were recorded for 2 weeks. Figure 3C and 3D Shown are mice vaccinated with either DelNS1 influenza B vaccine or PBS and exposed to B / Florida / 4 / 2006 ( Figure 3C) or B / Brisbane / 60 / 2008( Figure 3D ) Survival percentage of mice challenged with

[0022] Figure 4A and 4B Shown is the mouse adaptation virus B / Florida / 4 / 2006 ( Figure 4A ) or B / Brisbane / 60 / 2008( Figure 4B Comparison of viral titers in the lungs of mice immunized with DelNS1 influenza B live attenuated vaccine and control (PBS mock vaccination) on day 3 after immunization. DETAILED DESCRIPTION OF THE INVENTION

[0024] I. Definitions

[0025] Material

[0026] Materials, compositions, and components are disclosed that can be used in, used in conjunction with, used in the preparation of, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it should be understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed, while specific references to each different individual and collective combination and arrangement of these compounds may not be explicitly disclosed, each combination and arrangement is specifically contemplated and described herein. For example, if an aptamer is disclosed and discussed, and multiple modifications that can be made to multiple molecules or compositions that include the aptamer are discussed, then unless specifically indicated to the contrary, each possible combination and arrangement of the aptamer and these modifications is specifically contemplated. Thus, if a class of molecules A, B, and C is disclosed, and a class of molecules D, E, and F and examples of combined molecules AD are also disclosed, then each combination is considered individually or collectively even if each combination is not listed individually. Thus, in this example, each of the combinations AE, AF, BD, BE, BF, CD, CE, and CF is specifically contemplated and should be considered disclosed in terms of the disclosure of A, B, and C; D, E, and F; and the example combination AD. Likewise, subsets or combinations of these are also specifically contemplated and disclosed. Thus, for example, the subgroup of AE, BF, and CE is specifically contemplated and should be considered disclosed in terms of the disclosure of A, B, and C; D, E, and F; and the example combination AD. In addition, each of the materials, compositions, components, etc. contemplated and disclosed above may also be specifically and independently included or excluded from any group, subgroup, list, set, etc. of such materials. These concepts apply to all aspects of this application, including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are multiple additional steps that can be performed, it should be understood that each of these additional steps can be performed with any specific embodiment or combination of the embodiments of the disclosed methods, and each such combination is specifically contemplated and should be considered disclosed.

[0027] As used herein, the term "adjuvant" refers to a compound or mixture that enhances the immune response.

[0028] As described herein, "attenuation" refers to the process of weakening a pathogen (pathogen). An attenuated virus is a weakened, less viable virus. Vaccines against viral diseases can be prepared from attenuated, less virulent strains of the virus, viruses that can stimulate an immune response and produce immunity but do not cause disease or severe disease. Attenuation can be achieved by chemically treating the pathogen, by irradiation, or by genetic modification using methods known to those skilled in the art. Attenuation may result in decreased proliferation, attachment to host cells, or decreased toxin production or strength.

[0029] As used herein, "autologous" means derived from oneself.

[0030] The term "child" means a human or mammal between the ages of 0 months and 18 years, and a "young child" refers to a child less than 5 years old.

[0031] As used herein, the term "effective amount" or "therapeutically effective amount" means an amount sufficient to treat, inhibit or alleviate one or more symptoms of the disease state being treated or otherwise provide a desired pharmacological effect. The exact amount will vary according to multiple factors such as subject dependent variables (e.g., age, immune system health, etc.), disease, and subject age.

[0032] As used herein, the term "gene" refers to a nucleic acid (e.g., DNA or RNA) sequence that includes a coding sequence necessary to produce a polypeptide, RNA (e.g., including but not limited to mRNA, tRNA and rRNA) or precursor. The polypeptide, RNA or precursor may be encoded by the full-length coding sequence or any portion thereof. The term also encompasses the coding region of the structural gene and sequences located adjacent to the coding region on both the 5' end and the 3' end, adjacent to a distance of about 1 kb at each end, so that the gene corresponds to the length of the full-length mRNA. The term "gene" encompasses both cDNA and genomic forms of a gene that may be composed of DNA or RNA. The genomic form or clone of a gene may contain a coding region interrupted by a non-coding sequence called an "intron" or "intervening region" or "intervening sequence". Introns are gene fragments that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements, such as enhancers. Introns are removed or "spliced ​​out" from the nuclear or primary transcript; therefore, introns are absent from the messenger RNA (mRNA) transcript. During translation, the mRNA functions to specify the sequence or order of amino acids in a nascent polypeptide.

[0033] The term "immunogenic composition" or "composition" means that the composition can induce an immune response and is therefore antigenic. "Immune response" means any reaction by the immune system. These reactions include changes in the activity of the body's immune system in response to antigens, and can involve, for example, antibody production, induction of cell-mediated immunity, complement activation, or the formation of immune tolerance.

[0034] The term "nasal administration" refers to any form of administration whereby an active ingredient is propelled or otherwise introduced into the nasal passages of a subject such that it contacts the respiratory epithelium of the nasal cavity and is absorbed therefrom into the systemic circulation. Nasal administration may also involve contacting the olfactory epithelium at the top of the nasal cavity, located between the central nasal septum and the side walls of each major nasal passage. The area of ​​the nasal cavity immediately surrounding the olfactory epithelium is devoid of airflow. Therefore, specialized methods must generally be employed to achieve significant absorption onto the olfactory epithelium.

[0035] The terms "oral", "enteral", "enteral", "orally", "non-parenteral", "non-parenteral" and the like refer to administration of a compound or composition to a subject by a route or pattern along the digestive tract. Examples of "oral" routes of administration of a composition include, but are not limited to, swallowing a vaccine composition in liquid or solid form from the mouth, administering a vaccine composition through a nasojejunal or gastrostomy tube, administering a vaccine composition intraduodenally, and rectal administration (e.g., using a suppository that releases a live bacterial vaccine strain described herein).

[0036] As used herein, the term "mammal" includes both humans and non-humans, and includes, but is not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0037] The term "topical administration" refers to the application of a drug preparation to the outer surface of the skin or mucous membrane (including the surface membrane of the nose, lungs and mouth) so that the preparation passes through the outer surface of the skin or mucous membrane and enters the tissue below. Topical administration can result in limited distribution of the preparation in the skin and surrounding tissues, or, when the preparation is removed from the treatment area by the bloodstream, results in systemic distribution of the preparation. In a preferred form, the preparation is delivered by transdermal delivery (for example, using a transdermal patch). Transdermal delivery refers to the diffusion of the preparation on the skin (stratum corneum and epidermis) that acts as a barrier and rarely has the preparation able to penetrate. In contrast, the dermis is permeable for the absorption of many solutes and drugs, and therefore topical administration is more likely to occur by wiping off or otherwise peeling off the epidermis to expose the skin of the dermis. Before being applied to the skin, the absorption (a process referred to as smearing) by intact skin can be enhanced by combining the active preparation with an oily carrier (such as, for example, Remington's Pharmaceutical Sciences, current edition, Gennaro et al., described in eds., emulsions, emollients, penetration enhancers, etc.).

[0038] As used herein, the term "peptide" refers to a class of compounds consisting of amino acids chemically bound together. Generally speaking, amino acids are chemically bound together via amide bonds (CONH); however, amino acids can be bound together by other chemical bonds known in the art. For example, amino acids can be bound by amine bonds. As used herein, peptides include amino acid oligomers as well as small and large peptides, including polypeptides.

[0039] As used herein, "recombinant DNA" refers to DNA molecules extracted from different sources and chemically linked together; for example, DNA comprising genes from one source can be recombined with DNA from another source. Recombinant DNA can be all heterologous DNA, or a combination of homologous DNA and heterologous DNA. Recombinant DNA can be integrated into the chromosomes of the cell and expressed therefrom, or can be expressed for another chromosomal array (such as a plasmid).

[0040] As used herein, a "variant" or "mutated" polynucleotide or polypeptide contains at least one polynucleotide or polypeptide sequence change compared to the polynucleotide or polypeptide sequence of the corresponding wild-type or parent polynucleotide or polypeptide. Mutations can be natural, deliberate or accidental. Mutations include substitutions, deletions and insertions.

[0041] II. Composition

[0042] Immunogenic compositions comprising live attenuated influenza B (LAIVB) viruses are provided. The compositions are immunogenic in that they can be used to elicit an immune response to one or more antigens encoded by LAIVB. LAIVB has improved safety due to a deletion of the NS1 fragment (DelNS1) coding region and adaptive mutations (AM) that improve its growth in vaccine production systems. Influenza B viruses with these combinations of mutations are referred to herein as AM / LAVIB / DelNS1. The examples show that AM / LAVIB / DelNS1 viruses are nontoxic to mice even when challenged with the highest dose of virus ( Figure 3A and 3B AM / LAVIB / DelNS1 can be included in a formulation for administration, included in a carrier, and in some embodiments combined with an adjuvant. An adjuvant can be used as a carrier. In some embodiments, the immunogenic composition containing the disclosed AM / LAVIB / DelNS1 does not include an adjuvant.

[0043] A. Live attenuated virus

[0044] The influenza B virus genomes each contain eight negative-sense single-stranded viral RNA (vRNA) segments. The smallest vRNA segment of the two viruses encodes the nonstructural NS1 protein. The influenza B virus expresses a 281 amino acid nonstructural protein (called NS1-B) from the non-spliced ​​transcripts of the viral NS segment. The disclosed LAIVB preferably includes a complete deletion of the NS1 coding region in the LAIVB genome. AM / LAVIB / DelNS1 can be a Yamagata or Victoria lineage. During 1988 to 1989, two highly different influenza B antigenic variants were found in hemagglutination inhibition tests with infected ferret serum. These viruses are antigenically related to B / Victoria / 2 / 87 (the most recent reference strain) or B / Yamagata / 16 / 88 (a variant isolated in Japan in May 1988). During the winter epidemic from 1988 to 1989, all influenza B viruses isolated in the United States were antigenically related to B / Victoria / 2 / 87. Different influenza B virus strains are disclosed in the Influenza Research Database. Zhang et al., Nucleic Acids Research, Volume 45(D1):D466–D474, 2017.

[0045] There are eight segments of influenza B virus (and numbered in descending order of length) (Table 1). Each of segments 1, 3, 4 and 5 encodes only one protein: PB2, PA, HA and NP proteins.

[0046] Table 1. Influenza B virus segments and their encoded proteins

[0047]

[0048] All influenza viruses encode the polymerase subunit PB1 on segment 2.

[0049] The mutant influenza B viruses disclosed herein include a NS1 deletion and the following mutations: PA (T210C), NA (T1424C), NP (C182T), and M (A281G). The disclosed LAIV B can be easily distinguished from the virus described in US Pat. No. 8,592,196.

[0050] Similar mutations can be introduced into individual segments of other influenza B viruses; the sequences of the segments have been published. For example, the GenBank accession numbers of the nucleotide sequences of various influenza B virus segment 7 are: DQ792908.1 (influenza B virus (B / Lee / 40) cold-adapted M1 protein (M1) and BM2 protein (BM2) genes, complete cds); M20175.1 (influenza B / Ann Arbor / 1 / 66 (cold-adapted) membrane protein M1 (segment 7) RNA, complete cds); CY018758.1 (influenza B virus (B / Victoria / 02 / 1987) segment 7, complete sequence); CY018686.1 (influenza B virus (B / Hong Kong / 1434 / 2002) segment 7, complete sequence.

[0051] B. Adjuvant

[0052] The disclosed LAIV can be administered in combination with other immunomodulators, including adjuvants. Useful adjuvants include, but are not limited to, one or more of the following:

[0053] The inorganic substance containing adjuvant composition includes inorganic salts, such as aluminum salts and calcium salts. Exemplary inorganic salts include hydroxides (e.g., hydroxyhydroxides), phosphates (e.g., hydroxyphosphates, orthophosphates), sulfates, etc., or mixtures of different inorganic compounds (e.g., mixtures of phosphate and hydroxide adjuvants, optionally with excess phosphate), wherein the compound takes any appropriate form (e.g., gel, crystalline, amorphous, etc.), and preferably adsorption of salts. The inorganic substance containing composition can also be formulated as metal salt particles (WO / 0023105). Aluminum salts can be included in the composition of the present invention so that Al 3+ The dosage is between 0.2 and 1.0 mg per dose.

[0054] Oil emulsion adjuvants suitable for use as adjuvants in the present invention may include squalene-water emulsions, such as MF59 (5% squalene, 0.5% Tween 80 and 0.5% Span 85, formulated into submicron particles using a microfluidizer). See, for example, WO90 / 14837 and Podda, Vaccine 19:2673-2680, 2001. Additional adjuvants for the composition are submicron oil-in-water emulsions. Examples of submicron oil-in-water emulsions used herein include squalene / water emulsions optionally containing different amounts of MTP-PE, such as 4 to 5% w / v squalene, 0.25 to 1.0% w / v Tween 80 (polyoxyethylene sorbitan monooleate) and / or 0.25 to 1.0% Span 85 (sorbitan trioleate), and optionally N-acetylmuramoyl-L-alanyl-D-isoglutamido-L-alanine-2-(1'-2'-dipalmitoyl-s--N-glyceryl-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), for example, a submicron oil-in-water emulsion known as "MF59" (International Publication No. WO90 / 14837; U.S. Pat. Nos. 6,299,884 and 6,451,325, which are incorporated herein by reference in their entireties. MF59 may contain 4 to 5% w / v squalene (e.g., 4.3%), 0.25 to 0.5% w / v Tween 80 and 0.5% w / v Span 85, and optionally containing different amounts of MTP-PE, using microfluidics such as 110Y type microfluidics (Microfluidics, Newton, Mass.) to be mixed into submicron particles. For example, MTP-PE can be present in an amount of about 0 to 500 μg / dose, or 0 to 250 μg / dose, or 0 to 100 μg / dose. Submicron oil-in-water emulsions, methods for preparing them, and immunostimulatory preparations (such as muramyl peptides) for said compositions are described in detail in International Publication No. WO90 / 14837 and U.S. Patent No. 6,299,884 and 6,451,325.

[0055] Complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA) can also be used as adjuvants in the present invention.

[0056] Saponin adjuvant formulations can also be used as adjuvants of the present invention.Saponin is a heterogeneous group of sterol glycosides and triterpene glycosides present in the bark, leaves, stems, roots, and even flowers of various plant species.Saponin from Quillaia saponariaMolina has been widely studied as an adjuvant.Saponin can also be purchased from Smilax ornata (sarsaprilla), Gypsophilla paniculata (brides veil), and Saponaria officianalis (soap root).Saponin adjuvant formulations can include purified formulations such as QS21 and lipid formulations such as immunostimulatory complexes (ISCOMs; see below).High performance thin layer chromatography (HPLC) and reverse phase high performance liquid chromatography (RP-HPLC) have been used to purify saponin compositions. Specific fractions purified with these techniques have been identified, including QS7, QS17, QS18, QS21, QH-A, QH-B and QH-C. The method for producing QS21 is disclosed in U.S. Patent No. 5,057,540. Saponin formulations can also contain sterols, such as cholesterol (see WO96 / 33739). Compositions of saponins and cholesterol can be used to form unique particles known as ISCOMs. ISCOMs typically also include phospholipids, such as phosphatidylethanolamine or phosphatidylcholine. Any known saponin can be used for ISCOMs. For example, ISCOMs can include one or more of Quil A, QHA and QHC. ISCOMs are described in EP0109942, WO96 / 11711 and WO96 / 33739. Optionally, ISCOMs can be free of additional detergents. See WO00 / 07621. A description of the development of saponin-based adjuvants can be found in Barr et al., "ISCOMs and other saponinbased adjuvants", Advanced Drug Delivery Reviews 32:247-27, 1998. Also, see Sjolander et al., "Uptake and adjuvant activity of orally delivered saponin and ISCOM vaccines", Advanced Drug Delivery Reviews 32:321-338, 1998.

[0057] Virions and virus-like particles (VLPs) can also be used as adjuvants. These structures usually contain one or more proteins from viruses that are optionally combined with phospholipids or prepared together. They are usually non-pathogenic, non-replicative, and usually do not contain any one in the local viral genome. Viral proteins can be recombinantly produced or separated from the whole virus. These viral proteins suitable for virions or VLPs include proteins derived from the following: influenza virus (such as HA or NA), hepatitis B virus (such as core protein or capsid protein), hepatitis E virus, measles virus, Sindbis virus, rotavirus, foot-and-mouth disease virus, retrovirus, Norwalk virus, human papillomavirus, HIV, RNA phage, QB phage (such as coat protein), GA phage, fr phage, AP205 phage and Ty (such as retrotransposon Ty protein pl).

[0058] Bacterial or microbial derivatives suitable for use as adjuvants include: (i) non-toxic derivatives of enterobacterial lipopolysaccharide (LPS); (ii) lipid derivatives, (iii) immunostimulatory oligonucleotides and ADP-ribosylating toxins and detoxified derivatives thereof, (iv) ADP-ribosylating toxins and detoxified derivatives thereof. Examples of non-toxic derivatives of LPS monophosphoryl lipid A (MPL) and 3-O-deacylated MPL (3dMPL). 3dMPL is a mixture of 3 de-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains. Examples of "small particle" forms of 3-de-O-acylated monophosphoryl lipid A are disclosed in EP 0 689 454. Such "small particles" of 3dMPL are small enough to be sterile filtered through a 0.22 micron membrane (see EP 0 689 454). Other non-toxic LPS derivatives include monophosphoryl lipid A mimetics, such as aminoalkyl glucosaminide phosphate derivatives, for example, RC-529 (Johnson et al., Bioorg Med Chem Lett, 9: 2273-2278, 1999). Examples of lipid A derivatives may include derivatives of lipid A from Escherichia coli, such as OM-174. For example, OM-174 is described in Meraldi et al., "OM-174, a New Adjuvant with a Potential for Human Use, Induces a Protective Response with Administered with the Synthetic C-Terminal Fragment 242-310 from the circumsporozoite protein of Plasmodium berghei", Vaccine 21:2485-2491, 2003; and Pajak et al., "The Adjuvant OM-174 induces both the migration and maturation of murine dendritic cells in vivo", Vaccine 21:836-842, 2003. Examples of immunostimulatory oligonucleotide nucleotide sequences containing a CpG motif (a sequence containing an unmethylated cytosine followed by a guanosine and linked by a phosphate bond). Bacterial double-stranded RNA or oligonucleotides containing palindromic or poly (dG) sequences have also been shown to be immunostimulatory.

[0059] CpG's can include nucleotide modifications / analogs (such as thiophosphate modifications) and can be double-stranded or single-stranded. Optionally, guanosine can be replaced by an analog (such as 2'-deoxy-7-deazaguanosine). Examples of analog replacements are shown in Kandimalla et al., "Divergent synthetic nucleotide motif recognition pattern: design and development of potent immunomodulatory oligodeoxyribonucleotide agents with distinct cytokine induction profiles", Nucleic Acids Research 31: 2393-2400, 2003; WO02 / 26757 and WO99 / 62923. The adjuvant effect of CpG oligonucleotides is further discussed in Krieg, Nature Medicine (2003) 9 (7): 831-835; McCluskie et al., FEMS Immunology and Medical Microbiology (2002) 32: 179-185; WO98 / 40100; U.S. Pat. No. 6,207,646; U.S. Pat. No. 6,239,116 and U.S. Pat. No. 6,429,199. CpG sequences can be directed to Toll-like receptors (TLR9), such as the motifs GTCGTT or TTCGTT. See Kandimalla et al., "Toll-like receptor 9: modulation of recognition and cytokine induction by novel synthetic CpG DNAs", Biochemical Society Transactions (2003) 31 (part 3): 654-658. CpG sequences can be specifically used to induce Th1 immune responses, such as CpG-A ODN, or they can be more specifically used to induce B cell responses, such as CpG-B ODN. CpG-A and CpG-B ODNs are discussed in Blackwell et al., J.Immunol.170:4061-4068, 2003; Krieg, TRENDS in Immunology 23:64-65, 2002; and WO01 / 95935. In some aspects, CpG oligonucleotides can be constructed so that the 5' end is easy for receptor recognition. Optionally, two CpG oligonucleotide sequences can be attached at their 3' ends to form an "immunobody".See, e.g., Kandimalla et al., BBRC 306:948-95, 2003; Kandimalla et al., Biochemical Society Transactions 31:664-658, 2003; Bhagat et al., "BBRC 300:853-861, 2003; and WO03 / 035836. Bacterial ADP-ribosylating toxins and detoxified derivatives thereof can be used as adjuvants of the present invention. For example, the toxin can be derived from Escherichia coli (E. coli) (i.e., E. coli heat-labile enterotoxin (LT)), cholera (CT) or pertussis (PTX). The use of detoxified ADP-ribosylating toxins as mucosal adjuvants is described in WO95 / 17211, and the use as parenteral adjuvants is described in WO98 / 42375. In some aspects, the adjuvant can be a detoxified LT mutant, such as LT-K63, LT-R72, and LTR192G. The use of ADP-ribosylating toxins and their detoxified derivatives (particularly LT-K63 and LT-R72) as adjuvants can be found in the following references, each of which is expressly incorporated herein by reference in its entirety: Beignon et al., Infection and Immunity 70:3012-3019, 2002; Pizza et al., Vaccine 19:2534-2541, 2001; Pizza et al., Int. J. Med. Microbiol 290:455-461, 2003; Scharton-Kersten et al., Infection and Immunity 68:5306-5313, 2000; Ryan et al., Infection and Immunity 67:6270-6280, 2003; Partidos et al., Immunol. Lett. 67:09-216, 1999; Peppoloni et al., Vaccines 2:285-293, 2003; and Pine et al., J. Control Release 85:263-270, 2002.

[0060] Bioadhesives and mucus adhesives can also be used as adjuvants of the present invention. Suitable bioadhesives can include esterified hyaluronic acid microspheres (Singh et al., J. Cont. Rel. 70: 267-276, 2001) or mucus adhesives, such as cross-linked derivatives of poly (acrylic acid), polyvinyl alcohol, polyvinyl alcohol pyrrolidone, polysaccharides and carboxymethyl cellulose. For example, chitosan and its derivatives disclosed in WO99 / 27960 can also be used as adjuvants of the present invention.

[0061] Adjuvant microparticles: Microparticles can also be used as adjuvants. Microparticles (i.e., particles with a diameter of about 100 nm to about 150 μm, or a diameter of 200 nm to about 30 μm, or a diameter of about 500 nm to about 10 μm) formed from biodegradable and / or non-toxic materials (e.g., poly(α-hydroxy acid), polyhydroxybutyric acid, polyorthoesters, polyanhydrides, polycaprolactones, etc.), among which poly(lactide-co-glycolide) is envisioned, are optionally treated to have a negatively charged surface (e.g., with SDS) or a positively charged surface (e.g., with a cationic detergent such as CTAB).

[0062] Examples of liposome formulations suitable for use as adjuvants are described in US Pat. No. 6,090,406, US Pat. No. 5,916,588 and EP 0 626 169.

[0063] Other adjuvants include polyoxyethylene ethers and polyoxyethylene esters. WO99 / 52549. Such formulations may further include polyoxyethylene sorbitan ester surfactants (WO 01 / 21207) combined with octoxynol and polyoxyethylene alkyl ether or ester surfactants (WO01 / 21152) combined with at least one additional nonionic surfactant (such as octoxynol). In some aspects, polyoxyethylene ethers may include: polyoxyethylene-9-lauryl ether ether (laureth 9), polyoxyethylene-9-steryl ether, polyoxyethylene-8-steryl ether, polyoxyethylene-4-lauryl ether, polyoxyethylene-35-lauryl ether, or polyoxyethylene-23-lauryl ether.

[0064] PCPP formulations for use as adjuvants are described, for example, in Andrianov et al., Biomaterials 19: 109-115, 1998. 1998. Examples of muramyl peptides suitable for use as adjuvants in the present invention may include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-1-alanyl-d-isoglutamine (nor-MDP), and N-acetylmuramyl-1-alanyl-d-isoglutamido-1-alanine-2-(1'-2'-dipalmitoyl-s--n-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE). Examples of imidazoquinolone compounds suitable for use as adjuvants of the present invention may include imiquimod and its homologues further described in Stanley, "Imiquimod and the imidazoquinolones: mechanism of action and therapeutic potential" Clin Exp Dermatol 27:571-577, 2002 and Jones, "Resiquimod 3M", Curr Opin Investig Drugs 4:214-218, 2003. Human immunomodulators suitable for use as adjuvants of the present invention may include cytokines such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g., interferon gamma), macrophage colony stimulating factor, and tumor necrosis factor.

[0065] Adjuvant composition: The adjuvant is used as a composition in a preferred embodiment. For example, the adjuvant composition may include: saponin and oil-in-water emulsion (WO99 / 11241); saponin (e.g., QS21) plus a non-toxic LPS derivative (e.g., 3dMPL) (see WO94 / 00153); saponin (e.g., QS21) plus a non-toxic LPS derivative (e.g., 3dMPL) plus cholesterol; saponin (e.g., QS21) plus 3dMPL plus IL-12 (optionally with sterols) (WO98 / 57659); a composition of 3dMPL with, for example, QS21 and / or an oil-in-water emulsion (see European Patent Applications 0835318, 0735898 and 0761231); SAF containing 10% squalane, 0.4% Tween 80, 5% Plronic block polymer L121, and thr MDP, or microfluidization into submicron emulsion or vortexing to generate larger particle size emulsion. Ribi adjuvant system (RAS) containing 2% squalene, 0.2% Tween 80, and one or more bacterial cell wall components (Ribi Immunochem), the bacterial cell wall components are from the group consisting of monophosphoryl lipid A (MPL), trehalose dimycolate (TDM) and cell wall skeleton (CWS), preferably MPL + CWS (Detox); and one or more inorganic salts (such as aluminum salts) plus LPS non-toxic derivatives (such as 3dPML).

[0066] Aluminum salts and MF59 are examples of adjuvants for injectable influenza vaccines. Bacterial toxins and bioadhesives are examples of adjuvants for mucosal delivery of vaccines (such as nasal vaccines). All of the above adjuvants and other adjuvants generally known to those of ordinary skill in the art can be formulated using techniques known in the art for intranasal administration.

[0067] C. Formulations and Carriers

[0068] Compositions of the present invention can be formulated into pharmaceutical compositions.Except one or more strains, these pharmaceutical compositions can also include pharmaceutically acceptable excipients, carriers, buffers, stabilizers or other materials known to those of ordinary skill in the art.Such materials should be nontoxic usually and should not interfere with the effect of the active ingredient usually.The exact nature of the carrier or other materials can depend on the route of administration, such as oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular or intraperitoneal routes.

[0069] Pharmaceutical compositions for oral administration can be in tablet, capsule, powder or liquid form. Tablets can include solid carriers (such as gelatin) or adjuvants. Liquid pharmaceutical compositions generally include liquid carriers, such as water, petroleum, animal and vegetable oils, mineral oils or synthetic oils. Physiological saline solutions, glucose or other sugar solutions or glycols (such as ethylene glycol, propylene glycol or polyethylene glycol) can be included. The term "carrier" refers to a diluent, adjuvant, excipient or carrier for administering a pharmaceutical composition (e.g., immunogenic or vaccine formulation). Saline solutions, as well as aqueous glucose and glycerol solutions can also be used as liquid carriers, particularly injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, powdered matter, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, skim milk powder, glycerol, ethanol, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EWMartin. The formulation should be selected according to the mode of administration.

[0070] For intravenous, cutaneous or subcutaneous injection, or injection at the site of pain, the active ingredient will be in the form of a parenterally acceptable aqueous solution that is pyrogen-free and has a suitable pH, isotonicity and stability. Those skilled in the art will be well able to prepare suitable solutions using, for example, isotonic carriers such as sodium chloride injection, Ringer's injection or lactated Ringer's injection. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included as needed.

[0071] Preferably, the drug is administered in a "therapeutically effective amount" or a "prophylactically effective amount" (although prevention can be considered treatment, depending on the circumstances), which is sufficient to show benefit to the individual. The actual dosage, dosage rate, and administration time course will depend on the nature and severity of the disease being treated. It is the responsibility of general practitioners and other physicians to formulate treatment plans (e.g., determine dosages, etc.), and generally take into account the disease to be treated, the symptoms of the individual patient, the delivery site, the method of administration, and other factors known to the physician. Examples of the above techniques and protocols can be found in the latest edition of Remington's Pharmaceutical Science, Mack Publishing Company, Easton, Pa. ("Remington's").

[0072] III. Preparation Method

[0073] A scheme for engineering AM / LAVIB / DelNS1 virus is provided. The scheme includes (a) generating an influenza B virus in which the coding region of the NS1 gene is removed from its genome by transfecting eight plasmids (preferably pHW2000 plasmids) into one or more vaccine production cells, wherein the eight plasmids contain the genome of the DelNS1 influenza B virus, including a plasmid expressing the NS1 protein (b) rescuing the LAVIB / DelNS1 virus (c) passage the rescued virus into one or more vaccine production cells at 33° C. and 37° C., respectively, until the virus titer is stable (e.g., when the virus titer remains unchanged for three consecutive generations) to obtain AM / LAVIB / DelNS1, and (c) analyzing the presence of the desired mutation.

[0074] The complete sequence of the growth-adapted DelNS1 influenza B virus was analyzed and compared with the sequence of the parent strain to identify the acquired mutations. The coding region of the NS1 gene was removed from the viral genome without affecting the expression of other essential genes for viral replication (e.g. Figure 1A As shown). In a preferred embodiment, the virus in step b is cultured in a mixture of two or more cells (e.g., 293T / MDCK cells). The disclosed method for preparing LAIVB results in the deletion of the viral virulence element NS1 protein and adaptive mutations that allow the mutant strain to grow in a vaccine production system (such as eggs and MDCK cells). Preferred adaptive mutations are PA (T210C), NA T (1424C), NP (C182T) and M (A281G) mutations. The disclosed method preferably includes reverse genetics. Seven other plasmids containing the deleted NS1 fragment (DelNS1) and genomic fragments derived from influenza B virus strains are transfected into a 293T / MDCK cell mixture. Preferred virus strains include B / Yamagata and B / Victoria rescue viruses, which are passaged in MDCK cells until the virus titer is stable, until a high level of virus titer is obtained and remains unchanged for at least three consecutive generations. The virus is sequenced to determine the adaptive mutation.

[0075] The coding region of the NS1 gene can be removed using methods known in the art. The method of introducing targeted mutations into the genome or into the virus in a virological context is attributed to the term reverse genetics (RG), and for example, in Hoffmann et al., Proc Natl Acad Sci USA, 97 (11): 6108-13 Zheng et al., J. Virol. 89 (20): 10273-85 and Dauber et al., J. Virol., 78 (4): 1865-1872 (2004) Described, its materials and methods are incorporated herein by reference. This article summarizes and summarizes the method for generating influenza viruses with NS1 coding region deletions as disclosed by Dauber et al.

[0076] Generation of influenza B virus with the coding region of the NS1 gene removed

[0077] RT-PCR and plasmid construction

[0078] The RNeasy kit (Qiagen) can be used according to the manufacturer's protocol to extract viral RNA from influenza B virus stocks. Eight reverse genetics plasmids were constructed by amplifying individual viral RNA fragments by reverse transcriptase PCR (RT-PCR) and cloning the resulting cDNAs into plasmid pHW2000: pHW-PB2, pHW-PB1, pHW-PA, pHW-HA, pHW-NP, pHW-NA, pHW-M1, and pHW-NS1 (Table 1). All eight plasmids can be used to generate wild-type influenza B virus. The primers used in the PCR amplification are listed in Table 2 below:

[0079] Table 2

[0080] Flub-pb1-lic-S (SEQ ID NO: 9) CcgaagttgggggggAGCAGAAGCGGAGC Flub-pb1-lic-as (SEQ ID NO: 10) GGCCGCCGGGTTATTAGTAGAAACACGAGC Flub-pb2-lic-S (SEQ ID NO: 11) CcgaagttgggggggAGCAGAAGCGGAGC Flub-pb2-lic-as (SEQ ID NO: 12) GGCCGCCGGGTTATTAGTAGAAACACGAGC Flub-pa-lic-S (SEQ ID NO: 13) CcgaagttgggggggAGCAGAAGCGGTGC Flub-pa-lic-as (SEQ ID NO: 14) GGCCGCCGGGTTATTAGTAGAAACACGTGC Flub-ha-lic-S (SEQ ID NO: 15) CcgaagttgggggggAGCAGAAGCAGAGC Flub-ha-lic-as (SEQ ID NO: 16) GGCCGCCGGGTTATTAGTAGTAACAAGAGC Flub-na-lic-S (SEQ ID NO: 17) CcgaagttgggggggAGCAGAAGCAGAGC Flub-na-lic-as (SEQ ID NO: 18) GGCCGCCGGGTTATTAGTAGTAACAAGAGC Flub-np-lic-S (SEQ ID NO: 19) CcgaagttgggggggAGCAGAAGCACAGC Flub-np-lic-as (SEQ ID NO: 20) GGCCGCCGGGTTATTAGTAGAAACAACAGC Flub-m-lic-S (SEQ ID NO: 21) CcgaagttgggggggAGCAGAAGCACGCACTT Flub-m-lic-as (SEQ ID NO: 22) GGCCGCCGGGTTATTAGTAGAAACAACGCACTT Flub-ns-lic-S (SEQ ID NO: 23) CcgaagttgggggggAGCAGAAGCAGAGGATT Flub-ns-lic-as (SEQ ID NO: 24) GGCCGCCGGGTTATTAGTAGTAACAAGAGGATT Flub-delns1-F (SEQ ID NO: 25) CTCAAT TT GTGTTGTGGTC ATG Flub-delns1-R (SEQ ID NO: 26) TGGAGGATGAAGAAGATGGCCATCGGATCCTC

[0081] The coding region of the influenza B virus NS1 protein partially overlaps with the reading frame of the NEP / NS2 protein expressed from the grafted transcript of the viral NS gene segment. To generate NS1-deficient influenza virus, a derivative of the NS reverse genetics plasmid (referred to as pHW-Lee-ΔNS1-B) was prepared in which the sequence specifying the NS1 protein was deleted, while all NEP / NS2 coding sequences and terminal non-coding regions were retained. For example, to generate the pHW-DelNS1-B plasmid, polyadenylated RNA was extracted from MDCK cells infected with influenza B virus using the Oligotex direct mRNA Midi / Maxi Kit (Qiagen) for RT-PCR amplification and NS segment-specific primers. The amplified NEP / NS2 fragment was purified using the QiaEx II gel extraction kit (Qiagen), digested with BsmBI, and cloned into pHW2000.

[0082] These plasmids promote the bidirectional transcription of negative-sense viral RNAs and positive mRNAs, because the upstream side of the cloned viral cDNAs is connected to the human RNA polymerase I promoter, and the downstream side is connected to the RNA polymerase II specific promoter. In short, the viral RNAs are reverse transcribed first with Moloney murine leukemia virus reverse transcriptase (Promega) by using a universal nine-nucleotide primer (UNI-9) complementary to the conserved 3' end of all eight viral RNA segments. The RT reaction was carried out at 37°C for 60 minutes and then at 70°C for 15 minutes. Subsequently, individual gene fragments were amplified by PCR, which used Pfu Turbo polymerase (Roche Diagnostics) and fragment-specific primers carrying BsmBI (PB1, PB2, PA, NA, M and NS), BspMI (NP) or AarI (HA) restriction site sequences at the 5' end. pHW-NS-Xho is a derivative of pHW-NS, which was constructed using the QuikChange mutagenesis kit (Stratagene) by introducing a novel XhoI recognition site in the viral NS segment at nucleotides 262 to 267. The NS segment of the transfected virus was engineered to carry an engineered genetic marker site, making the corresponding cDNA susceptible to cleavage by the restriction endonuclease XhoI, thereby verifying the recombinant nature of the isolate.

[0083] Transfection-mediated recovery of recombinant influenza B virus.

[0084] To generate recombinant influenza B wild-type viruses, eight plasmids, pHW-PB2, pHW-PB1, pHW-PA, pHW-HA, pHW-NP, pHW-NA, pHW-M, and pHW-NS-XhoI (0.5 μg each), were transfected into suspended 10 6 293T cells. 72 hours after transfection, the supernatant of the transfected cells was inoculated into the allantoic cavity of 11-day-old chicken eggs to grow the stock of recombinant virus. The supernatant of the transfected cells carrying the mutant plasmid can be passaged into 6-day-old chicken eggs. The recovery of the recombinant influenza B virus can be verified by gel electrophoresis analysis of the RT-PCR product representing the viral NS segment.

[0085] The plasmids are preferably transfected into a mixture of cells (eg, 293T / MDCK cells) to grow stocks of recombinant virus. Figure 1A DelNS1 virus can be rescued by essentially the same procedure, except that pHW-NS-XhoI is replaced by pHW-ΔNS1-B and 0.5 μg of NS1 expression vector (e.g., pcDNA-NS1) is added to the transfection mixture. To construct plasmid pcDNA-NS1-B, NS1 cDNA can be PCR amplified using pHW-leen-NS as a template and cloned between the HindIII / XhoI sites of pcDNA3.

[0086] Influenza B viruses completely lacking the NS1 ORF disclosed in Dauber et al., J. Virol., 78:1865-1872 (2004) did not replicate efficiently in Vero cells (respectively, using an moi of 0.1 and titers of 1.7-2.5*10 2 FFU / ml, with no detectable titer at an moi of 0.001). The influenza B NS1 deletion mutant consisting of the amino-terminal 16 amino acids was also highly attenuated in replication, with a maximum titer of approximately 10 4 FFU / ml. (Hai et al.; Journal of Virology; November 2008, p.10580-90)

[0087] Cultivation of rescued viruses to obtain influenza B viruses with growth comparable to wild type

[0088] The rescued DelNS1 virus was cultured in virus producer cells until the virus titer was stable, as evidenced by a constant titer for at least three serial passages in MDCK cells and eggs. Figure 1A, transfected cell supernatants were collected 72 hours later and passaged in MDCK cells.

[0089] The preferred cell for going down to posterity is MDCK (Madin-Darby canine kidney) cell. However, the cell for using culture medium to cultivate virus can be a cell that can be grown in vitro in a synthetic medium and can be used for virus propagation. These can be, for example, BSC-1 cell, LLC-MK cell, CV-1 cell, CHO cell, COS cell, mouse-derived cell, human cell, HeLa cell, 293 cell, VERO cell, MDBK cell, MDOK cell, CRFK cell, RAF cell, TCMK cell, LLC-PK cell, PK15 cell, WI-38 cell, MRC-5 cell, T-FLY cell, BHK cell, SP2 / 0 cell, NSO, PerC6 (human retinal cell), chicken embryo cell or derivative, embryonated egg cell, embryonated chicken egg or its derivative.

[0090] The culture medium used for producing the virus may be any culture medium known in the prior art as being suitable for virus culture. Preferred culture media are synthetic media. This may be, for example, basal media such as modified Eagle's medium MEM, minimal essential medium MEM, Dulbecco's modified Eagle's medium D-MEM, D-MEM-F12 medium, William's E medium, RPMI medium and their analogs and derivatives. These may also be specialized cell culture and virus growth media such as VP-SFM, OptiPro TM SFM、AIM Culture medium, HyQ SFM4 MegaVir TM 、EX-CELL TM Vero SFM, EPISERF, ProVero, any 293 or CHO medium and their analogs and derivatives. These media may be supplemented with any additives known in the art suitable for cell and virus culture, for example, animal serum and its fractions or analogs, amino acids, growth factors, hormones, buffers, trace elements, trypsin, sodium pyruvate, vitamins, L-glutamine and biological buffers. A preferred medium is OptiPRO supplemented with L-glutamine and trypsin. TM SFM.

[0091] Therefore, the disclosed method includes culturing the virus for an effective amount of time to obtain a stable virus titer. In a preferred embodiment, the rescued virus is passaged in virus production cells (e.g., MDCK cells) for a period of time until the virus titer remains unchanged after 3 consecutive passages. The culture period can be in the range of 10 to 50 passages, preferably, more than 20 passages at 33°C. The time and conditions of culture lead to adaptive mutations, which allow LAIVB to replicate in a vaccine production system (such as eggs or MDCK).

[0092] The examples show mutations in PA (T210C), NA (T1424C), NP (C182T) and M (A281G) that support DelNS1 influenza B virus replication in embryonated chicken eggs or in the vaccine production cell line MDCK cells for the tested virus strains ( Figure 1B The DelNS1 influenza B live attenuated virus with adaptive mutations was able to replicate to levels comparable to wild-type virus in vaccine production systems (eggs or MDCK cells) ( Figure 2B ). DelNS1 live attenuated virus cannot replicate in interferon-competent A549 cells. This is a safety property that can prevent the vaccine recipient from becoming infected with the virus ( Figure 2C and 2D The DelNS1 influenza B virus replicates preferentially at lower temperatures (e.g., 33°C, which simulates the upper respiratory tract), but not at 37°C, which simulates the lower respiratory tract. Figure 2C ) is restricted. This property of the DelNS1 influenza B virus used as a human vaccine is an additional safety feature ( Figure 2C ).

[0093] IV. How to use

[0094] The disclosed AM / LAVIB / DelNS1 can be used to effectively increase viral titer or cause immune response in a subject in need thereof. In some aspects, the subject can include an elderly person (e.g., greater than 65 years old), a young child (e.g., less than 5 years old). The method for improving children's immune response using adjuvant formulations is disclosed, for example, in U.S. Publication No. 2017 / 0202955.

[0095] LAIVB can generally be administered directly to a mammal in need thereof to increase viral titer and elicit an immune response in the mammal. The Examples demonstrate that immunization with one lineage of influenza B vaccine (the Victoria lineage) can protect mice from lethal challenge with either the Victoria or Yamagata lineages of mouse-adapted influenza B virus ( Figure 3A and 3B ).

[0096] The virus is usually administered to a patient in need thereof in the form of a pharmaceutical composition. The pharmaceutical composition containing the virus can be used for systemic or local administration. The dosage form for administration by parenteral (intramuscular (IM), intraperitoneal (IP), intravenous (IV) or subcutaneous injection (SC)) or transmucosal (nasal cavity, vagina, lung or rectum) administration route can be formulated. In the most preferred embodiment, the immune virus is delivered peripherally by intranasal or by intramuscular injection, and the therapeutic virus is delivered by local injection.

[0097] Direct delivery can be achieved by parenteral injection (e.g., subcutaneously, intraperitoneally, intradermally, intravenously, intramuscularly, or to the interstitial space of a tissue), or mucosal administration (such as by rectal, oral (e.g., tablets, sprays), vaginal, topical, transdermal (see, e.g., WO99 / 27961) or transdermal (see, e.g., WO02 / 074244 and WO02 / 064162), inhalation, intranasal (see, e.g., WO03 / 028760), ocular, aural, pulmonary or other mucosal administration). The composition can also be topically administered to the skin surface by direct transfer. Topical administration can be achieved without the use of any device or by contacting bare skin with the composition using a bandage or bandage-like device (see, e.g., U.S. Pat. No. 6,348,450). In some aspects, the mode of administration is parenteral, mucosal, or a combination of mucosal and parenteral immunization. In other aspects, the mode of administration is parenteral, mucosal, or a combination of mucosal and parenteral immunizations for a total of 1 to 2 vaccinations 1 to 3 weeks apart. In related aspects, routes of administration include, but are not limited to, intranasal delivery.

[0098] 1. Effective amount

[0099] The composition is usually administered in an effective amount to induce an immune response to one or more antigens encoded by the virus. For example, an effective amount of the virus usually results in the production of antibodies and / or activated T cells that kill or limit the proliferation or infection of the virus.

[0100] The composition can generally be used to cause systemic and / or mucosal immunity, such as causing enhanced systemic and / or mucosal immunity. For example, the immune response can be characterized by inducing serum IgG and / or intestinal IgA immune responses. Typically, the level of protection against influenza infection can be 50% or more, for example, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. In one aspect, the level of protection can be 100%.

[0101] The immune response induced by the present invention can be one or both of a TH1 immune response and a TH2 response. The immune response can be an improved or enhanced or altered immune response. The immune response can be one or both of a systemic immune response and a mucosal immune response. For example, the immune response can be an enhanced systemic and / or mucosal response. The enhanced systemic and / or mucosal immunity is reflected in the enhanced TH1 and / or TH2 immune response. For example, the enhanced immune response can include an increase in IgG1 and / or IgG2a and / or IgA production. On the other hand, the mucosal immune response can be a TH2 immune response. For example, the mucosal immune response can include an increase in IgA production.

[0102] Generally, activation TH2 cells enhance antibody production, and therefore have value in coping with extracellular infection.Activation TH2 cells can usually secrete one or more of IL-4, IL-5, IL-6 and IL-10.TH2 immune response can also cause the production of IgG1, IgE, IgA and / or memory B cells, for future protection.Generally speaking, TH2 immune response can include one or more cytokines (such as IL-4, IL-5, IL-6 and IL-10) associated with TH2 immune response to increase or IgG1, IgE, IgA and memory B cells to produce one or more of increase.For example, the enhanced TH2 immune response can include IgG1 to produce increase.TH1 immune response can include CTLs increase, one or more cytokines (such as IL-2, IFN-γ and TNF-α) associated with TH1 immune response to increase, activated macrophages increase, NK activity increase or IgG2a to produce one or more of increase.For example, the enhanced TH1 immune response can include IgG2a to produce increase.

[0103] The LAIVB strain can be used alone or in combination with other agents, optionally in combination with immunomodulators capable of eliciting a Th1 and / or Th2 response.

[0104] 2. Dosage

[0105] The exact dosage will vary according to factors such as subject dependent variables (e.g., age, immune system health, etc.) and the age of the subject to be treated. The appropriate dosage can be determined by a person skilled in the art, taking into account the treatment background, age and overall health of the recipient. The selected dosage depends on the desired therapeutic effect, route of administration and desired duration of treatment. When determining the effective amount of the virus to be administered for prevention, the physician can assess the level of virus in circulating plasma and / or the production of existing antibodies to the antigen. Active virus can also be measured in terms of plaque forming units (PFU). Plaque forming units can be defined as the area of ​​cytolysis (CPE) caused by infection of a single viral particle in a monolayer cell culture under covering conditions. Generally, the dosage level of the virus administered to humans is between 10 2 Up to 10 12 In various embodiments, the dosage range is 10 4 Up to 10 10 pfu, 10 5 Up to 10 9 pfu, 10 6 Up to 10 8 When more than one vaccine is to be administered (ie, in the form of a combination vaccine), the amount of each vaccine preparation may be within the ranges described therefor.

[0106] The virus is usually administered as a liquid suspension, with volumes ranging from 10 μl to 100 μl, depending on the route of administration. Vaccine volumes commonly used range from 0.1 mL to 0.5 mL. In general, the dose and volume will be lower for local injection than for systemic administration or infusion.

[0107] The vaccine composition can be administered in a single dose or multiple dose format. The vaccine can be prepared with an adjuvant several hours or days before administration, but a stable buffer and a suitable adjuvant composition need to be determined. Typically, the dose for local administration is 100 μl multiple doses, while systemic or regional administration via subcutaneous, intramuscular, intraorgan, intravenous or intranasal administration can be, for example, 10 to 100 μl.

[0108] V. Kit

[0109] Also provided are kits comprising the disclosed LAIVB. The kit may include a separate container containing a suitable carrier, diluent or excipient, and in addition, the kit may include instructions for mixing or combining the components and / or administering. The composition may be in liquid form or may be lyophilized. Suitable containers for the composition include, for example, bottles, vials, syringes, and test tubes. The container may be formed from a variety of materials including glass or plastic. The container may have a sterile access port (e.g., the container may be an IV bag or vial having a stopper that can be penetrated by a hypodermic needle).

[0110] The kit may further include a second container comprising a pharmaceutically acceptable buffer, such as phosphate buffered saline, Ringer's solution or glucose solution. The second container may also contain other materials that can be used for the end user, including other pharmaceutically acceptable formulation solutions (such as buffers, diluents), filters, needles, and syringes or other delivery devices. The kit may further include a third component comprising an adjuvant.

[0111] The kit may also include a drug insert containing written instructions for inducing immunity, preventing infection, or treating infection. The drug insert may be an unapproved draft drug insert, or may be a drug insert approved by the Food and Drug Administration (FDA) or other regulatory agencies.

[0112] The present invention also provides a delivery device pre-filled with a composition of the present invention.

[0113] The compositions are typically formulated to be sterile, substantially isotonic, and in full compliance with all Good Manufacturing Practice (GMP) regulations of the US Food and Drug Administration. Example

[0114] Materials and methods

[0115] Cells and viruses

[0116] The B / HK / 8038 / 11 strain was obtained from Queen Mary Hospital, and the full genome sequence of DelNS1 B / HK / 8038 / 11 has been registered in GenBank with accession numbers MH636851-MH636858. All cell lines were obtained from ATCC. Human embryonic kidney cells (293T) and lung adenocarcinoma cells (A549) were maintained in Dulbecco's minimal essential medium (DMEM) supplemented with 10% fetal bovine serum, 100 units / ml penicillin and 100 μg / ml streptomycin sulfate (Life Technologies). Canine MDCK cells were cultured in Eagle's minimal essential medium (MEM) supplemented with equal amounts of serum and antibiotics. Influenza B virus B / HK / 8038 / 11 was rescued by reverse genetics. B DelNS1 (Flu B) LAIVs were constructed and rescued according to the protocol described in this article and previous reports (Zheng et al., J. Virol., 89: 10273-10285 (2015)). The viral gene fragments were amplified and cloned into pHW2000 plasmids to obtain eight pHW2000 plasmids, which were transfected into 293T / MDCK cells. The rescued viruses were amplified in MDCK cells or chicken embryo eggs.

[0117] Plasmid construction

[0118] As described previously (Zheng et al., J. Virol., 89: 10273-10285 (2015)), the NS1 deletion plasmid pHW2000-DelNS1 was constructed. Using the pHW2000-8038-NS (influenza B) plasmid as a template, inverse PCR was performed to delete the NS1 gene. The PCR product was then gel purified, phosphorylated, and self-ligated using standard protocols. The primers for the influenza B DelNS1 424 inverse PCR were 5'-CTCAAT TT GTGTTGTGGTC ATG-3' (SEQ ID NO: 25) (Flub-DelNS1-F) and 5'-TGGAGGATGAAGAAGA TGGCCATCGG ATCCTC-3' (SEQ ID NO: 26) (Flub-DelNS1-R).

[0119] Example 1. Generation and characterization of DelNS1 influenza B live attenuated virus vaccine.

[0120] Clinical isolate B / Hong Kong / 8038 / 2011, which was confirmed to be of Victoria lineage by sequence analysis, was used in these experiments. The coding region of the NS1 gene was removed from the viral genome without affecting the expression of other essential genes for viral replication ( Figure 1A ).

[0121] Eight kinds of pHW2000 plasmids containing the DelNS1 fragment and other 7 influenza virus segments are transfected into the 293T / MDCK cell mixture together with the NS1 expression plasmid and incubated overnight. The DNA mixture is removed, and the MEM supplemented with the trypsin (Sigma) of 1 μg / ml N-tosyl-L-phenylalanine chloromethyl ketone (TPCK) processing is added. Virus supernatant is collected after 72 hours and is designated as the 0th generation (P0) virus, and is subsequently passed down in MDCK cells or chicken embryo eggs.

[0122] The initially rescued DelNS1-8308B influenza B virus obtained from 293T cells transfected for 72 hours at 37°C replicated poorly only in MDCK cells or eggs. The rescued virus was passaged 10 times at 33°C in MDCK cells. For all DelNS1 viruses, the deletion of the NS1 gene was confirmed by RT-PCR and sequencing. The rescued virus (DelNS1-8308B influenza B virus) was passaged more than 20 times at 33°C and 30°C in MDCK cells, respectively, until the virus titer stabilized, and its measurement standard was that the virus titer remained unchanged for three consecutive passages. After this, the adaptive mutations in the growth-adapted DelNS1-8308B influenza B virus were identified. Four mutations in PA (T210C), NA T (1424C), NP (C182T) and M (A281G) were identified. The DelNS1-8308B influenza B virus designated as influenza B virus DeINS1-B8038HK has been deposited at the American Type Culture Collection and its ATCC deposit number is PTA-125209.

[0123] Example 2. Growth characteristics of DelNS1 influenza B virus in MDCK and A459 cells

[0124] The growth kinetics of DelNS1 virus in MDCK and A549 cells were estimated at 37°C and 33°C, respectively. Confluent cells (A549 or MDCK) inoculated on 24-well plates were infected with the virus at a specified multiplicity of infection (MOI). After adsorption for 1 hour, the virus supernatant was removed, the cells were washed twice with phosphate buffered saline (PBS), then covered with MEM containing 1 μg / ml TPCK trypsin, and incubated at the indicated temperature. Supernatants were collected at different time points and titers were determined by plaque assay of MDCK cells.

[0125] Plaque assay: Virus was serially diluted 10-fold and added to confluent MDCK cells on 6-well plates and then incubated at 37°C for 1 hour. The supernatant was removed and the cells were washed twice with PBS and then covered with 1% MEM agarose containing 1 μg / ml TPCK trypsin. The plates were incubated at 33°C for 48 hours and then fixed with 10% PBS buffered formaldehyde solution for at least 2 hours. Plaques were visualized by staining with 1% crystal violet solution.

[0126] DelNS1 influenza B live attenuated virus with adaptive mutations is able to replicate to levels comparable to wild-type virus in vaccine production systems (eggs or MDCK cells) ( Figure 2A ). DelNS1 live attenuated virus cannot replicate in interferon-competent A549 cells. This is a safety attribute that prevents viral shedding in vaccinated people ( Figure 2B ).

[0127] The growth kinetics of the DelNS1-8308B influenza B virus carrying the adaptive mutations were analyzed in MDCK cells at 33°C and 37°C. The DelNS1 influenza B virus replicates preferentially at lower temperatures (such as 33°C, which simulates the upper respiratory tract), but replication is limited at 37°C, which simulates the lower respiratory tract. This property of the DelNS1 influenza B virus for use as a human vaccine is an additional safety feature ( Figure 2B ).

[0128] Example 3. Protection of DelNS1 influenza vaccine against lethal challenge with mouse-adapted influenza B virus

[0129] Use DelNS1 influenza B vaccine (Victoria lineage, 2x10 6 Mice were inoculated once with 500 pfu (pfu) via nasal drops.

[0130] Three weeks later, mice were infected with influenza B virus B / Florida / 4 / 2006 (Yamagata lineage, 5 × 10 5 TCID 50 ) and B / Brisbane / 60 / 2008 (Victoria pedigree, 5x10 6 TCID 50 ) were challenged with any of the vaccinated mice. The weight and survival rate of the mice were recorded for 2 weeks. According to animal ethics guidelines, mice with a weight loss of more than 25% were euthanized. To evaluate viral replication in mouse lungs, lungs were collected on day 3 and homogenized in 1 ml PBS. Viral titers were determined by plaque assay of MDCK cells.

[0131] DelNS1 influenza B virus was not toxic to mice even when challenged with the highest dose of virus ( Figure 3A and 3B To evaluate whether DelNS1-B8038 (a Victoria lineage influenza B virus) could protect against infection with both lineages of influenza B virus, mice were immunized once by the nasal route and then challenged three weeks later with a mouse-adapted influenza B virus of the Yamagata (B / Florida / 4 / 2006) or Victoria (B / Brisbane / 60 / 2008) lineage. Mice mock-vaccinated with PBS died after 6 to 8 days, whereas all DelNS1-B8038 LAIV-immunized mice survived ( Figure 3C and 3D Compared with the control group, on the third day after infection, the lung virus titer of mice vaccinated with DelNS1-B8038 LAIV was significantly reduced ( Figure 4A Immunization with one lineage of live attenuated influenza B virus, namely, DelNS1-B8038 of the Victoria lineage, protected mice from lethal challenge with either the Victoria or Yamagata lineages of mouse-adapted influenza B virus ( Figures 3A to 3D ).

[0132] It should be understood that the disclosed methods and compositions are not limited to the specific methods, protocols and reagents described, as these may vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is limited only by the appended claims.

[0133] It should be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "an aptamer" includes a plurality of such aptamers, reference to "the aptamer" is a reference to one or more aptamers and equivalents thereof known to those skilled in the art, and so forth.

[0134] Throughout the description and claims of this specification, the word "comprise" and variations of the word (such as "comprising" and "comprises") mean "including but not limited to", and are not intended to exclude, for example, other additives, components, integers or steps.

[0135] “Optional” or “optionally” means that the subsequently described event, circumstance or material may or may not occur or exist, and that the description includes instances where the event, circumstance or material occurs or exists and instances where it does not occur or exist.

[0136] In this article, the range can be expressed as from "about" one specific value and / or to "about" another specific value. When expressing such a range, unless the context clearly indicates otherwise, it is also particularly contemplated and expected to disclose a range from a specific value and / or to other specific values. Similarly, when the value is expressed as an approximation by using the antecedent "about", it will be understood that unless the context clearly indicates otherwise, the specific value forms another embodiment that should be considered to be disclosed and clearly considered. It will be further understood that unless the context clearly indicates otherwise, the endpoints of each range are significant relative to the other endpoints and independently of the other endpoints. It should be understood that unless the context clearly indicates otherwise, all single values ​​and sub-ranges of values ​​contained in the clearly disclosed range are also clearly considered and should be considered to be disclosed. Finally, it should be understood that all ranges refer to the ranges listed as a single digit range and set from the first endpoint (including the first endpoint) to the second endpoint (including the second endpoint). In the latter case, it should be understood that any one of the single digits can be selected as a form in the quantity, value or feature referred to by the range. In this way, a range describes a group of numbers or values ​​from a first endpoint (including the first endpoint) to a second endpoint (including the second endpoint), from which a single member of the group (i.e., a single number) can be selected as the quantity, value or feature referred to by the range. The foregoing applies regardless of whether some or all of these embodiments are explicitly disclosed in a particular case.

[0137] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the disclosed methods and compositions belong. Although any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present methods and compositions, particularly useful methods, apparatuses and materials are described. The publications cited herein and the materials cited therein are expressly incorporated by reference herein. Nothing herein should be construed as admitting that the present invention is not entitled to be disclosed in advance by virtue of a prior invention. It is not recognized that any reference constitutes prior art. The discussion of the references states the author's claims, and the applicant reserves the right to question the accuracy and relevance of the references. It should be clearly understood that although many publications are cited herein, such references do not constitute an admission that any of these documents form part of the common general knowledge in the art.

[0138] Although the description of materials, compositions, components, steps, techniques, etc. may include many options and alternatives, this should not be interpreted as, and is not an admission that such options and alternatives are equivalent to each other or particularly obvious alternatives. Thus, for example, a list of different parts does not indicate that the listed parts are obvious to each other, nor does it indicate an admission of equivalence or obviousness. Sequence Listing <110> The University of Hong Kong <120> Live attenuated influenza B virus compositions and methods of preparation and use thereof <130> FPCH18160103P <160> 26 <170> PatentIn Version 3.5 <210> 1 <211> 2426 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 1 agtactggtc gacctccgaa gttggggggg agcagaagcg gagcgttttc aagatgacat 60 tggccaaaat tgaattgtta aaacaactgc taagggacaa tgaagccaaa acagttttga 120 agcaaacaac agtagaccaa tataacataa taagaaaatt caatacatca aggattgaaa 180 agaatccttc actaaggatg aagtgggcca tgtgttctaa ttttcccttg gctctaacca 240 agggcgatat ggcaaacaga atccccttgg aatacaaagg gatacaactc aaaacaaatg 300 ctgaagacat aggaaccaaa ggccaaatgt gctcaatagc agcagttattggtggaata 360 catatggacc aataggagat actgaaggtt tcgaaagggt ctacgaaagc ttttttctca 420 gaaaaatgag acttgacaac gccacttggg gccgaataac ttttggccca gttgaaagag 480 tgagaaaaag ggtactgcta aaccctca ccaggaat gcctccggat gaggcgagca 540 atgtgataat ggaaatattg ttccctaaag aagcaggaat accagagaa tccacttgga 600 tacataggga actgaaaa gaaaaaagag aaaattgaa aggaacaatg atactccaa 660 tcgtactggc atacatgctt gaagagaac tggttgctcg aagagattc ttgccagtgg 720 caggagcaac atcagctgag ttcatagaaa tgctacactg cttacaaggt gaaaattgga 780 ghaaaata tcaccagga gggaataat taactgagtc caggtctca tcaatgatag 840 tagcttgtag aaaaataatc agagatcaa tagtcgctc aaacccactg gagctagctg 900 tagaaattgc aaaacaagact gtgatagata ctgaaccttt aaagtcatgt ctggcagcca 960 tagaggagg tgatgtagct tgtgacata tagagctgc attaggacta aagatcagac 1020 aagacaag atttggacgg cttgagctaa aaagaatac aggaagga ttcaaatg 1080 repeat attaaggg accgaaaacagagat tggaatgg gacgggag 1140 aggagttcca tgtaagatgt ggtgaatgca ggggaatact aaaaagagt aaatgaaac 1200 tggaaaaact actgataaat tcagccaaaa aggagatat gagagattta ataatcttat gcatggtatt ttctcaagac actaggatgt tccaaggggt gagaggaga ataaatttc ttaatcgagc aggccaactt ttatctccaa tgtaccaact ccaacgatat tttttgaata gaagcaacga cctttttgat caatggggggt atgaggaatc acccaaagca agtgaactac atgggataaa tgaatcaatg aatgcatctg actatacatt gaaagggatt gtagtgacaa gaatgtaat tgacgacttt agctctactg aaacagaaaa agtatccata acaaaaaatc ttagtttaat aaaaaggact ggggaagtca taatggggagc taatgacgtg agtgaattag aatcacaagc acagctgatg aatacatatg atacacctaa aatgtggga atgggaacaa ccaaagaact ggtgcaaaac acttatcaat gggtgctaaa aaacttggtg acactgaagg ctcagtttct tctaggaaaa gaggacatgt tccaatggga tgcatttgaa gcatttgaga gcataattcc tcagaagatg gctggtcaat acagtggatt tgcaagagca gtgctcaaac aaatgagaga ccaggaggtt atgaaaactg accagttcat aaagttgttg cctttttgtt tctcaccacc aaaattaagg agcaatgggg agccttatca attcttaaaa cttgtgttga 1980 aaggaggagg ggaaaatttc atcgaagtaa ggaaagggtc ccctctattt tcctataatc 2040 cacaaacaga agtcctaact atatgcggca gaatgatgtc attaaaaggg aaaattgaag 2100 atgaagaaag gaatagatca atggggaatg cagtattagc aggctttctc gttagtggca 2160 aatatgaccc agatcttgga gatttcaaaa ctattgaaga acttgaaaag ctgaaaccag 2220 gggaaaaggc aaacatctta ctttatcaag gaaaaccagt taaagtagtt aaaaggaaaa 2280 ggtatagtgc tttgtccaat gacatttcac aaggaattaa gagacaaaga atgacagttg 2340 agtccatggg gtgggccttg agctaatata aatttatcca ttaattcaat gaacgcaatt 2400 gagtgaaaaa tgctcgtgtt tctact 2426 <210> 2 <211> 2369 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 2 agcagaagcg gagcctttaa gatgaatata aatccttatt ttctcttcat agatgtgccc 60 gtacaggcag caatttcaac aacattccca tacactggtg ttcccccctta ttctcatgga 120 acaggaacag gctacacaat agacaccgtg atcagaacgc atgagtactc aaacaagggg 180 aaaagtaca tttctgatgt tacaggatgc aaatggtag atccaaaaa tggaccatta 240 cccgaagata atgagccgag tgcctatgcg caattagatt gcgttttaga ggctttggat 300 agaatggatg aagaaccc aggtctttt caagcagcct caagaatgc tatggaggcc 360 ctaatggtca caactgtaga caaattaacc caggggagac agacttttga ttggacagta 420 tgcagaaacc aacctgctgc aacggcactg aacacaacaa taacctcttt taggttgaat 480 gatttaaatg gagccgacaa aggtggatta ataccttttt gtcaggatat cattgattca 540 ttagaccgac ctgaaatgac tttcttctca gtaaagaata taaagaaaaa attgcctgcc 600 aaaaacagaa agggtttcct cataaagagg ataccaatga aggtaaaaga caaaataacc 660 aaagtggaat acatcaaaag agcattatca ttaaacacaa tgacaaaaga cgctgaaaga 720 ggcaaattga aaagaagagc gattgccact gctggaatac aaatcagagg gtttgtatta 780 gtagttgaaa acttggctaa aaatatatgt gaaatctag aacaaagtgg tttaccagta 840 ggtggaaacg agaagaagc caactgtca aacgcagtgg ccaaatgct cagtaactgc 900 ccaccaggag ggattagcat ccaccaggaaca ccaaatgaa tgaatgtttta 960 aacccaagaa tctttttggc tatgactgaa agaatacca gagacagccc aatttggttc 1020 agggatttt gtagtatagc accggtcctg ttctccaata agatagcaag attggggaaa 1080 gggtttatga taacaagcaaaaaaaga ctgaggctc aaataccttg tcctgatctg 1140 tttagtatac cattagaaag attaatgaa gaacaaggg CAAATtgaa aaagctaaaa 1200 ccattcttca atgagaagg aactgcatct ttgtcgcctg ggatgatt gggaatgttt 1260 atatgctat ctaccgtgtt gggagtagct gcactaggta tcagaacat tggaacaaa 1320 gatacttat gggatggact gcaatcttct gatgattttg ctctatttgt taatgcaaag 1380 gatgagaaa catgtatgga aggaataac gactttacc gaacatgtaa attattggga 1440 aaacatga gcaaaagaa aagttactgt atgagactg gatgttttga attackacc 1500 atgttctaca gagatggatt tgtatctaat tttgcaatgg aactccctc gttttggggtt 1560 gctggagtaa atgaatcagc agaatggca atggaatga caataataa gaacaacatg 1620 atcaacaatg ggatgggtcc agcaacagca siacagcca tacagttatt catagctgat 1680 tatagataca cctacaatg ccacagggga gattchaag tagaggaaa gagaatgaaa 1740 atcataagg agttatgg aaacactaaa ggaagagatg gtctattagt agcagatggt 1800 gggcccaaca tttacaattt gagaaacttg catatcccag aaatagtatt aaagtataat 1860 ctaatggacc ctgaataca agggcggtta cttcatcctc aaaatcctt tgtgggacat 1920 ttgtctattg aaggcatca agaggcagat atacccag cacatggtcc agtaagaaa 1980 atggactacg atgcggtgtc tggaactcat agttggagaa ccaaagaaa cagatctata 2040 ctaaaacactg atcagaggaa catgattctt gaggaacaat gctaacgctaa atgttgcaac 2100 ctatttgagg cctgttttaa cagtgcatca tacaggaagc cagtgggtca acatagcatg 2160 cttgaggcta tggcccacag attagaatg gatgcacgat taggattga atcaggga 2220 atgtcaaagg atgattttga gaaagcaatg gctcaccttg gtgagattgg gtacatataa 2280 gcttcgaaga tgtttatggg gttattggtc accattgaat acatgcgata cacaaatgat 2340 taaaatgaaa aaaggctcgt gtttctact 2369 <210> 3 <211> 2305 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequence <400> 3 agcagaagcg gtgcgtttga tttgtcataa tggatacttt tattacaaga aacttccaga 60 ctacaataat acaaaaggcc aaaaacacaa tggcagaatt tagtgaagat cctgaattgc 120 aaccagcaat gctattcaat atctgcgtcc atctagaggt ttgctatgta ataagtgaca 180 tgaattttct tgacgaagaa ggaaaagcac atatagcatt agaaggacaa gggaaagaac 240 aaaacttgag accacaatat gaagtaattg agggaatgcc aagaaccata gcatggatgg 300 tccagagatc cttagctcaa gagcatggaa tagagactcc caagtatctg gctgatttgt 360 ttgattataa aaccaaaaga tttatagaag ttggaataac aaaaggattg gctgatgatt 420 acttttggaa aaagaaagaa aagttgggaa atagcatgga actgatgata ttcagctaca 480 atcaagacta ctcgttaagt atgaatcct cattggatga ggaagggaaa gggagagtgc 540 taagcagact cacagaactt caggctgagt taagtctgaa aaacttatgg caagttctca 600 taggagagga agatgttga aagggaattg atttttaact tggacaaca atatctagac 660 taagggatat atctgttccg gctggttttt ccaattttga aggaatgagg agctacatag 720 acaataga cccaaaagga gcaatagaga gaatctagc aaggatgtct cccttagtat 780 cagtcacacc taaaaagtta acatgggagg acctaagacc gataggcct cacatttatg 840 accatgagct accagaagtt ccatataatg ccttcttct aatgtctgat gaactgggac 900 tggccaatat gactgaggga aaatccaaaaaccgaagac attagccaa gatgtctag 960 aaagtactc aacactacgg gatcaactg acccaatatt atatgaa agcgaaaag 1020 ctaacgaaaa tttcctatgg aagctttgga gagactgtgt aaacacaata agtaatgagg 1080 aaacaagtaa cgagttacag aaaaccaatt atgccaatg ggctacaggg gacggattaa 1140 cataccagaa aatgaaa gaagtagcaa taggacga aacaatgtgc caagagagc 1200 ctaaaatccc taacaatgt agagtggctg cttggttca aacagagatg atctattga 1260 gcactctgac aagtaaaga gctctggacc taccagaat agggccagac atagcaccccg 1320 tggagcatgt aggagtga agaggaaat acttgttaa tgatcaac tactgtagg 1380 cctctacagt tatgatgaag tatgtgcttt ttcacacttc attgttgaat gaaagcaatg 1440 ccagcatggg aaatacaaa gtaaataccaa taaccaatag agtagtaat gaaaaagggg 1500 aaagttttcga catgctttac gttctagcgg ttaaggaca atctcatctg agggagata 1560 ctgatgttgt aacagttgta actttcgaat ttagtggtac agatccaaga gtggactcag 1620 gaaagtggcc aaaatact gtgtttagga ttggctccct atttgtgagt gggagggaa 1680 aatctgtgta cttgtattgc cgagtgaatg gcacaataa gatcaatg aaatggggaa 1740 tggagctag aagatgttg cttcaatcaat tgcacaat ggaggcatt gttgacagg 1800 aatcatcaat shackattack aagcctgttt shackshack aggcat 1860 gccccaaaac tttcagtatt ggaactcaag aaggaaaact agtaaaagga tcctttggaa 1920 aaacactaag agtaatattt actaaatgct tgatgcacta tgtatttgga aatgcccaat 1980 tggaggggtt tagtgccgag tctaggagac ttctactgtt gattcaagca ttaaaggaca 2040 gaaagggccc ctgggtgttc gacttagagg gaatgtattc tggaatagaa gaatgtatta 2100 gcaacaaccc ttgggtaata cagagtgtat actggttcaa tgaatggttg ggctttgaaa 2160 aggaggggag taaagtgttg gaatcagtgg atgaaataat ggatgaataa aaggaaatgg 2220 tactcaattt ggtactattt tgttcattat gtatctaaac atccaataaa aagaaccaag 2280 aatcaaaaat gcacgtgttt ctact 2305 <210> 4 <211> 1882 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequence <400> 4 agcagaagca gagcattttc taatatccac aaaatgaagg caataattgt actactcatg 60 gtagtaacat ccaatgcaga tcgaatctgc actgggataa catcgtcaaa ctcaccacat 120 180. gtcgtcaaaa ctgctactca aggggaggtc aatgtgactg gtgtaatacc actgacaaca acacccacca aatctcattt tgcaaatctc aaaggacag aaaccagagg gaaactatgc ccaaatgcc ccactgcac agatctggac gtagccttgg gcagaccaaa atgcacggga 360. aaaataccct cggcaagagt ttcaatactc catgaagtca gacctgttac atctgggtgc 420. tttcctata tgcacgacag aacaaaaatt agacagctgc ctaaccttct ccgaggatac gacatatca gattatcaac tcataacgtt atcaatgcag aaagtgcacc aggaggaccc 540. gtcttgccct aacgttacca atggaaacgg atttttcgca acaatggctt gggccgtccc aaaaaacgac aaaaacaaaaa cagcaacaga tccattaaca 660. catacatttg catacatttg ttaccgtttg ggggttccac tctgataacg agatccaaat ggcaaagctc tatggggact caaagcccca gaagttcacc tcatctgcca acggagtgac cacacattac gtttcacaga ttggtggctt cccaaatcaa 840. acagaagacg gaggactacc acaaagtggt agaattgttg ttgattacat ggtacaaaaa tctgggaaaa caggaacaat tacctatcaa agaggtattt tattgcctca aaaggtgtgg 900 tgcgcaagtg gcaggagcaa ggtaataaa ggatccttgc ctttaattgg agaagcagat 960 tgcctccacg aaaaatacgg tggattaaac aaaagcaagc cttactacac aggggaacat 1020 gcaaaggcca taggaaattg cccaatatgg gtgaagacac ccttgaagct ggccaatgga 1080 accaaatata gacctcctgc aaaaactatta aaggaaggg gtttcttcgg agctattgct 1140 ggtttcttag aaggaggatg ggaaggaatg attgcaggtt ggcacggata cacgtcccat 1200 ggggcacatg gagtagcggt ggcagcagac cttaagagca ctcaagaggc cataaacaag 1260 ataaaaaa atctaaactc tttgagtgag ctggagataa agaatcttca aagactaagc 1320 1380 agagctgata caataagctc acaaatagaa ctcgcagtcc tgctttccaa tgaaggaata 1440 ataaacagtg aagatgaaca tctcttggcg cttgaaagaa agctgaagaa aatgctgggg 1500 ccctctgctg tagagatagg gaatggatgc tttgaaacca aacacaagtg caaccagacc 1560 tgtctcgaca gaatagctgc tggtaccttt gacgcaggag aattttctct ccccaccttt 1620 gattcactga atattactgc tgcatcttta aatgacgatg gattggataa tcataccata 1680 ctgctttact actcaactgc tgcctccagt ttggctgtaa cactgatgat agctatcttt 1740 gttgtttata tggtctccag agacaatgtt tcttgctcca tctgtctata agggaagtta 1800 agccctgtgt tttcctttgt tgtagtgctt gtttgcttgt tgccattaca aagaaacgtt 1860 attgaaaaat gctcttgtta ct 1882 <210> 5 <211> 1844 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 5 agcagaagca cagcattttc ttgtgaactt caagcaccag taaaagaact gaaaatcaaa 60 atgtccaaca tggatattga cggtataaac actgggacag ttgacaaaac accggaagaa 120 ataacttctg gaaccagtgg gacaaccaga ccaatcatta gaccagcaac ccttgcccca 180 ctaagcaaca aacgaacccg taacccatcc ccggaaagag caactacaag cagtgaagat 240 gatgtcggaa ggaaaaccca aaagaaacag accccgacag agataagaa gagcgtctac 300 aacatggtgg tgaactggg cgaattctat aaccagatga tggtcaagc tggactcaat 360 gatgacatgg agagaaacct aatccaaat gcgcatgccg tggaaagaat tctattggct 420 gccactgatg acagaaaac cgatttccag aagaaaaaga atgccagaga tgtcaaagaa 480 gggaagaag aaatagatca airaca ggaggcacct tttatagat ggtaagagat 540 gataaaacca tctactttag ccctataaga attacctttt taaaagaga ggtgaaaaca 600 atgtacaaaa ccaccatggg gagtgatggc ttcagtggac taaatcacat atgattggg 660 cattcacaga tgaatgatgt ctgttccaa agatcaagg cactaaaag agttggactt 720 gatccttcat taatcagtac ctttgcggga agcacagtcc ccagagatc aggtgcgact 780 ggtgttgcaa tcaaggagg tggacttta gtggctgag ccattcgatt taggact 840 gcaatggcag acagaggggct attgagagat atcaagcca agactgccta tgaaaagatt 900 cttctgaatc taaaaaaaaaa atgctctgcg cctcaacaa aggctctagt tgatcaagtg 960 atcggaagca gaaatccggg gattgcagac attgaagatc taaccctgct tgctcgtagt 1020 atggtcgttg ttaggccctc tgtggcaagc aaagtggtgc ttcccataag catttacgcc 1080 aaaatacctc aactagggtt caatgttgaa gagtactcta tggttgggta cgaagccatg 1140 gctctttaca atatggcaac acctgtgtcc atattaagaa tgggagatga tgcaaaagat 1200 aaatcgcaat tattcttcat gtcttgcttc ggagctgcct atgaagacct gagagttttg 1260 tctgcattga caggcacaga attcaaacct agatcagcat taaaatgcaa gggtttccat 1320 gttccagcaa aggaacaagt agaaggaatg ggagcagctc tgatgtccat caagctccag 1380 ttttgggctc caatgaccag atctgggggg aacgaagtag gtggagacgg agggtctggc 1440 caaataagct gcagcccagt gtttgcagtg gaaagaccta ttgctctaag caagcaagct 1500 gtaaggagaa tgctatcaat gaatattgag ggacgtgatg cagatgtcaa aggaaatcta 1560 ctcaagatga tgaatgactc aatggctaag aaaaccagtg gaaatgcttt cattgggaag 1620 aaaatgtttc aaattcaga caaaaacaaa accaatccca ttgaaattcc aattaagcag 1680 accatcccca atttcttctt tgggagggac acagcagagg attatgatga cctcgattat 1740 taaagcaaca aaatagacac tatgactgtg attgtttcaa tacgtttgga atgtgggtgt 1800 ttattcttat taaaataaat ataaaaaatg ctgttgtttc tact 1844 <210> 6 <211> 1557 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 6 agcagaagca gagcatcttc tcaaaattga agcaaatagg ccgaaaatga acaatgctac 60 cctcaactat acaaacgtta accctatttc tcacatcagg gggagtatta ttatcactat 120 atgtgtcagc ttcactgtca tacttactat attcggatat attgctaaaa ttcccatcaa 180 cagaaattac tgcaccaaca atgccattag attgtgcaaa cgcatcaaat gttcaggctg 240 tgaaccgttc tgcaacaaaa ggggtgacac ttcttctccc agaaccggag tggacatacc 300 cgcgtttatc ttgcccgggc tcaacctttc agaaagcact cctaattagc cctcatagat 360 tcggagagac caaaggaaac tcagctccct tgataataag ggaacctttt attgcttgtg 420 gaccaaagga atgcaacac tttgctctaa cccactatgc agcccaacca gggggatact 480 acaatggaac agaggagac agaacaagc tgaggcatct aatttcagtc aaattgggca 540 aaatcccaac agtagaaac tccattcc acatggcagc atggagcggg tccgcatgtc 600 atgatggtaa ggaatggaca tatatcggag ttgatggccc tgacaataat gcattgctca 660 aaaayaata tggggagca tatactgaca cataccattc ctagcaaac aacatcctaa 720 gaacacaaga aagtgcctgc aattgcatcg gaggaattg ttatcttatg atactgatg 780 gctcagcttc aggtgttagt gatgcagat ttcttaaaat tcgagaggggc cgaataataa 840 aagaaatatt tccaacagga agaatacaac atactgaaga atgcacatgc ggatttgcta 900 gcataaaac catagaatgt gcctgtagag atacagtta cacagcaaa agaccctttg 960 tcaattaa cgtggagact gatcagcag aaatagatt gatgtgcaca aagacttatt 1020 tggacacccc cagaccagag gatggaagca taactggggcc tgtgaatct atggaggca 1080 aagggagtgg aggcatcag taggattg tccatcaag aatggcatcc agatttggaa 1140 ggtggtactc tcgaacgatg tctaaaactg aaaggaaggg gatggggctg tatgtcaagt 1200 ataatggaga cccatgggct gacagtgatg cccttgtttt tagtggagta atggtttcaa 1260 tggaagaacc tggttggtac tcctttggct tcgaaataaa agacaagaaa tgtgatgtcc 1320 cctgtattgg gatagagatg gtacatgatg gtggaaaaga gacttggcac tcagcagcta 1380 cagccattta ctgtttaatg ggctcaggac agctgctgtg ggacactgcc acaggtgtta 1440 atatgactct gtaatggagg aatggttgag tctgctctaa accctttgtt cctattttgt 1500 ttgaacaatt gtccttacta aacttaattg tttctgaaaa atgctcttgt tactact 1557 <210> 7 <211> 1190 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Sequence <400> 7 agcagaagca ggcactttct taaaatgtcg ctgtttggag acacaattgc ctacttgctt 60 tcattgacag aagatggaga aggcaaacca gaactagcag aaaaattaca ctgttggttt 120 ggtgggaaag aatttgacct agactctgcc ttagaatgga taaaaaacaa aagatgctta 180 actgatatac aaaaagcact aattggtgcc tctatatgct ttttaaaacc caaagaccag gaagaaaaa gaagattcat cacagagccc ttatcaggag tgggaacaac agcaacaaaaa aagaaaggcc tgattctggc tgagagaaaa atgagaagat gtgtgagctt tcatgaagca 420. tttgaaatag cagaaggcca tgaaagctca gcgctactat actgtctcat ggtcatgtac ctgaatcctg gaattattc aatgcaagta aaactaggaa cgctctgtgc tttgtgcgag aaacaagcat cacattcaca cagagctcat cgagatcttc agtgcctgga gtgagacgag aaatgcagat ggtctcagct atgaacacag caaaaacaat gaatggaatg ggaaaaggag aagacgtcca aaagctggca gaagagctgc aaagcaacat tggagtgctg agatctcttg gggcaagtca aaagaatggg gaaggaattg caaaggatgt aatggaagtg ctaaagcaga gctctatggg aaattcagct cttgtgaaga aatatctata atgctcgaac catttcagat tctttcaatt tgttctttta tcttatcagc tctccatttc atggcttgga 840 caatagggca tttgaatcaa ataaaaagag caataacat gaaatacga ataaaaagtc caaacaaaga gacaataaac agagaggtat caattttgag acacagttac caaaaagaaa 960 tccaggccaa agaaacaatg aaggaagtac tctctgacaa catggaggta ttgagtgacc 1020 acataataat tgaggggctt tctgccgaag aaataataaa aatgggtgaa acagttttgg 1080 agatagaaga attgcattaa attcaatttt tgctgtattt cttactatgc atttaagcaa 1140 attgtaatca atgtcagcaa ataaactgga aaaagtgcgt tgtttctact 1190 <210> 8 <211> 1097 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequence <400> 8 agcagaagca gaggatttgt ttagtcactg gcaaacagga aaaatggcga acaacatgac 60 cacaacacaa attgaggtgg gtccgggagc aaccaatgcc accataaact ttgaagcagg 120 aattctggag tgctatgaaa ggctttcatg gcaaagagcc cttgactacc ctggtcaaga 180 ccgcctaaac agactaaaga gaaaattaga gtcaagaata aagactcaca acaaaagtga 240 gcctgaaagt aaaaggatgt cccttgaaga gagaaaagca attggagtaa aaatgatgaa 300 agtactccta tttatggatc cgtctgctgg aattgaaggg tttgagccat actgtatgaa 360 aagttcctca aatagcaact gtacgaaata caattggacc gattaccctt caacaccagg 420 gagatgcctt gatgacatag aagaagaacc agaggatgtt gatggcccca ctgaaatagt 480 attaagggac atgaacaaca aagatgcgag gcaaaagata aaggaggaag taaacactca 540 gaaagaaggg aagttccgtt tgacaataaa aagggatatg cgtaatgtat tgtccttgag 600 agtgttggta aacggaacat tcctcaaaca tcccaatgga tacaagtcct tatcaactct 660 gcatagattg aatgtatatg accagagtgg aaggcttgtt gctaaacttg ttgctactga 720 tgatcttaca gtggaggatg aagaagatgg ccatcggatc ctcaactcac tcttcgagcg 780 tcttaatgaa ggacattcaa agccaattcg agcagctgaa actgcggtgg gagtcttatc 840 ccaatttggt caagagcacc gattatcacc agaagaggga gacaattaga ctggtcacgg 900 aagaacttta tcttttaagt aaaagaattg atgataacat attgttccac aaaacagtaa 960 tagctaacag ctccataata gctgacatgg ttgtatcatt atcattatta gaaacattgt 1020 atgaaatgaa ggatgtggtt gaagtgtaca gcaggcagtg cttgtgaatt taaaataaaa 1080 atcctcttgt tactact 1097 <210> 9 <211> 29 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 9 ccgaagttgg gggggagcag aagcggagc 29 <210> 10 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 10 ggccgccggg ttattagtag aaacacgagc 30 <210> 11 <211> 29 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 11 ccgaagttgg gggggagcag aagcggagc 29 <210> 12 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 12 ggccgccggg ttattagtag aaacacgagc 30 <210> 13 <211> 29 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 13 ccgaagttgg ggggggagcag aagcggtgc 29 <210> 14 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 14 ggccgccggg ttattagtag aaacacgtgc 30 <210> 15 <211> 29 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 15 ccgaagttgg gggggagcag aagcagagc 29 <210> 16 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 16 ggccgccggg ttattagtag taacaagagc 30 <210> 17 <211> 29 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 17 ccgaagttgg gggggagcag aagcagagc 29 <210> 18 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 18 ggccgccggg ttattagtag taacaagagc 30 <210> 19 <211> 29 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 19 ccgaagttgg gggggagcag aagcacagc 29 <210> 20 <211> 30 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 20 ggccgccggg ttattagtag aaacaacagc 30 <210> twenty one <211> 32 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> twenty one ccgaagttgg ggggggagcag aagcacgcac tt 32 <210> twenty two <211> 33 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> twenty two ggccgccggg ttattagtag aaacaacgca ctt 33 <210> twenty three <211> 32 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> twenty three ccgaagttgg gggggagcag aagcagagga tt 32 <210> twenty four <211> 33 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> twenty four ggccgccggg ttattagtag taacaagagg att 33 <210> 25 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 25 ctcaatttgt gttgtggtca tg 22 <210> 26 <211> 32 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 26 tggaggatga agaagatggc catcggatcc tc 32

Claims

1. A live attenuated influenza virus B (LAIVB), wherein the deposit number of the LAIVB is ATCC PTA-125209.

2. The LAIVB of claim 1, wherein the LAIVB is incapable of replicating in interferon-competent cells.

3. The LAIVB of claim 2, wherein the interferon-competent cells are A549 cells.

4. The LAIVB of any one of claims 1-3, wherein the LAIVB replicates poorly in MDCK cells at 37°C when compared to the replication of the LAIVB in MDCK cells at 33°C.

5. The LAIVB of any one of claims 1-3, wherein the LAIVB is capable of replicating at a level comparable to that of a wild-type influenza virus of the same strain in a vaccine production system.

6. The LAIVB of claim 5, wherein after passage in a virus production system, 10 7 pfu / ml to 10 8 pfu / ml of LAIVB.

7. The LAIVB of claim 5, wherein the vaccine production system comprises MDCK cell culture.

8. The LAIVB of claim 6, wherein the vaccine production system comprises MDCK cell culture.

9. The LAIVB of claim 4, wherein the LAIVB is capable of replicating at a level comparable to that of a wild-type influenza virus of the same strain in a vaccine production system.

10. The LAIVB of claim 9, wherein after passage in a virus production system, 10 7 pfu / ml to 10 8 pfu / ml of LAIVB.

11. The LAIVB of claim 9 or 10, wherein the vaccine production system comprises MDCK cell culture.

12. The LAIVB of claim 1, wherein administration of the LAIVB to a subject in need thereof reduces viral titers of different strains of influenza B virus in the subject infected with different strains of influenza B virus.

13. A live attenuated influenza virus B (LAIVB), which has a deletion (DelNS1) of the viral virulence element NS1 protein and adaptive mutations, wherein the adaptive mutations consist of T210C of PA, T1424C of NA, C182T of NP and A281G of M; and the influenza B virus is the B / HK / 8038 / 2011 strain.

14. A pharmaceutical composition comprising an effective amount of the LAIVB of any one of claims 1 to 12 to induce an immune response to an antigen encoded by the viral genome.

15. The pharmaceutical composition according to claim 14, further comprising an adjuvant.

16. The pharmaceutical composition according to claim 14 or 15, which is suitable for nasal administration.

17. Use of the pharmaceutical composition according to any one of claims 14 to 16 in the preparation of a medicament for inducing or enhancing an immune response against influenza B virus in a subject.

Images