Method for preparing isothermal amplification mixed enzyme system
The RPA enzyme system was treated by dialysis and ultrafiltration to remove glycerol and concentrate it, which solved the problems of enzyme activity loss and low reaction efficiency, and achieved efficient enzyme system preservation and improved reaction performance.
Patent Information
- Application Number
- CN202111395102.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-11-23
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2041-11-23
AI Technical Summary
The existing freeze-drying method for preparing RPA mixed enzyme system has the problems of large enzyme activity loss and low reaction efficiency.
The prepared RPA enzyme system was dialyzed to remove most of the glycerol, and then concentrated by ultrafiltration to prepare an enzyme system with a trace amount of glycerol.
The amplification efficiency of freeze-dried samples of the RPA mixed enzyme system was significantly improved, the enzyme activity loss was reduced, and the performance of the reaction system was improved.
Smart Images

Figure BDA0003370000170000061 
Figure BDA0003370000170000071 
Figure HDA0003370000180000011
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preparing a constant temperature amplification mixed enzyme system. Background Art
[0002] Freeze-drying (lyophilization) involves freezing a water-containing material below its freezing point, converting the water into ice, and then removing the ice by converting it into vapor under a high vacuum. Enzyme freeze-dried powders produced using freeze-drying technology can be stored at low temperatures without repeated freeze-thaw cycles, making it a well-established and versatile method for preserving enzymes.
[0003] Isothermal amplification utilizes a constant temperature during nucleic acid amplification. Because it eliminates the need for a qPCR instrument, which is essential for qPCR, it can significantly reduce instrument costs. It also eliminates the need for a heating instrument with precise temperature control, allowing for smaller and more portable devices, greatly facilitating its application. Recombinase polymerase amplification (RPA), a type of isothermal amplification technology, is gaining increasing attention in the field of nucleic acid testing due to its high efficiency, sensitivity, and specificity.
[0004] RPA reactions typically require 5-8 individual enzymes to initiate the reaction. Experimental studies have shown that these 5-8 individual enzymes, once mixed to form a complete RPA enzyme system, are unstable when stored at -20°C. Therefore, lyophilization of the RPA enzyme system is used to achieve long-term storage at low temperatures. However, existing lyophilization methods for preparing RPA enzyme mixtures suffer from significant enzyme activity loss and low reaction efficiency.
[0005] Therefore, those skilled in the art are committed to developing a preparation process that can avoid the loss of enzyme activity in the RPA enzyme system. Summary of the Invention
[0006] The object of the present invention is to provide a method for stably preparing a constant temperature amplification enzyme system.
[0007] In a first aspect of the present invention, a method for preparing a mixed enzyme system for isothermal amplification is provided, the method comprising the steps of:
[0008] (1) providing the single enzymes required for the isothermal amplification mixed enzyme system, wherein each single enzyme is independently stored in a separate preservation solution, and the glycerol content in each preservation solution is about 20%-70% (w / w);
[0009] (2) mixing the single enzymes provided in step (1) to prepare a mixed enzyme solution;
[0010] (3) dialyzing the mixed enzyme solution obtained in step (2); and
[0011] Optionally,
[0012] (4) Concentrate the mixed enzyme solution after dialysis.
[0013] In another preferred embodiment, the isothermal amplification mixed enzyme system is an RPA mixed enzyme system.
[0014] In another preferred embodiment, the method further comprises the steps of:
[0015] (5) The dialyzed or concentrated mixed enzyme solution is freeze-dried.
[0016] In another preferred embodiment, the single enzymes required for the isothermal amplification mixed enzyme system include: recombinase, single-strand binding protein, and DNA polymerase.
[0017] In another preferred embodiment, the single enzyme required for the isothermal amplification mixed enzyme system further includes: a loading protein.
[0018] In another preferred embodiment, the single enzymes required for the isothermal amplification mixed enzyme system further include: exonuclease, and / or creatine kinase.
[0019] In another preferred embodiment, the single enzyme required for the isothermal amplification mixed enzyme system further comprises one or more components selected from the following group: reverse transcriptase, ribonuclease inhibitory protein, and inorganic pyrophosphatase.
[0020] In another preferred embodiment, the loading protein is the loading protein UvsY.
[0021] In another preferred embodiment, the exonuclease is exonuclease III (EXO).
[0022] In another preferred embodiment, the recombinase is recombinase UvsX.
[0023] In another preferred embodiment, the single-chain binding protein is the single-chain binding protein gp32.
[0024] In another preferred embodiment, the DNA polymerase is DNA polymerase Bsu.
[0025] In another preferred embodiment, the reverse transcriptase is reverse transcriptase MMLV.
[0026] In another preferred embodiment, in step (3), the dialysate used for dialysis includes: 20-80mM Tris, 200-400mM NaCl, 0.05-0.2mM EDTA, 0.5-2DTT, and the pH of the dialysate is 6.5-7.5; preferably, the dialysate used for dialysis includes: 50mM Tris, 300mM NaCl, 0.1mM EDTA, 1mM DTT, and the pH is 7.0.
[0027] In another preferred embodiment, in step (3), the dialysis bag used for dialysis is a 5-10KD dialysis bag.
[0028] In another preferred embodiment, in step (3), the dialysis temperature is about 0-10°C, preferably 0-4°C; and the dialysis time is 5-24 hours, preferably 10-20 hours.
[0029] In another preferred embodiment, in step (3), the volume of the dialysate used for dialysis is 50-200 times, preferably 100 times, of the volume of the mixed enzyme liquid machine.
[0030] In another preferred embodiment, in step (4), an ultrafiltration tube is used to concentrate the dialyzed mixed enzyme solution.
[0031] The second aspect of the present invention provides a kit, which includes a constant temperature amplification mixed enzyme system prepared using the method described in the first aspect of the present invention.
[0032] In another preferred embodiment, the kit further comprises specific primers and / or probes.
[0033] In another preferred embodiment, the kit includes a first container, wherein the first container contains a constant temperature amplification mixed enzyme system prepared using the method described in the first aspect of the present invention.
[0034] In another preferred embodiment, the kit further comprises a second container, wherein the second container comprises one or more components selected from the group consisting of creatine phosphate, Tris-HCl, ATP, DTT, dNTPs, potassium acetate, and polyethylene glycol.
[0035] In another preferred embodiment, the kit further comprises a third container, wherein the third container contains magnesium acetate.
[0036] In another preferred embodiment, the kit further comprises a fourth container containing water or a buffer solution.
[0037] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Figure 1 The detection results in Example 1 are shown. DETAILED DESCRIPTION
[0039] Through extensive and in-depth research, the inventors unexpectedly discovered that a pre-prepared isothermal amplification enzyme system containing glycerol can be dialyzed to remove the vast majority of the glycerol, followed by ultrafiltration to concentrate the enzyme system containing trace amounts of glycerol. Experimental results showed that the isothermal amplification enzyme system containing trace amounts of glycerol prepared using this method performed better than an enzyme system containing glycerol. Based on this, the present invention was completed.
[0040] Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions may vary. It should also be understood that the terminology used herein is intended to describe specific embodiments only and is not intended to be limiting, and the scope of the present invention will be limited only by the appended claims.
[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to a specific recited value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0042] Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.
[0043] Enzymes typically require relatively low temperatures for long-term storage. Because repeated freeze-thaw cycles can affect enzyme activity, 50% glycerol is often added to the stock solution to ensure liquid storage at -20°C. However, some enzymes remain unstable when stored in liquid form at -20°C, or the enzyme itself requires the avoidance of glycerol during the reaction. In these scenarios, using a 50% glycerol stock solution is not conducive to enzyme preservation.
[0044] The inventors have found that the stock solution of the isothermal amplification (such as RPA) enzyme system has poor stability when storing single enzymes in a frozen state, and the presence of glycerol will reduce the coagulation temperature of the enzyme system, resulting in poor freezing effect of the enzyme system during the freeze-drying process. Glycerol can be removed during the preparation process of each single RPA enzyme to obtain a stock solution without glycerol for each single enzyme, but the single enzyme with glycerol removed cannot be stored at a low temperature of -20°C, and each single enzyme needs to be quality tested and the concentration determined before being configured into a complete RPA enzyme system. This results in the configured single enzyme being stored above 0°C for a period of time, and the storage process above 0°C will cause damage to the enzyme activity, resulting in a decrease in the effect of the configured complete RPA enzyme system.
[0045] The present invention removes most of the glycerol from the prepared glycerol-containing RPA enzyme system through dialysis, and then uses ultrafiltration to concentrate the enzyme system containing trace glycerol. Experiments show that the performance of the RPA trace glycerol enzyme system prepared by this method is better than that of the glycerol-containing enzyme system.
[0046] Recombinase polymerase amplification technique
[0047] Recombinase polymerase amplification (RPA) is a type of isothermal amplification technique. Disclosures of RPA methods include U.S. Patents 7,270,981, 7,399,590, 7,666,598, and 7,435,561; U.S. Patent Publication No. 2009 / 0029421; and International Application No. WO 2010 / 141940.
[0048] The key enzymes in the RPA system include a recombinase that binds to single-stranded nucleic acids (oligonucleotide primers), a single-stranded DNA binding protein (SSB), and a strand-displacing DNA polymerase. The protein-DNA complex formed by the recombinase and primers searches for homologous sequences in double-stranded DNA. Once the primers locate the homologous sequence, a strand exchange reaction occurs, initiating DNA synthesis and exponentially amplifying the target region on the template. The displaced DNA strand binds to the SSB, preventing further displacement.
[0049] The RPA reaction initiates when the recombinase pairs with oligonucleotide primers homologous to the double-stranded DNA template. In the presence of the nucleotide template, exponential amplification begins using two or more sequence-specific primers (e.g., gene-specific). The reaction proceeds rapidly, resulting in sequence-specific amplification of the double-stranded DNA template, with the DNA template expanding from only a few copies to detectable levels within minutes.
[0050] The present invention adds reverse transcriptase, ribonuclease inhibitory protein and inorganic pyrophosphatase to the real-time fluorescence RPA technology. Reverse transcriptase and ribonuclease inhibitory protein are simultaneously used in the reaction system to initiate and maintain the normal progress of the RNA template amplification reaction. The addition of inorganic pyrophosphatase significantly improves the reaction efficiency.
[0051] Recombinase
[0052] The recombinase (recombinant protein) used for RPA reaction can be derived from prokaryotes, viruses or eukaryotes. Typical recombinases include UvsX and RecA (such as RecA protein or UvsX protein obtained from any species), and their fragments or mutants, or any combination thereof.
[0053] RecA and UvsX proteins can be obtained from any species, and RecA and UvsX fragments or mutant proteins can be generated using appropriate RecA and UvsX proteins, nucleotide sequences, and molecular biology techniques (see, for example, the generation of UvsX mutants as described in US Pat. No. 8,071,308). Typical UvsX proteins include those derived from myoviridae phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Other typical recombinase proteins include the archaeal RADA and RADB proteins and the eukaryotic (e.g., plant, mammalian, and fungal) Rad51 proteins (e.g., RAD51, RAD51B, RAD51C, RAD51D, DMC1, XRCC2, XRCC3, and recA) (see, e.g., Lin et al., Proc. Natl. Acad. Sci. USA 103: 10328-10333, 2006).
[0054] In a preferred embodiment of the present invention, the recombinase is the recombinase UvsX. The typical amino acid sequence of UvsX can be found in NCBI sequence number NP_049656.2.
[0055] Single-chain binding protein
[0056] Single-stranded DNA binding proteins (ssDNA binding proteins) can be used to stabilize nucleotides. One or more single-stranded DNA binding proteins can be derived from or obtained from various species, such as prokaryotes, viruses, or eukaryotes. Typical single-stranded DNA binding proteins include, but are not limited to, Escherichia coli SSB and those derived from myoviral phages, such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophages, Vibrio phages, and the like.
[0057] In the present invention, the single-stranded binding protein is preferably the single-stranded binding protein gp32. The gp32 protein plays a key role in the DNA replication, recombination, and repair processes of T4 bacteriophage, most importantly because the gp32 protein has the property of tightly binding to single-stranded DNA. The amino acid sequence of a typical gp32 protein is shown in NCBI sequence number NP_049854.
[0058] DNA polymerase
[0059] The DNA polymerase can be a eukaryotic or prokaryotic polymerase. Examples of eukaryotic polymerases include pol-alpha, pol-beta, pol-delta, pol-epsilon, and mutants or fragments thereof, or combinations thereof. Examples of prokaryotic polymerases include Escherichia coli (E. coli) DNA polymerase I (such as the Klenow fragment), bacteriophage T4 gp43 DNA polymerase, a large fragment of Bacillus stearothermophilus polymerase I, Phi-29 DNA polymerase, T7 DNA polymerase, Bacillus subtilis Pol I, Staphylococcus aureus Pol I, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, and mutants or fragments thereof, or combinations thereof.
[0060] In the present invention, the preferred DNA polymerase is Bsu DNA polymerase. Generally speaking, Bsu DNA polymerase (Bsu DNA Polymerase Large Fragment) is derived from Bacillus subtilis by truncating the first 296 codons of the Bacillus subtilis DNA polymerase I gene. This fragment retains the 5′-3′ polymerase activity of Bsu DNA polymerase, but lacks the 5′-3′ exonuclease activity. The large fragment itself lacks the 3′-5′ exonuclease activity. The amino acid sequence of a typical Bsu DNA polymerase is shown in NCBI sequence number AAR00931.1.
[0061] Loading protein
[0062] The loader protein can be derived from a prokaryotic organism, a virus, or a eukaryotic organism. Typical loader proteins include E. coli RecO, E. coli RecR, UvsY, and mutants or fragments thereof, or combinations thereof. Typical UvsY proteins include those derived from myoviral phages such as T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2.
[0063] In the present invention, the preferred loading protein is loading protein UvsY. The amino acid sequence of a typical loading protein UvsY is shown in NCBI sequence number NP_049799.2.
[0064] Exonucleases
[0065] Exonucleases are a collective term for several subclasses of the hydrolase class (EC 3.1.11.13.14.15.16), which catalyze the hydrolysis of phosphodiester bonds at the ends of nucleic acid chains, cleaving off nucleotides one by one. Based on substrate specificity, they are categorized as DNA exonucleases, RNA exonucleases, and exonucleases that act on both DNA and RNA.
[0066] In a preferred embodiment of the present invention, the exonuclease of the present invention is exonuclease III. The amino acid sequence of a typical exonuclease III can be found in NCBI sequence number WP_000673937.1.
[0067] Creatine kinase
[0068] Creatine kinase (CK) is an important kinase that is directly related to intracellular energy circulation, muscle contraction, and ATP regeneration. It reversibly catalyzes the transphosphoacyl reaction between creatine and ATP.
[0069] Creatine kinase can be rabbit myokinase or carp myokinase, for example carp myokinase M1 type (M1-CK). The amino acid sequence of a typical creatine kinase is shown in NCBI sequence number NP_001075708.1.
[0070] Reverse transcriptase
[0071] Reverse transcriptase, also known as RNA-dependent DNA polymerase, uses RNA as a template, dNTPs as substrates, and tRNA (primarily tryptophan tRNA) as a primer. Based on the principle of base pairing at the 3'-OH end of tRNA, it synthesizes a single DNA strand complementary to the RNA template in the 5'-3' direction. This strand is called complementary DNA (cDNA).
[0072] Reverse transcriptases can be used for synthesizing first-strand cDNA, making cDNA probes, RNA transcription, sequencing, and reverse transcription of RNA. Commonly used reverse transcriptases in the art include murine leukemia virus (M-MLV) reverse transcriptase and avian myeloblastosis virus (AMV) reverse transcriptase. The amino acid sequence of a typical creatine kinase is shown in NCBI sequence number AAA66622.1.
[0073] RNase inhibitory protein
[0074] Ribonuclease inhibitory protein (RNasin) is a protein inhibitor of RNase. It can be extracted from rat liver or human embryonic disc, or produced by genetic recombination. Rnasin is a non-competitive inhibitor of RNase, binding to and inactivating various RNases. The amino acid sequence of a typical Rnasin is available in NCBI sequence number P13489.2.
[0075] Inorganic pyrophosphatase
[0076] Inorganic pyrophosphatase (IPP) catalyzes the hydrolysis of inorganic pyrophosphate to produce orthophosphate. Inorganic pyrophosphatase can be produced by recombinant E. coli strains or yeast strains carrying the inorganic pyrophosphatase gene. The amino acid sequence of a typical inorganic pyrophosphatase is available in NCBI sequence number WP_000055072.1.
[0077] RT-RPA reaction system and detection method
[0078] In a preferred embodiment, the RT-RPA reaction system of the present invention comprises:
[0079] Recombinant protein UvsX, loading protein UvsY, single-strand binding protein gp32, nuclease III, Bsu DNA polymerase, creatine kinase CK, reverse transcriptase (MMLV), RNasin, IPP enzyme, creatine phosphate (PC), Tris-HCl (pH 7.5), ATP, dithiothreitol (DTT), dNTPs, potassium acetate (KOAc), magnesium acetate, polyethylene glycol (such as PEG35000).
[0080] In another preferred embodiment, the contents of the components in the RT-RPA reaction system are as follows:
[0081]
[0082]
[0083] Preferably, the concentration of the upstream primer in the RT-RPA reaction system is 10-200 nM, the downstream primer is 100 nM, the probe is 50-300 nM, and the RNA template is 1-10 μL. Preferably, the total volume of the RT-qRPA system is 15-50 μL, and the remaining volume is supplemented with double-distilled water.
[0084] Reaction procedure:
[0085] Keep the temperature at 20-45℃ and continue the reaction for 10-40 minutes.
[0086] The reaction endpoint can be monitored by agarose gel electrophoresis, Sybr Green I, or a specific probe. When monitoring with Sybr Green I, increase the reaction system to a final concentration of 0.3-0.5x Sybr Green I. The reaction time can be 20-40 minutes, with fluorescence readings taken every 30 seconds. Instruments for detection include the ABI7500, FTC-3000, Bio-Rad CFX MiniOpticon System, and the GenDx GS8 Constant-Temperature Fluorometer.
[0087] If a specific probe is used for detection and amplification, the final concentration of the fluorescently labeled probe should be 10-500 nM. Fluorescence detection can be performed using an ABI QuantStudio 5, ABI 7500, FTC-3000, Bio-Rad CFX MiniOpticon System, or GenDx Constant Temperature Fluorescence Detector GS8.
[0088] The main advantages of the present invention are:
[0089] The method for preparing the RPA mixed enzyme system provided by the present invention can significantly improve the amplification efficiency of the RPA mixed enzyme system freeze-dried sample.
[0090] The method of the present invention can save the cost of additionally preparing a glycerol-free RPA enzyme system, eliminates the need for additional production of a glycerol-free RPA single enzyme, and improves the efficiency of preparing a mixed enzyme system. Experiments have also confirmed that this method can also improve the performance of the reaction system.
[0091] The present invention will be further described in detail below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which detailed conditions are not specified, are generally performed according to conventional conditions such as those described in "Molecular Cloning Laboratory Manual" by Sambrook.J et al. (translated by Huang Peitang et al., Beijing: Science Press, 2002), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. The experimental materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.
[0092] Example 1
[0093] The individual enzymes required for the RPA enzyme system were stored separately in a 50% (w / w) glycerol solution. The individual enzymes included: recombinant protein UvsX, loader protein UvsY, single-strand binding protein gp32, exonuclease III, Bsu DNA polymerase, creatine kinase CK, reverse transcriptase (MMLV), RNasin, and IPP enzyme.
[0094] The nine single enzymes required for the RPA enzyme system were mixed in a specific ratio to prepare an RPA mixed enzyme system (50 mL). Since the eight single enzymes were stored in a preservation solution containing 50% glycerol, the prepared RPA enzyme system stock solution also contained 50% glycerol.
[0095] Prepare glycerol-depleted enzyme dialysis solution with the following formula: 50 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, pH 7.0.
[0096] The glycerol-containing RPA enzyme system was placed in a 10KD dialysis bag. After the two ends of the dialysis bag were sealed, it was placed in 500 mL of glycerol-free enzyme system dialysate, and then the dialysate was placed at 4°C for more than 16 hours.
[0097] The RPA enzyme system after dialysis was taken out from the dialysis bag. Dialysis of the glycerol-containing enzyme system in the glycerol-free dialysate will cause the volume of the enzyme system to increase. Therefore, the dialyzed enzyme system was placed in a 3KD ultrafiltration tube. The ultrafiltration tube was placed in a centrifuge with a speed set to 5000 rpm for 30 minutes to concentrate the enzyme system. The volume of the final trace glycerol mixed enzyme system was the same as that of the mixed enzyme system before dialysis.
[0098] The enzyme content in the RT-RPA reaction system used in this example is as follows:
[0099] Components content Recombinant protein UvsX 500ng / μL Loading protein UvsY 228ngμL Single-chain binding protein gp32 919 ng / μL Exonuclease III 3ng / μL Bsu DNA polymerase 9.5 ng / μL Creatine kinase CK 1ng / μL Reverse transcriptase (MMLV) 5U / μL RNasin 20 U / μL IPPase 1U / μL
[0100] The mixed enzyme system is prepared according to the above ratio.
[0101] The RPA reaction solution used in this example is as follows:
[0102] RPA basic reaction solution components RPA reaction solution component concentration Creatine phosphate (PC) 1mM Tris-HCl (pH 7.5) 10mM ATP 10mM Dithiothreitol (DTT) 2.7mM dNTPs 25 μM Potassium acetate (KOAc) 100mM magnesium acetate 15mM PEG35000 3%
[0103] According to the contents shown in the table, the RPA basic reaction solution was prepared by adding 100 nM upstream primer, 100 nM downstream primer, 150 nM probe, and 8 μL of RNA template for reaction at different concentrations to form a complete RT-qRPA system. The total system volume was 20 μL. The part less than 20 μL was supplemented with double-distilled water to 20 μL.
[0104] Reaction procedure:
[0105] The temperature was kept constant at 42°C for 20 minutes. The detection channel was FAM, and the fluorescence signal was detected every 30 seconds. The detection was carried out on an ABIQuantStudio 5 quantitative PCR instrument.
[0106] The detection target is apoB gene:
[0107] cagtgtatctggaaagcctacaggacaccaaaataaccttaatcatcaattggttacaggaggctttaagttcagcatctttggctcacatgaaggccaaattccgagagactctagaagatacacgagaccgaatgtatcaaatggacattca gcaggaacttcaacgatacctgtctctggtaggccaggtttatagcacacttgtcacctacatttctgattggtggactcttgctgctaagaaccttactgactttgcagagcaatattctatccaagattgggctaaacgtatgaaagca(SEQ ID NO.1)
[0108] Upstream primer: CAGTGTATCTGGAAAGCCTACAGGACACCAAAA (SEQ ID NO. 2)
[0109] Downstream primer: TGCTTTCATACGTTTAGCCCAATCTTGGATAG (SEQ ID NO. 3)
[0110] Probe:
[0111] attcagcaggaacttcaacgatacctgtctc T g-THF- Taggccaggtttatagca[C3-spacer](SEQ ID NO.4)
[0112] The 32nd base is T, which is modified to a base with a FAM fluorescent group;
[0113] A THF (tetrahydrofuran) site was added between the 33rd and 34th bases;
[0114] The 34th base is T, which is modified to a base with a BHQ1 quencher group;
[0115] C3-spacer was added to the 3' end.
[0116] The apoB gene shown above was cloned into a plasmid, and then the T7 in vitro transcription promoter: TAATACGACTCACTATAGG (SEQ ID NO. 5) was added to the 5' end of the template by PCR. Transcription was then initiated by T7 RNA polymerase recognition to obtain the corresponding apoB RNA template. DNase was then added to digest the DNA template, and finally, the template was inactivated by heating at 80°C for 2 minutes.
[0117] Test results such as Figure 1 As shown, the amplification curves represent the test results of the test group using the mixed enzyme system freeze-dried product without dialysis treatment and the mixed enzyme system freeze-dried product after dialysis and concentration treatment, wherein the CT value of the enzyme system test group after dialysis and concentration treatment is 8.697, and the CT value of the enzyme system test group before dialysis treatment is 10.749. The results show that this preparation method not only reduces the glycerol content of the enzyme system from 50% to below 1%, but also significantly improves the amplification efficiency of the reaction system.
[0118] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto. Sequence Listing <110> Guangzhou Daan Gene Co., Ltd. <120> Method for preparing isothermal amplification mixed enzyme system <130> 020100 <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 305 <212> DNA <213> Artificial sequence <400> 1 cagtgtatct ggaaagccta caggacacca aaataacctt aatcatcaat tggttacagg 60 aggctttaag ttcagcatct ttggctcaca tgaaggccaa attccgagag actctagaag 120 atacacgaga ccgaatgtat caaatggaca ttcagcagga acttcaacga tacctgtctc 180 tggtaggcca ggtttatagc acacttgtca cctacatttc tgattggtgg actcttgctg 240 ctaagaacct tactgacttt gcagagcaat attctatcca agattgggct aaacgtatga 300 aagca 305 <210> 2 <211> 33 <212> DNA <213> Artificial sequence <400> 2 cagtgtatct ggaaagccta caggacacca aaa 33 <210> 3 <211> 32 <212> DNA <213> Artificial sequence <400> 3 tgctttcata cgtttagccc aatcttggat ag 32 <210> 4 <211> 51 <212> DNA[[ID=attcagcagg aacttcaacg atacctgtct ctgtaggcca ggtttatagc a 51 <210> 5 <211> 19 <212> DNA <213> Artificial sequence <400> 5 taatacgact cactatagg 19
Claims
1. A method for preparing a mixed enzyme system for isothermal amplification, characterized in that: The method comprises the steps of: (1) Providing the single enzymes required for the isothermal amplification mixed enzyme system, wherein each single enzyme is independently stored in a preservation solution, wherein the glycerol content in each preservation solution is 20%-70% (w / w), and the single enzymes include: a recombinase, a single-strand binding protein, and a DNA polymerase; (2) mixing the single enzymes provided in step (1) to prepare a mixed enzyme solution; (3) dialyzing the mixed enzyme solution obtained in step (2); and Optionally, (4) Concentrating the mixed enzyme solution after dialysis; Wherein, in step (3), the dialysate used for dialysis includes: 20-80 mM Tris, 200-400 mM NaCl, 0.05-0.2 mM EDTA and 0.5-2 DTT, and the pH of the dialysate is 6.5-7.
5.
2. The method according to claim 1, wherein The method further comprises the steps of: (5) Freeze-dry the dialyzed or concentrated mixed enzyme solution.
3. The method according to claim 1, wherein The single enzyme required for the isothermal amplification mixed enzyme system further comprises one or more components selected from the following group: loading protein, nuclease exonuclease and creatine kinase.
4. The method according to claim 1, wherein The single enzymes required for the isothermal amplification mixed enzyme system also include: loading protein, nuclease exonuclease, and creatine kinase.
5. The method according to claim 1, wherein The single enzyme required for the isothermal amplification mixed enzyme system further comprises one or more components selected from the following group: reverse transcriptase, ribonuclease inhibitory protein, and inorganic pyrophosphatase.
6. The method according to claim 1, wherein The isothermal amplification mixed enzyme system is an RPA mixed enzyme system.
7. The method according to claim 4, wherein The loading protein is the loading protein UvsY.
8. The method according to claim 4, wherein The exonuclease is exonuclease III.
9. The method according to claim 3, wherein The recombinase is recombinase UvsX.
10. The method according to claim 3, wherein The single-chain binding protein is single-chain binding protein gp32.
11. The method according to claim 3, wherein The DNA polymerase is DNA polymerase Bsu.
12. The method according to claim 5, wherein The reverse transcriptase is reverse transcriptase MMLV.
13. The method according to claim 1, wherein In step (3), the dialysis bag used for dialysis is a 5-10KD dialysis bag.
14. The method according to claim 1, wherein In step (3), the dialysis temperature is 0-10°C; and the dialysis time is 5-24 hours.
15. The method according to claim 14, wherein In step (3), the dialysis temperature is 0-4°C.
16. The method according to claim 14, wherein In step (3), the dialysis time is 10-20 hours.
17. The method according to claim 1, wherein In step (4), the dialyzed mixed enzyme solution is concentrated using an ultrafiltration tube.
Citation Information
Patent Citations
Recombinase polymerase amplification
US20090029421A1
Recombinase polymerase amplification
US7270981B2
Recombinase polymerase amplification
US7399590B2
Methods for multiplexing recombinase polymerase amplification
US7435561B2
Recombinase polymerase amplification
US7666598B2