Application of PTPN2 inhibitors in KRAS mutant tumors

Abstract

The present invention relates to the use of a PTPN2 inhibitor in KRAS mutant tumors. Specifically, the PTPN2 inhibitor provided by the present invention can significantly inhibit the proliferation of KRAS-dependent tumor cells, while having no effect on the proliferation of KRAS-independent cells. PTPN2 can serve as a key protein molecule necessary for the membrane localization and activation of mutant KRAS. Therefore, inhibiting PTPN2 can treat mutant KRAS tumors.

Description

Technical Field

[0001] The present invention belongs to the field of medicine and biology. Specifically, the present invention relates to the application of a PTPN2 inhibitor in KRAS mutant tumors. Background Art

[0002] Non-receptor protein tyrosine phosphatase 2 (PTPN2, TCPTP) is a member of the non-receptor tyrosine-specific phosphatases. Its main function is to dephosphorylate tyrosine-phosphorylated proteins. It was first cloned from the cDNA library of human peripheral blood T cells in 1989, and subsequent studies have found that it is widely expressed in various tissues. The functional research of PTPN2 is mainly focused on regulating T cell differentiation and immunity.

[0003] The anti-cancer effect of PTPN2 was only reported in 2010. First, Kleppe et al. analyzed samples of patients with T-cell acute lymphoblastic leukemia (T-ALL) and found that 6% of patients had PTPN2 expression loss. Knocking out PTPN2 in cell lines significantly promoted tumor cell proliferation, suggesting that PTPN2 is a tumor suppressor gene in T-ALL. Subsequent studies have found that PTPN2 can negatively regulate the JAK / STAT signaling pathway, which in many cases promotes tumor proliferation, so PTPN2 is considered to be a tumor suppressor gene. However, some studies have found that PTPN2 acts as an oncogene. In Myc-induced mouse B-cell lymphoma, overexpressed Ptpn2 can promote cell proliferation, while knocking down Ptpn2 significantly inhibits cell proliferation, and even completely inhibits B-cell lymphoma in mice. The inflammatory response in the rectum of Ptpn2 conditional knockout mice is more severe than that of wild-type mice, but in the colorectal cancer model, it was found that the occurrence and development of colorectal cancer in Ptpn2 knockout mice was significantly slower than that in wild-type mice. Some articles have reported that the expression level of PTPN2 in patients with glioma and glioblastoma is strongly correlated with the patient's prognosis. Patients with high expression of PTPN2 often have a poor prognosis, which also suggests that PTPN2 may promote tumors. Recently, an article reported that KRAS can also be tyrosine phosphorylated, and the phosphorylated KRAS shows that the related signaling pathways are inhibited. Based on our previous results, we speculate that PTPN2 negatively regulates the tyrosine phosphorylation of KRAS and thus regulates the activation of KRAS.

[0004] RAS gene is the gene with the highest mutation frequency in tumors. Nearly a quarter of tumors have RAS mutations, especially KRAS, which is the gene with the highest mutation frequency in human cancer, accounting for 85% of all RAS mutations, followed by NRAS (12%), and HRAS mutations are relatively rare (3%). 71% of pancreatic cancers, 29% of colorectal cancers and 18.6% of lung cancers have KRAS mutations. There are three main RAS genes in the mammalian RAS family, encoding four highly homologous proteins: HRAS, NRAS, KRAS4A and KRAS4B. RAS protein belongs to the small molecule guanosine triphosphatase (GTPase) family, and its activity is regulated by binding to GTP or GDP.

[0005] RAS protein has the function of "molecular switch" and plays a role in signal transduction in a series of important life activities such as regulating cell growth, metabolism, differentiation, and apoptosis. 30% of human malignant tumors have RAS gene mutations. In addition, many related genes that regulate RAS activity have carcinogenic mutations that can also cause abnormal activation of RAS. However, because the enzyme activity of RAS plays a "self-shutdown" role, and RAS is locked in an activated state bound to GTP due to the inactivation of RAS guanylate enzyme after mutation, RAS protein itself is considered to be a protein molecule that cannot be directly targeted. Finding other targets that regulate RAS signaling pathways is crucial for the treatment of RAS-related tumors. Cell and animal experiments have confirmed that mutated KRAS plays an important role in the initiation and development of tumors and is closely related to tumor resistance. Therefore, KRAS has always been an important target for tumor treatment.

[0006] However, due to the particularity of the KRAS protein structure, it is difficult for it to become a direct target of drugs, so it is particularly important to find other protein molecules that can regulate KRAS activation. More and more studies have found that KRAS needs other partner molecules to function, so people are also actively looking for protein molecules that regulate KRAS function by interacting with KRAS, such as GPR31, which helps KRAS transport to the cell membrane after interacting with KRAS. For example, KRAS needs PDEδ to be correctly located on the cell membrane. After silencing PDEδ, KRAS cannot be located on the cell membrane, thereby inhibiting KRAS downstream signaling pathways, such as ERK phosphorylation, and effectively inhibiting tumor cell proliferation and cloning. PDEδ inhibitors can show better specificity and less cytotoxicity in in vitro cell experiments, but they are quickly metabolized in mice and cannot be used for in vivo experiments. More stable PDEδ inhibitors are currently being sought.

[0007] Although more and more KRAS-related protein molecules have been discovered, there are still no effective drugs targeting these targets for clinical use. Therefore, finding KRAS-specific regulatory proteins will help to better understand the KRAS activation mechanism and screen for KRAS mutant tumor-specific therapeutic targets.

[0008] Therefore, the field of the present invention urgently needs to develop a protein molecule that regulates KRAS membrane localization as a new therapeutic target for KRAS mutant tumors. Summary of the invention

[0009] The purpose of the present invention is to provide a key protein molecule PTPN2 necessary for the membrane localization and activation of mutant KRAS as a new therapeutic target for KRAS mutant tumors.

[0010] In a first aspect of the present invention, there is provided a use of a PTPN2 inhibitor for preparing a composition or a preparation, wherein the composition or the preparation is used for:

[0011] (a) Inhibit the localization of KRAS protein to the cell membrane;

[0012] (b) inhibiting the proliferation of KRAS-dependent tumor cells;

[0013] (c) Treatment of KRAS-positive tumors;

[0014] (d) reducing phosphorylation of KRAS downstream signaling molecules; and / or

[0015] (e) Increase the tyrosyl phosphorylation level of KRAS.

[0016] In another preferred embodiment, the “inhibiting the localization of KRAS protein to the cell membrane” comprises: reducing the amount of KRAS protein on the cell membrane;

[0017] In another preferred embodiment, the composition is a pharmaceutical composition.

[0018] In another preferred embodiment, the pharmaceutical composition is used to treat tumors.

[0019] In another preferred embodiment, the pharmaceutical composition is in the form of an injection or external use pharmaceutical formulation.

[0020] In another preferred embodiment, the pharmaceutical composition can be administered by subcutaneous injection, intravenous injection, or intramuscular injection.

[0021] In another preferred embodiment, the inhibitor is selected from the following group: small molecules, antibodies, polypeptides, oligonucleotides, and aptamers.

[0022] In another preferred embodiment, the inhibitor is a small molecule or an oligonucleotide.

[0023] In another preferred embodiment, the inhibitor comprises MicroRNA, siRNA, shRNA, or a combination thereof.

[0024] In another preferred embodiment, the inhibitor is siRNA.

[0025] In another preferred embodiment, the inhibitor is PTPN2 siRNA-432, and its sequence is shown in SEQ ID NO:9 and SEQ ID NO:10.

[0026] In another preferred embodiment, the inhibitor is PTPN2 siRNA-1161, and its sequence is shown in SEQ ID NO:11 and SEQ ID NO:12.

[0027] In another preferred embodiment, the PTPN2 inhibitor is used to inhibit the expression of PTPN2.

[0028] In another preferred embodiment, the KRAS-dependent tumor cells or KRAS-positive tumors have mutant KRAS.

[0029] In another preferred embodiment, the mutant KRAS is selected from the following group: KRAS G12D 、KRAS G12V 、KRAS Q61K 、KRAS G13D .

[0030] In another preferred embodiment, the tumor is selected from the following groups: pancreatic cancer, colon cancer, fibrosarcoma, colorectal cancer or lung cancer (such as non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)), gastrointestinal cancer (such as colorectal cancer, small intestine cancer, and gastric cancer), bladder cancer, liver cancer, esophageal cancer, bile duct cancer, breast cancer, ovarian cancer, endometrial cancer, cervical cancer, prostate cancer, hematopoietic system cancer (such as leukemia, myeloid leukemia, and lymphoma), brain cancer (such as malignant glioma), malignant peripheral nerve sheath tumor (MPNST), neurofibromatosis type 1 (NF1) mutant MPNST, or neurofibroma.

[0031] Preferably, the tumor is selected from the group consisting of pancreatic cancer, colon cancer, fibrosarcoma, colorectal cancer or lung cancer (eg, non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)).

[0032] In another preferred embodiment, the tumor is pancreatic cancer (PAAD).

[0033] In a second aspect, the present invention provides a method for inhibiting the localization of KRAS protein to the cell membrane and / or increasing the tyrosyl phosphorylation level of KRAS in vitro, comprising the steps of:

[0034] (a) Cells expressing KRAS protein are cultured in the presence of a PTPN2 inhibitor, thereby inhibiting the localization of KRAS protein to the cell membrane and / or increasing the tyrosine phosphorylation level of KRAS.

[0035] In a third aspect, the present invention provides a method for inhibiting the growth of KRAS-dependent tumor cells in vitro, comprising the steps of:

[0036] (a1) KRAS-dependent tumor cells are cultured in the presence of a PTPN2 inhibitor, thereby inhibiting the growth of KRAS-dependent tumor cells.

[0037] The fourth method of the present invention provides a use of a PTPN2 protein, a PTPN2 coding sequence or a promoter thereof for preparing a composition or a preparation, wherein the composition or the preparation is used for:

[0038] (a) Promote the localization of KRAS protein to the cell membrane;

[0039] (b) Promote the proliferation of KRAS-dependent tumor cells;

[0040] (c) preparing an animal model of KRAS-positive tumors;

[0041] (d) increasing phosphorylation of KRAS downstream signaling molecules; and / or

[0042] (e) Reduce the tyrosyl phosphorylation level of KRAS.

[0043] In a fifth aspect, the present invention provides a method for treating KRAS-positive tumors, comprising the steps of: administering a therapeutically effective amount of a PTPN2 inhibitor to a subject in need of treatment.

[0044] In another preferred embodiment, in the subject, PTPN2 expression is upregulated.

[0045] In a sixth aspect, the present invention provides a composition comprising:

[0046] (i) PTPN2 inhibitors;

[0047] (ii) KRAS inhibitors; and

[0048] (iii) a pharmaceutically acceptable carrier.

[0049] In a seventh aspect, the present invention provides a use of a PTPN2 detection reagent for preparing a kit for prognosis of KRAS-positive tumors.

[0050] Preferably, the KRAS tumor is selected from the group consisting of pancreatic cancer, colon cancer, fibrosarcoma, colorectal cancer or lung cancer (eg, non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC)).

[0051] In another preferred embodiment, the tumor is pancreatic cancer (PAAD).

[0052] In another preferred embodiment, the kit is used to detect the expression level of PTPN2.

[0053] In another preferred embodiment, the kit further contains a reagent for detecting KRAS mutation.

[0054] In an eighth aspect, the present invention provides a method for prognosing a patient with a KRAS mutant tumor, the method comprising:

[0055] (a) determining the PTPN2 expression level C1 in the patient, and comparing it with the PTPN2 expression level of a normal population or a standard value C0;

[0056] If the expression level C1 is significantly greater than C0, it indicates that the patient has a poor prognosis; if the expression level C1 is equal to or less than C0, it indicates that the patient has a good prognosis.

[0057] In another preferred embodiment, the “expression level C1 is significantly greater than C0” indicates that the ratio of C1 / C0 is ≥1.5, preferably ≥2.0, and more preferably ≥3.0.

[0058] In another preferred embodiment, the “expression level C1 is equal to or less than C0” indicates that the ratio of C1 / C0 is ≤1, preferably ≤0.75, and more preferably, ≤0.5.

[0059] In a ninth aspect, the present invention provides a detection kit, the kit comprising:

[0060] (i) a first detection reagent for detecting PTPN2;

[0061] (ii) A second detection reagent for detecting KRAS.

[0062] In another preferred embodiment, the kit is used to detect whether a subject has a KRAS mutation and to detect whether the expression level of PTPN2 in the subject is upregulated.

[0063] In a tenth aspect, the present invention provides a use of the detection kit described in the ninth aspect for preparing a companion diagnostic kit for determining whether a KRAS-positive patient should be treated with a PTPN2 inhibitor and / or a KRAS inhibitor.

[0064] In another preferred embodiment, the companion diagnostic kit is used to determine whether the patient has KRAS + PTNT2 + Cancer patients.

[0065] In another preferred embodiment, for the KRAS + PTNT2 + Tumor patients were treated with a combination of PTPN2 inhibitors and KRAS inhibitors.

[0066] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 PTPN2 was shown to regulate KRAS membrane binding.

[0068] Figure 2 Shown is the effect of PTPN2 knockdown on KRAS-dependent cell viability.

[0069] Figure 3 The effects of PTPN2 knockdown on KRAS-dependent cell proliferation and survival are shown.

[0070] Figure 4 The effects of PTPN2 knockdown on KRAS activation, signaling, and tyrosine phosphorylation are shown.

[0071] Figure 5 GFP-KRAS was shown to be G12D Protein stability.

[0072] Figure 6 The effect of PTPN2 knockdown on KRAS tyrosine phosphorylation is shown.

[0073] Figure 7 It was shown that high expression of PTPN2 in PAAD patients was associated with poor prognosis. DETAILED DESCRIPTION

[0074] After extensive and in-depth research, the inventors unexpectedly discovered for the first time that PTPN2 can be used as a new therapeutic target for KRAS mutant cancer. Among them, knocking down PTPN2 can significantly inhibit the proliferation of KRAS-dependent tumor cells, while having no effect on the proliferation of KRAS-independent cells. In addition, PTPN2 is necessary for the survival of KRAS-dependent tumor cell lines, and silencing PTPN2 can increase cell apoptosis; and silencing PTPN2 can reduce the interaction between KRAS and downstream molecules, thereby significantly weakening the phosphorylation of downstream signaling molecules. In addition, high expression of PTPN2 is significantly associated with poor prognosis in PAAD patients. Therefore, PTPN2 is a key protein molecule necessary for the membrane localization and activation of mutant KRAS, and it is expected to become a new therapeutic target for KRAS mutant tumors. On this basis, the present invention was completed.

[0075] Non-receptor protein tyrosine phosphatase 2 (PTPN2)

[0076] Protein tyrosine phosphatase 2 (non-receptor type 2, PTPN2, TCPTP) is a member of non-receptor tyrosine-specific phosphatases. Its main function is to dephosphorylate tyrosine-phosphorylated proteins. The accession number of PTPN2 is NP_536347.1.

[0077] PTPN2 inhibitors

[0078] The PTPN2 inhibitor of the present invention refers to PTPN2 that can specifically bind, including small molecules, antibodies, polypeptides, oligonucleotides, and aptamers. Preferably, it is siRNA.

[0079] Among them, siRNA refers to a short double-stranded RNA molecule that can target mRNA with homologous complementary sequences and degrade specific mRNA. This process is the RNA interference pathway.

[0080] The siRNA used in the present invention may be chemically modified, for example, the 2' position of the pentose may be modified with an alkyl group (eg, methyl, ethyl, etc.), and the phosphate may be a thiophosphate, etc.

[0081] Preferably, the PTPN2 inhibitor of the present invention is

[0082] PTPN2 siRNA-432, whose sequence is

[0083] Sense CAAAGGAGUUACAUCUUAATT (SEQ ID No.: 9),

[0084] Antisense UUAAGAUGUAACUCCUUUGTT (SEQ ID No.: 10).

[0085] Preferably, the PTPN2 inhibitor of the present invention is

[0086] PTPN2 siRNA-1161, whose sequence is

[0087] Sense GCCUUUGAUCAUUCACCAATT (SEQ ID No.: 11),

[0088] Antisense UUGGUGAAUGAUCAAAGGCTT (SEQ ID No.: 12).

[0089] The PTPN2 inhibitors of the present invention can be used for:

[0090] (a) Inhibit the localization of KRAS protein to the cell membrane;

[0091] (b) inhibiting the proliferation of KRAS-dependent tumor cells;

[0092] (c) Treatment of KRAS-positive tumors;

[0093] (d) reducing phosphorylation of KRAS downstream signaling molecules; and / or

[0094] (e) Increase the tyrosyl phosphorylation level of KRAS.

[0095] KRAS-dependent tumors

[0096] RAS gene is the gene with the highest mutation frequency in tumors. Nearly a quarter of tumors have RAS mutations, especially KRAS, which is the gene with the highest mutation frequency in human cancer, accounting for 85% of all RAS mutations, followed by NRAS (12%), and HRAS mutations are relatively rare (3%). 71% of pancreatic cancers, 29% of colorectal cancers and 18.6% of lung cancers have KRAS mutations. There are three main RAS genes in the mammalian RAS family, encoding four highly homologous proteins: HRAS, NRAS, KRAS4A and KRAS4B. RAS protein belongs to the small molecule guanosine triphosphatase (GTPase) family, and its activity is regulated by binding to GTP or GDP.

[0097] RAS protein has the function of "molecular switch" and plays a role in signal transduction in a series of important life activities such as regulating cell growth, metabolism, differentiation, and apoptosis. 30% of human malignant tumors have RAS gene mutations. In addition, many related genes that regulate RAS activity have carcinogenic mutations that can also cause abnormal activation of RAS. However, because the enzyme activity of RAS plays a "self-shutdown" role, and RAS is locked in an activated state bound to GTP due to the inactivation of RAS guanylate enzyme after mutation, RAS protein itself is considered to be a protein molecule that cannot be directly targeted. Finding other targets that regulate RAS signaling pathways is crucial for the treatment of RAS-related tumors. Cell and animal experiments have confirmed that mutated KRAS plays an important role in the initiation and development of tumors and is closely related to tumor resistance. Therefore, KRAS has always been an important target for tumor treatment.

[0098] Reagent test kit

[0099] The present invention provides a detection kit, which comprises:

[0100] (i) a first detection reagent for detecting PTPN2;

[0101] (ii) A second detection reagent for detecting KRAS.

[0102] In another preferred embodiment, the kit is used to detect whether a subject has a KRAS mutation and to detect whether the expression level of PTPN2 in the subject is upregulated.

[0103] The kit of the present invention can be used to prepare a companion diagnostic kit, which is used to determine whether a KRAS-positive patient should be treated with a PTPN2 inhibitor and / or a KRAS inhibitor.

[0104] In another preferred embodiment, the companion diagnostic kit is used to determine whether the patient has KRAS + PTNT2 + Cancer patients.

[0105] In another preferred embodiment, for the KRAS + PTNT2 + Tumor patients were treated with a combination of PTPN2 inhibitors and KRAS inhibitors.

[0106] The main advantages of the present invention are:

[0107] 1. The present invention provides a new therapeutic target for KRAS mutant tumors.

[0108] 2. Knocking down PTPN2 using a PTPN2 inhibitor can significantly inhibit the proliferation of KRAS-dependent tumor cells.

[0109] 3. Inhibiting the high expression of PTPN2 can significantly improve the poor prognosis of patients.

[0110] General Methods

[0111] 1. Cell Culture

[0112] Human lung cancer cell lines (A549 and H460), colon cancer cell lines (HCT-116 and DLD-1), pancreatic cancer cell lines (PaTu8988T), melanoma cell lines (SK-MEL-30), fibrosarcoma cell lines (HT-1080) and human embryonic kidney (HEK) cell line 293T were purchased from the American type culture collection (ATCC) and authenticated by ATCC and DSMZ using short tandem repeat analysis. All cells were tested regularly to ensure the absence of mycoplasma contamination.

[0113] HCT-116 and DLD-1 cells were cultured in RPMI-1640 medium (Source Culture, Shanghai); HEK-293T, PaTu8988T, A549 and H460 cells were cultured in DMEM (Source Culture, Shanghai); SK-MEL-30 and HT-1080 cells were cultured in MEM medium (Source Culture, Shanghai). All culture media were supplemented with 10% fetal bovine serum (Gibco, Carlsbad, CA, USA), 1× penicillin / streptomycin, and cells were cultured in an incubator at 37°C, 5% CO2.

[0114] 2. DNA constructs

[0115] Plasmid construction was mainly carried out by homologous recombination, and GFP-fused KRAS G12D (GFP-KRAS G12D ), GFP-fused KRAS G12D / 6Q (GFP-KRAS G12D / 6Q ), Myc-fused KRAS G12D The fragment, PTPN2 siRNA-1161 resistant mutation (PTPN2-Res) and enzyme activity inactivation mutation (PTPN2-D182A) plasmids were constructed into MigR1 plasmid by homologous recombination. The recombinant plasmids were transformed into TOP10 competent cells and coated on LB plates containing ampicillin resistance. Some clones were selected for small shaking. On the second day, part of the bacterial solution was taken for small extraction. Then the plasmids in the small extraction were sequenced. The bacterial solution with the correct sequence was shaken for large shaking. The plasmids after large extraction were confirmed again.

[0116] 3. Construction of HEK 293T cell line stably expressing GFP-KRAS G12D

[0117] HEK 293T cells were maintained in DMEM containing 10% FBS. Before transfection, the cells were digested with trypsin-EDTA (Yuanpei, Shanghai) and then cultured in 6-well plates to allow the cells to adhere overnight. Cells were transfected with GFP-KRAS using Lipofectamine 3000 reagent (Invitrogen). G12D , refer to the instructions for use, prepare 2 clean EP tubes, tube 1: 125μl Opti-MEM + 5μl Lipofectamine 3000, tube 2: 125μl Opti-MEM + 5μg DNA plasmid + 10μl P3000 reagent. Mix tube 1 and tube 2 and incubate at room temperature for 10 minutes. Then add the DNA-lipid complex to the cells. Change the medium 8 hours after transfection.

[0118] After 5 days of cell culture, GFP-positive cells were sorted by FACS. After 2 weeks of culture, GFP-positive cells were sorted again by FACS and cultured in 96-well plates to make a single GFP-positive cell / well. The cells were further cultured for 2 weeks, digested with trypsin-EDTA, and then cultured in 6-well plates. G12D Cell lines with uniform expression were used in the next experiment.

[0119] 4. siRNA library screening

[0120] A pre-aliquoted siRNA library (Dharmacon; Human ON-TARGETplus) was used to generate siRNAs in the GFP-KRAS G12D siRNA screening was performed in HEK 293T cells. siRNA was dispensed into 96-well plates (CellCarrier-96, PerkinElmer) at 10 μl / well in duplicate. Before siRNA screening, OptiMEM mixed with RNAiMAX transfection reagent (Invitrogen) was added to the 96-well plates at 40 μl / well (with RNAiMAX volume of 0.3 μl). Digestion of GFP-KRAS G12D HEK293T cells were centrifuged and counted, and the cell density was adjusted to 10 with medium containing 10% FBS. 5 / ml. The cell suspension was added to the wells mixed with RNAiMAX using a spray gun, 50μl / well, and the final siRNA concentration was 25nM. The cells were imaged using the OperaPhenix High Content Screening System (PerkinElmer) 72 hours after transfection. The images were taken using a 40X water immersion objective in confocal mode, and 17 fields of view were captured.

[0121] 5. siRNA Transfection

[0122] The cells were digested with trypsin containing EDTA, then neutralized with medium containing 10% FBS, and then collected in a 15 ml centrifuge tube and centrifuged at 800 rpm for 5 minutes. The supernatant was discarded, resuspended with 10% FBS medium, and counted. siRNA was transfected with RNAiMAX or FECT transfection reagent according to the instructions, as follows:

[0123] RNAiMAX Transfection Reagent Method:

[0124]

[0125]

[0126] FECT1 Transfection Reagent Method

[0127]

[0128] 6. Western Blot

[0129] Whole cell lysates were prepared, washed twice with pre-chilled phosphate-buffered saline (PBS), and lysed in sodium dodecyl sulfate (SDS) lysis buffer (100 mM Tris-HCl, 2% SDS, 10% glycerol, 50 mM dithiothreitol, 0.1% bromophenol blue; pH 6.8) supplemented with a protease inhibitor cocktail and 2 mM phenylmethylsulfonyl fluoride (PMSF). Proteins in the lysate were separated by SDS-polyacrylamide gel electrophoresis and subjected to Western blotting with the following antibodies: (a) anti-phospho MEK1 / 2 (Ser217 / 221) (Catalog No. 9121, 1:1000), anti-phospho ERK1 / 2 (D13.14.4E; Catalog No. 4370, 1:1000), anti-GFP (Catalog No. 2555, 1:1000), anti-p44 / 42 MAPK (Erk1 / 2) (137F5) (Catalog No. 4695S; 1:1000), anti-MEK1 / 2 (9122; 1:1000) and anti-Myc (71D10, Catalog No. 2278, 1:1000) (all purchased from Cell Signaling) Technology); (b) anti-KRAS (WH0003845M1, 1:1000) and anti-PTPN2 (HPA046176, 1:1000) (purchased from Sigma-Aldrich), anti-[EP1845Y] sodium potassium ATPase (ab76020); 1:1000, purchased from Abcam); (c) HRP-conjugated GAPDH (catalog number: HRP-6004, 1:4000), HRP-conjugated β-actin (catalog number: HRP-60008, 1:4000) and HRP-conjugated α-tubulin antibody (HRP-66031, 1:4000) (all purchased from ProteinTech). Secondary antibodies were anti-mouse IgG HRP-linked antibody (Cell Signaling Technology, 1:3000; #7076) or anti-rabbit IgG HRP-linked antibody (Cell Signaling Technology, 1:3000; #7074). Western blot images were developed using Amersham Imager 600 (GE Healthcare, Boston, MA, USA). Each Western blot shown is representative of at least 2 independent experiments.

[0130] 7. Flow Cytometry

[0131] According to the reagent manual (BD Pharmingen TMThe thymidine analog 5-bromo-2-deoxyuridine (BrdU) incorporation assay was performed using RNAiMAX reagent (Invitrogen, catalog number 13778) with a final concentration of 50 nM and plated in 6-well plates for 72 h. BrdU (10 μM) was added and incubated for another 3 h. The cells were then washed 3 times with 1× PBS and fixed and permeabilized with BD Cytofix / Cytoperm Buffer. The cells were further permeabilized with Cytoperm Permeabilization Buffer Plus for 10 min under ice bath conditions and re-fixed with Cytofix / Cytoperm Buffer for 10 min. After incubation in DNase for 1 h at 37°C, the cells were stained with FITC-conjugated anti-BrdU antibody for 30 min at room temperature. Before detection by flow cytometry, cells were stained with the nucleolar dye 7-aminoactinomycin D (7-ADD) for 15 minutes. GraphPad Prism 5 was used to count and calculate the percentage of BrdU positive cells.

[0132] The Annexin V apoptosis detection kit (eBioscience, catalog number 88800772) was used to detect and quantify cell apoptosis. After the tumor cell lines were treated with siRNA for 72 hours, the cells were harvested and washed with precooled PBS and then suspended in annexin binding buffer. Subsequently, the cells were incubated with Annexin V-APC and propidium iodide (PI) at room temperature in the dark for 15 minutes and immediately analyzed using a BD LSRFortessa flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). The data were analyzed using FlowJo (Tree Star) software.

[0133] 8. siRNA-mediated Knockdown of KRAS and PTPN2

[0134] Cells were transfected with siRNA (final concentration of 50 nM) by Dharmafect 1 Transfection Reagent (Dharmacon, catalog number T2001-01) or RNAiMAX reagent (Invitrogen, catalog number 13778) and seeded in 6-well plates for Western blot or apoptosis assays and 96-well plates for cell viability assays. Transfected cells were collected 72 hours after transfection for Western blot analysis as described above and were subjected to the following assays 72 hours later. Luminescent cell viability assay (Promega). siRNA was purchased from GenePharma Corporation, and the sequences used for KRAS siRNA and PTPN2 siRNA experiments are as follows:

[0135] Negative Control:

[0136] Sense UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 1),

[0137] Antisense ACGUGACACGUUCGGAGAATT (SEQ ID NO: 2);

[0138] KRAS siRNA-244:

[0139] Sense GCCUGACGAUACAGCUAATT (SEQ ID NO: 3),

[0140] Antisense UUAGCUGUAUCGUCAAGGCTT (SEQ ID NO: 4);

[0141] KRAS siRNA-585:

[0142] Sense GGACUUAGCAAGAAGUUAUTT (SEQ ID NO: 5),

[0143] Antisense AUAACUUCUUGCUAAGUCCTT (SEQ ID NO: 6);

[0144] KRAS siRNA-643:

[0145] Sense GGUGUUGAUGAUGCCUUCUTT (SEQ ID NO: 7),

[0146] Antisense AGAAGGCAUCAUCAACACCTT (SEQ ID NO: 8);

[0147] PTPN2 siRNA-432:

[0148] Sense CAAAGGAGUUACAUCUUAATT (SEQ ID NO: 9),

[0149] Antisense UUAAGAUGUAACUCCUUUGTT (SEQ ID NO: 10);

[0150] PTPN2 siRNA-1161:

[0151] Sense GCCUUUGAUCAUUCACCAATT (SEQ ID NO: 11),

[0152] Antisense UUGGUGAAUGAUCAAAGGCTT (SEQ ID NO: 12).

[0153] 9. Cell Viability Assay

[0154] Use as described above Cell viability assay was performed by luminescent cell viability assay. HCT-116, H460, DLD-1, A549, PaTu8988T, HT-1080, and SK-MEL-30 cells were transfected with siRNA at a final concentration of 50 nM by reverse transfection using Dharmafect 1 or RNAiMAX and seeded in regular 96-well plates at a density of 5 × 10 3 Up to 1×10 4 After 72 hours of incubation, cell viability was measured using CellTiter-Glo reagent. Luminescence was detected using Envision plate reader (PerkinElmer).

[0155] 10. KRAS Activity Assay

[0156] KRAS activation was determined by a special kit (EMD Millipore, 17-218), and the specific method was as follows: collect cells 3 days after siRNA transfection, wash once with pre-cooled PBS, centrifuge at 800rpm for 5 minutes, remove the supernatant, add 400μl Pierce IP lysis buffer (ThermoScientific, 87788) containing protease and phosphatase inhibitors (Roche) to the cell pellet, lyse the cells, lyse on ice for 30 minutes, centrifuge at 12000g for 15 minutes at 4°C, transfer the supernatant after centrifugation to a new EP tube, and take 40μl from it as total protein. The remaining supernatant lysate was incubated with 5μg RAF-1RBD agarose beads at 4°C for 8 hours. After washing the agarose beads three times with PBS, centrifuge at 2000 rpm for 2 minutes at 4°C to precipitate the agarose beads to the bottom, discard the supernatant and add 50 μl 2×SDS lysis buffer to dissociate the protein from the RAF-1RBD agarose beads, boil at 100°C for 10 minutes to fully denature the protein. Then the sample was centrifuged at 12000 rpm for 20 minutes at 4°C. After centrifugation, the supernatant was transferred to a new EP tube, an equal amount of bromophenol blue indicator was added and mixed, and then the sample was subjected to protein blotting. Finally, a specific anti-KRAS antibody (Sigma, 1:1000) was used to detect activated KRAS (GTP-KRAS).

[0157] 11. Immunoprecipitation and Immunoblotting

[0158] siRNA (50 nM) was transfected into HEK 293T cells using FECT 1 transfection reagent and 1×10 6 Cells were seeded in 6-well plates at a density of 10 cells / well. After 24 hours of culture, GFP / KRASG12D plasmid was transiently transfected into siRNA-transfected cells using Lipo6000 transfection reagent (Biyuntian, C0526). After 6 hours of transfection, the culture medium was replaced with new one and then cultured for 42 hours. The cells were collected, washed with pre-cooled PBS, centrifuged at 800rpm for 5 minutes, and the supernatant was removed. 400μl of Pierce IP lysis buffer containing protease and phosphatase inhibitors was added to the cell pellet, lysed on ice for 30 minutes, centrifuged at 12000g for 15 minutes at 4°C, and the supernatant after centrifugation was transferred to a new EP tube, and 40μl was taken as total protein. The remaining supernatant lysate was incubated with 10μg anti-Myc agarose beads (Abcam, ab1253) or IgG agarose beads (Abcam, ab104155) at 4°C for 8 hours. After washing the agarose beads three times with PBS, centrifuge at 2000 rpm for 2 minutes at 4°C to precipitate the agarose beads to the bottom, discard the supernatant, add 50 μl 2×SDS lysis buffer to dissociate the protein from the agarose beads, and boil at 100°C for 10 minutes to fully denature the protein. Centrifuge the sample at 12000 rpm for 20 minutes at 4°C. After centrifugation, transfer the supernatant to a new EP tube, add an equal amount of bromophenol blue indicator and mix well. Perform protein blotting on the sample as described above, and use anti-Phospho-Tyrosine antibody (Cell Signaling Technology, catalog no. 9411, 1:1000) or anti-Myc antibody (Cell Signaling Technology, 1:1000) to detect the blot.

[0159] 12. KRAS protein stability

[0160] GFP-KRASG12D HEK 293T cells were transfected with siRNA at a final concentration of 50 nM by RNAiMAX reverse transfection and cultured at 2.5 × 10 5 Cells / well were seeded at a density of 1 / 40 μl in a regular 12-well plate. After 48 hours, fresh medium containing cycloheximide (50 μg / mL) was added. At the specified time intervals, cells were washed twice with pre-cooled PBS and lysed in SDS lysis buffer supplemented with a protease inhibitor cocktail and 2 mM PMSF. Western blot analysis was performed on samples as described previously.

[0161] 13. Extraction of small amounts of RNA

[0162] RNA from a small amount of cells was extracted using RNeasy Micro Kit (Qiagen) according to the instructions, as follows:

[0163] 293T cells in 96-well plates were trypsinized, neutralized with 10% FBS complete medium, centrifuged at 800 rpm for 5 minutes at 4°C, supernatant discarded, and then resuspended with 350 μl RLT buffer containing DTT, mixed thoroughly, and added to QIAshredder column, connected to a 2 ml centrifuge tube, centrifuged at 12000 g for 2 minutes, 350 μl 70% ethanol was added to the 2 ml centrifuge tube, gently pipetted to mix, and then added to the RNeasy MinElute column, connected to a 2 ml centrifuge tube, centrifuged at 8000 g for 30 seconds, and the liquid in the 2 ml centrifuge tube was discarded. Then 350 μl RW1 buffer was added to the RNeasy MinElute column, connected to a 2 ml centrifuge tube, centrifuged at 8000 g for 30 seconds, and the liquid in the 2 ml centrifuge tube was discarded. Then add 80μl DNase I (diluted with 70μl Buffer RDD) to the RNeasy MinElute column and incubate at room temperature for 15 minutes. Then add 350μl RW1 buffer to the RNeasy MinElute column, connect a 2ml centrifuge tube, centrifuge at 8000g for 30 seconds, and discard the liquid in the 2ml centrifuge tube. Then add 500μl RPE buffer to the RNeasy MinElute column, connect a 2ml centrifuge tube, centrifuge at 8000g for 30 seconds, and discard the liquid in the 2ml centrifuge tube. Add 500μl 80% ethanol to the RNeasy MinElute column, centrifuge at 8000g for 2 minutes, then put the RNeasy MinElute column into a new 1.5ml EP tube, add 15μl RNase-free water to the RNeasy MinElute column, centrifuge at 8000g for 1 minute, and the 1.5ml EP tube contains the required RNA. Use nanodrop to measure the concentration of the extracted RNA and perform subsequent experiments or store it at -80℃.

[0164] 14.qRT-PCR (Real Time-Polymerase Chain Reaction)

[0165] Primer design: Primers were designed using Primer-blast on the NCBI (National Center for Biotechnology Information) website. The two pairs of primers are as follows: beta-ACTIN: CTCCATCCTGGCCTCGCTGT / GCTGTCACCTTCACCGTTCC; PTPN2: TCTGGCACCTTCTCTCTGGT / GGTGTCTGTCAATCTTGGCCT.

[0166] Cell RNA extraction: operate on ice, add 200μl chloroform to each EP tube, shake vigorously for 15 seconds, and then let it stand for 2-3 minutes. Centrifuge at 12000g for 15 minutes at 4℃, and transfer the supernatant after centrifugation to a new EP tube. Add 500μl isopropanol to each tube, mix it upside down, and then let it stand for 10 minutes to precipitate RNA. Centrifuge again for 10 minutes under the same conditions, discard the supernatant, add 1ml 75% ethanol to the EP tube, and flick the tube wall to mix it. Centrifuge at 7500g for 5 minutes at 4℃, remove the supernatant, and put it in a fume hood to dry. After drying, add 30μl DEPC (DiethylPyrocarbonate) water and put it in a 57℃ water bath. Take it out after 20 minutes in the water bath, measure the RNA concentration, and dilute it to 1μg / μl, and store it in a -80℃ refrigerator for later use.

[0167] RNA is reverse transcribed into cDNA (complementary DNA): reverse transcription reagent uses PrimeScript TM RT MasterMix (TaKaRa), using a 10μl reaction system, including 2μl 5× PrimeScript RT Master Mix, 0.5μl RNA, 7.5μl RNase-free water. The reaction program was set to 37℃ for 15 minutes, 85℃ for 5 seconds, and then cooled at 4℃. After the cDNA was taken out, it was stored in a 4℃ refrigerator for later use.

[0168] qRT-PCR: Use 20 μl system, including 10 μl qPCR Master Mix, 1 μl cDNA, 1 μl upstream and downstream primers, and 7 μl RNase-free water.

[0169] The reaction program was set up as follows:

[0170]

[0171] 15. Confocal fluorescence microscope photography

[0172] Subcultured GFP-KRAS G12D 293T cells were digested with trypsin and collected in a 15 ml centrifuge tube. The cells were centrifuged at 800 rpm for 5 minutes and the cell density was counted after resuspending (according to 10 6 / well density seeding). Prepare siRNA and mix GFP-KRASG with siRNA 12D 293T cells were cultured in a cell culture plate with a glass bottom (WHB Company) in DMEM containing 10% FBS. After 8 hours of transfection, the culture medium was replaced and culture was continued for 64 hours. Finally, the cells were observed and photographed using a confocal microscope TCS SP8 (Leica) using a 63×NA1.4 oil lens.

[0173] 16. Extraction of cell membrane proteins and cytoplasmic proteins

[0174] Collect cells 3 days after siRNA transfection, discard the supernatant after centrifugation, gently resuspend the cell pellet with pre-cooled PBS, centrifuge at 600g for 5 minutes at 4°C to precipitate the cells, and discard the supernatant. Then centrifuge at 600g for 1 minute at 4°C to further remove the residual liquid on the tube wall and precipitate the cells, and try to absorb the residual liquid. Add membrane protein extraction reagent A with PMSF added before use to the cells, gently and fully suspend the cells, and place them in an ice bath for 10-15 minutes.

[0175] Freeze and thaw the sample in liquid nitrogen and room temperature twice, then take a small amount of sample to detect the degree of cell disruption under a microscope. If the degree of cell disruption is less than 70%, increase the number of freeze-thaw cycles until the degree of cell disruption is greater than 70%. Then centrifuge at 700g for 10 minutes at 4℃, and carefully collect the supernatant into a new centrifuge tube. Centrifuge the collected supernatant at 14000g for 30 minutes at 4℃ to precipitate cell membrane fragments. The supernatant is the cytoplasmic protein and can be stored at -70℃ for later use. Centrifuge the remaining sample at 14000g for 10 seconds at 4℃, and try to remove the supernatant (you can gently touch the precipitate, or even suck away a small amount of precipitate). Add 2XSDS lysis buffer (100mM Tris-HCl, 2% SDS, 10% glycerol, 50mM dithiothreitol; pH 6.8), resuspend the precipitate by vortexing at the highest speed for 5 seconds, and ice bath for 5-10 minutes. Repeat the above steps of vortex and ice bath incubation 1-2 times to fully extract membrane proteins. Then centrifuge at 14000g for 5 minutes at 4℃, collect the supernatant as the cell membrane protein solution, and store at -70℃ for later use.

[0176] 17. Analysis of the relationship between PTPN2 and clinical outcomes of PAAD, LUAD or COAD

[0177] The association of PTPN2 expression or KRAS expression with the prognosis of PAAD, LUAD, or COAD was analyzed by using UALCAN (http: / / ualcan.path.uab.edu / index.html), an interactive network for exploring the association between the prognosis of tumor patients and gene expression. Survival was determined in The Cancer Genome Atlas (TCGA) (https: / / cancergenome.nih.gov / ). p < 0.05 was considered statistically significant. Kaplan-Meier plots of overall survival of PAAD, LUAD, or COAD patients stratified by KRAS mutation were obtained from the cBioPortal database.

[0178] 18. Statistical Analysis

[0179] Continuous variable data are presented as mean ± SD. Comparisons among treatments were performed using one-way ANOVA followed by Tukey test using Graphpad Prism 5. P < 0.05 was considered statistically significant.

[0180] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0181] Example

[0182] Example 1. siRNA screening confirms that PTPN2 can act as a regulator of KRAS plasma membrane binding

[0183] To identify genes required for KRAS membrane trafficking, we developed an image-based screening assay that monitors KRAS G12D To this end, we first established a stable expression of GFP-fused KRAS G12D (GFP-KRAS G12D ) G12D HEK 293T cell line, most GFP-KRAS G12D The proteins are localized to the plasma membrane (PM) Figure 1 A). Then, a 147-siRNA sub-library was screened using the Opera Phenix high-content screening system, which was enriched in targets that regulate protein translocation (siRNA target genes and sequences are shown in SEQ ID No.: 1-12 above).

[0184] PDE6D siRNA was used as a positive control. After 72 h of treatment of cells with arrayed siRNA in 96-well plates, PTPN2 siRNA significantly altered PM-bound GFP-KRAS G12D cytoplasmic GFP-KRAS G12D The ratio ( Figure 1 A).

[0185] In addition, other PTPN2 siRNAs from GenePharma were used as well as KRAS siRNAs to confirm the screening results. Two different PTPN2 siRNAs (PTPN2 siRNA-432 and PTPN2 siRNA-1161) were able to effectively reduce GFP-KRAS G12D The level of PTPN2 in HEK 293T cells ( Figure 1 B) Then, a membrane protein extraction kit was used to examine the expression of GFP-KRAS on PM. G12D Compared with the negative control (NC), silencing PTPN2 could upregulate the expression of KRAS G12D Reduced transport to PM Figure 1 C and 1D). At the same time, KRAS in the cytoplasm G12D The level has increased slightly ( Figure 1 C and 1D). Figure 1 GFP-KRAS in C G12D The signal intensity in the membrane and cytoplasmic fractions was quantified (n = 4 independent biological experiments, expressed as normalized intensity relative to the NC control siPTPN2; mean ± SD; two-tailed t test. *, p < 0.05), and the results are shown in Figure 1 As shown in D, silencing PTPN2 can inhibit KRAS G12D Transport to PM was reduced by approximately 30%.

[0186] These results suggest that PTPN2 plays a key role in regulating KRAS G12D plays an important role in plasma membrane binding.

[0187] Example 2 Effect of PTPN2 on KRAS-dependent tumor cell growth

[0188] PTPN2 was knocked down in five human tumor cell lines with KRAS mutations (HCT-116, H460, PaTu8988T, A549, and DLD-1) and two human tumor cell lines with KRAS wild-type (HT-1080 and SK-MEL-30) using mixed siRNA. Mixed KRAS siRNA was also used as a positive control. Cells were treated with siRNA for 72 hours and then Luminescent cell viability assay, the results are as Figure 2As shown in A (values ​​are expressed as mean ± SD; n = 3, one-way ANOVA followed by Tukey's test. *, P < 0.05 vs. NC; **, P < 0.01 vs. NC; ***, P < 0.001 vs. NC; # P < 0.05 vs. KRAS siRNA).

[0189] Silencing PTPN2 with mixed siRNA significantly attenuated the proliferation of HCT-116 (colon), H460 (lung), PaTu8988T (pancreas), and HT-1080 (fibrosarcoma) cells, and slightly but significantly inhibited the growth of A549 (lung) and SK-MEL-30 (skin). However, in DLD-1 (colon) cells, silencing neither PTPN2 nor KRAS affected cell proliferation ( Figure 2 A). In addition, it can be seen that the growth inhibitory effects of silencing PTPN2 are consistent with those of silencing KRAS.

[0190] Figure 2 B is the silencing effect of PTPN2 siRNA and KRAS siRNA in HCT-116, PaTu8988T, H460, A549, DLD-1, HT-1080 and SK-MEL-30 cells shown by Western Blot. It can be seen that PTPN2 siRNA can effectively inhibit the cell viability of KRAS-dependent cell lines.

[0191] Figure 2 C shows the effects of control siRNA, KRAS siRNA and two different PTPN2 siRNAs on the viability of H460, PaTu8988T and HCT-116 cells (values ​​are expressed as mean ± SD; n = 3, one-way ANOVA followed by Tukey test. **, P < 0.01 vs. NC; ***, P < 0.001 vs. NC); Figure 2 D: HCT-116, PaTu8988T, and H460 cells were transfected with the indicated siRNAs, and lysates were harvested and prepared on day 3 after transfection, and immunoblotted for KRAS, PTPN2, and actin / GAPDH. It can be seen that both siRNAs can reduce the expression of PTPN2 and inhibit the proliferation of the cell lines.

[0192] The above results indicate that PTPN2 plays a key role in KRAS oncogenic signaling and PTPN2 siRNA can effectively inhibit the viability of KRAS-dependent cell lines.

[0193] Example 3 Effect of PTPN2 on the survival of KRAS-dependent tumor cells

[0194] The effects of PTPN2 and KRAS silencing on cell proliferation were examined by BrdU analysis. The results of the luminescent cell viability analysis were consistent with that of the above cell lines, except for DLD-1, the proportion of BrdU-positive cells was significantly reduced ( Figure 3 A).

[0195] In addition, the effect of PTPN2 on KRAS cell survival signaling was also examined. All of the above tumor cell lines were treated with PTPN2, KRAS or control siRNA for 72 h and then stained with Annexin V-APC and PI. Flow cytometric analysis showed that the percentage of apoptosis in the three KRAS-dependent tumor cell lines was significantly higher than that in the control ( Figure 3 B).

[0196] The above results indicate that: in PaTu8988T, H460 and A549, the effect of PTPN2 silencing is smaller than that of KRAS silencing, and therefore, PTPN2 has limited activity on KRAS proliferation signals in these cells; in KRAS-dependent tumor cell lines, the effect of PTPN2 silencing is greater than or equivalent to that of KRAS silencing, and therefore, PTPN2 is required for KRAS cell survival signal transduction.

[0197] Example 4 PTPN2 regulates the activation of oncogenic KRAS and its downstream signaling

[0198] To gain further insight into the mechanism by which PTPN2 regulates KRAS-dependent tumor cell proliferation and survival, we used RAS-GTP pull-down assays to examine whether PTPN2 affects KRAS activation. Figure 4 As shown in A, GFP-KRAS was expressed in the G12D Compared with 293T cells (control group), cells expressing GFP-KRAS were treated with PTPN2 siRNA (mixed or two different single siRNAs). G12D 293T cells, whose GTP-KRAS G12D Similarly, in H460 cells, the level of GTP-KRAS was also reduced by treatment with mixed PTPN2 siRNA ( Figure 4 B).

[0199] Effects of PTPN2 on activation of KRAS downstream signaling pathways Figure 4 As shown in C, both KRAS and PTPN2 silencing significantly reduced the phosphorylation levels of MEK and ERK in KRAS-dependent tumor cell lines HCT-116, PaTu8988T, and H460.

[0200] In the presence of the protein synthesis inhibitor cycloheximide (CHX, 50 μg / ml), GFP-KRAS was expressed in HEK 293T cells. G12D Protein stability, such as Figure 5 As shown in A and 5B, endogenous KRAS protein is very sensitive to PTPN2 knockdown, while exogenous GFP-KRAS G12D The protein underwent only marginal changes. The different effects of PTPN2 on stability between endogenous and exogenous KRAS could be explained in part by the fact that exogenous KRAS is a mutant form, whereas endogenous KRAS is a wild-type form.

[0201] The above experimental results indicate that PTPN2 is required for regulating the activation of oncogenic KRAS and its downstream signaling pathways.

[0202] Example 5 PTPN2 regulates KRAS tyrosine phosphorylation levels

[0203] GFP-KRAS G12D HEK 293T cell lysates were first immunoprecipitated with anti-Myc antibody and then immunoblotted with anti-pTyr. G12D The phosphorylated KRAS level in HEK 293T cells was significantly increased ( Figure 6 A and 6B). Rescue experiments were performed using two siRNA-resistant wild-type PTPN2 isoforms (PTPN2-1-R and PTPN2-2-R) and a phosphatase-inactive mutant (PTPN2-D182A) (Asp to Ala at residue 182). Transfection of PTPN2-1-R and PTPN2-2-R constructs into cells treated with PTPN2 siRNA (1161) significantly increased PTPN2 expression ( Figure 6 C). In addition, it can be seen that it is due to the overexpression of PTPN2-2-Res that the tyrosine phosphorylation level of KRAS is reduced, rather than PTPN2-2-D182A-Res or PTPN2-1-Res ( Figure 6 C).

[0204] These results suggest that PTPN2 is a tyrosine phosphatase of KRAS and that PTPN2 regulates tyrosine phosphorylation of KRAS through its tyrosine phosphatase activity and that PTPN2-2-Res is the major isoform that performs this function.

[0205] Example 6 Correlation between PTPN2 expression level and poor prognosis of pancreatic cancer

[0206] To verify whether PTPN2 expression is associated with the prognosis of patients with KRAS mutant tumors. The clinical database cBioPortal was analyzed to determine the impact of PTPN2 expression in KRAS-related cancers. Among them, KRAS mutation was negatively correlated with the prognosis of pancreatic adenocarcinoma (PAAD), and patients with KRAS mutation had a poor prognosis, but it was not related to lung adenocarcinoma (LUAD) or colorectal adenocarcinoma (COAD) ( Figure 7 A). Kaplan-Meier survival analysis of PAAD, LUAD, and COAD embedded in the UALCAN web tool was performed. Figure 7 As shown in Figure B, high expression of KRAS mRNA was negatively correlated with overall survival prognosis in PAAD (P = 0.023) and LUAD (P = 0.028), but not in COAD (P = 0.6). Consistent with the prognostic value of KRAS mutations in these three cancers, high expression of PTPN2 was negatively correlated with overall survival prognosis in PAAD patients (P < 0.01), but not in LUAD or COAD patients ( Figure 7 C).

[0207] These results suggest that PTPN2 plays an important role in KRAS-dependent tumors.

[0208] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine <120> Application of PTPN2 inhibitors in KRAS mutant tumors <130> P2020-1052 <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 1 uucuccgaac gugucacgut t 21 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 2 acgugacacg uucggagaat t 21 <210> 3 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 3 gccuugacga uacagcuaat t 21 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 4 uuagcuguau cgucaaggct t 21 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 5 ggacuuagca agaaguuaut t 21 <210> 6 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 6 auaacuucuu gcuaagucct t 21 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 7 gguguugaug augccuucut t 21 <210> 8 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 8 agaaggcauc aucaacacct t 21 <210> 9 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 9 caaaggaguu acaucuuaat t 21 <210> 10 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 10 uuaagaugua acuccuuugt t 21 <210> 11 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 11 gccuuugauc auucaccaat t 21 <210> 12 <211> twenty one <212> DNA <213> Artificial Sequence() <400> 12 uuggugaaug aucaaaggct t 21

Claims

1. Use of a PTPN2 inhibitor in the preparation of a composition or preparation for treating a KRAS-dependent tumor, wherein the KRAS-dependent tumor is selected from the group consisting of pancreatic cancer, fibrosarcoma, lung cancer and skin cancer, and the composition or preparation is used for: (a) Inhibit the localization of KRAS protein to the cell membrane; (b) inhibiting the proliferation of KRAS-dependent tumor cells; (c) Treatment of KRAS-positive tumors; (d) reducing phosphorylation of KRAS downstream signaling molecules; and / or (e) Increase the tyrosyl phosphorylation level of KRAS; in, The inhibitors are PTPN2 siRNA-432 and PTPN2 siRNA-1161, wherein the sense chain sequence of PTPN2 siRNA-432 is shown in SEQ ID NO:9, and the antisense chain sequence is shown in SEQ ID NO:10; the sense chain sequence of PTPN2 siRNA-1161 is shown in SEQ ID NO:11, and the antisense chain sequence is shown in SEQ ID NO:

12.

2. Use of a composition in the preparation of a composition or preparation for treating KRAS-dependent tumor cells, characterized in that: The composition comprises: (i) PTPN2 inhibitors, wherein the inhibitors are PTPN2 siRNA-432 and PTPN2 siRNA-1161, wherein the sense strand sequence of PTPN2 siRNA-432 is shown in SEQ ID NO:9, and the antisense strand sequence is shown in SEQ ID NO:10; the sense strand sequence of PTPN2 siRNA-1161 is shown in SEQ ID NO:11, and the antisense strand sequence is shown in SEQ ID NO:12; (ii) a KRAS inhibitor, wherein the KRAS inhibitor is KRAS siRNA-244, KRAS siRNA-585 and KRAS siRNA-643, wherein the sense strand sequence of KRAS siRNA-244 is shown in SEQ ID NO:3, and the antisense strand sequence is shown in SEQ ID NO:4; the sense strand sequence of KRAS siRNA-585 is shown in SEQ ID NO:5, and the antisense strand sequence is shown in SEQ ID NO:6; the sense strand sequence of KRAS siRNA-643 is shown in SEQ ID NO:7, and the antisense strand sequence is shown in SEQ ID NO:8; and (iii) a pharmaceutically acceptable carrier; The KRAS-dependent tumor is selected from the group consisting of pancreatic cancer, fibrosarcoma, lung cancer and skin cancer.

Images