Methods and systems for detecting methylation changes in DNA samples

Abstract

Methods and systems are provided for highly sensitive detection of methylation changes in DNA samples, particularly DNA samples obtained from biological fluids such as plasma and urine.

Description

Field of the Invention

[0001] The present invention relates to a method and system for highly sensitively detecting methylation changes in DNA samples, particularly methylation changes in DNA samples obtained from biological fluids such as plasma and urine. The system and method can be used for disease diagnosis. Background of the Invention

[0003] DNA methylation alterations are known to occur in many types of cancer, including hypomethylation of isolated CpGs and hypermethylation primarily at CpG islands. Specifically, hypermethylation of CpG islands in the promoter regions of tumor suppressor genes has been extensively studied and demonstrated in many different types of cancer, leading to gene silencing.

[0004] Tumors release DNA fragments or "cell-free DNA" into body fluids, and therefore methylation changes in tumor-derived DNA molecules can be detected in "liquid biopsies" obtained from body fluids such as plasma and urine. Compared with traditional biopsies, liquid biopsies are non-invasive and can better represent the full genetic profile of tumor subclones. Therefore, the detection of cancer-associated methylation changes in liquid biopsies has great promise for early detection, prognosis, and treatment monitoring. However, in order to detect tumor-derived DNA in liquid biopsies, ultrasensitive biochemical methods are required because tumor DNA can be present in extremely low amounts relative to the large background of normal DNA.

[0005] Several techniques have been developed for detecting methylated molecules in liquid biopsies based on sodium bisulfite treatment of DNA followed by quantitative PCR, with analytical sensitivities as high as 1:10,000 (Cottrell et al., Nucleic Acids Res., 2004, 32(1):e10; Kristensen and Hansen, Clin Chem., 2009, 55(8):1471-83; Zou et al., Clin Chem., 2012, 58(2):375-83). Based on these assays, commercial products have been introduced for the detection of colorectal cancer in blood and feces, and for the detection of bladder cancer in urine (Young et al. Cancer Med., 2016, 5(10):2763-72; Imperiale et al., N Engl J Med., 2014, 370(14):1287-97; Van Kessel et al., J Urol., 2016, 195(3):601-7). Although sodium bisulfite conversion of DNA is popular, it is a cumbersome assay with disadvantages including degradation of the template DNA and preferential amplification of either methylated or unmethylated DNA in subsequent PCR.

[0006] Another study based on bisulfite sequencing is described in Moss et al., Nature Communications, Vol. 9, Article No. 5068 (2018), in which cell-free DNA in plasma samples was analyzed using bisulfite conversion and commercial methylation arrays. Moss et al. used plasma methylation patterns to identify cell type-specific cfDNA under healthy and pathological conditions. In particular, Moss et al. evaluated the accuracy of cancer detection using deconvolution by performing a mixing experiment: plasma from patients with colon cancer was mixed with plasma from healthy donors in different proportions, and the methylation group of the resulting mixture was deconvoluted. The algorithm correctly identified the presence of colon DNA in the mixture, with a correct proportion as low as 3% (33-fold dilution of the original cancer plasma sample).

[0007] Non-bisulfite-based DNA methylation analysis methods include affinity / antibody enrichment or methylation-sensitive and / or dependent restriction. Methods based on methylation-dependent restriction include differential methylation hybridization, methylated CpG island amplification and microarrays, enrichment of HpaII microfragments by ligation-mediated PCR, combined bisulfite restriction analysis, and methylation-specific multiplex ligation-dependent probe amplification. These non-bisulfite-based methods are primarily used for whole genome analysis.

[0008] In order to analyze specific loci, some methods using methylation-sensitive and / or dependent restriction enzymes have been developed. For example, a method combining methylation-sensitive restriction, methylation-dependent restriction, double digestion and mock digestion (mock digest) and subsequent quantitative PCR was developed (Oakes et al., Epigenetics., 2006, 1 (3): 146-52), but it requires four separate restriction and amplification reactions for each analyzed locus, which complicates the determination and limits its applicability in samples with limited input DNA. A similar but simpler method uses a methylation-dependent restriction reaction followed by quantitative real-time PCR and comparison with the same DNA sample that was mock-digested and PCR-amplified (Hashimoto et al., Epigenetics., 2007, 2 (2): 86-95). This method has also been used by different teams for quantitative analysis of methylation levels in hepatocellular carcinoma (Huang et al., Exp Mol Pathol., 2011, 91 (3): 702-7). Although simpler, this method still requires two separate digestions and PCR for each analyzed locus. Another variation of this general technique has recently been used to detect the methylation signature of lung cancer, pulmonary fibrosis and COPD patients (Wielscher et al., EBioMedicine., 2015, 2 (8): 929-36). In this variation, a single restriction reaction is performed with a methylation-sensitive enzyme, followed by two rounds of continuous PCR amplification (the initial round of high multiplexing, followed by the round of single locus PCR). The methylation level of each locus is determined by comparing the signal obtained from the locus with the signal obtained from the control locus, which is amplified in a separate hole. Although this method has only adopted one restriction reaction, the use of two continuous PCR amplifications has led to quite complex determinations. In addition, the restriction mentioned above for methylation analysis, followed by the determination based on amplification, depends on the comparison of the signals from different PCR holes, and this may potentially introduce high levels of noise, even if the determination is correctly performed, because each hole has slightly different reagent concentrations and thermal conditions.

[0009] WO 2011 / 070441, assigned to the applicant of the present invention, discloses another methylation analysis method based on methylation-sensitive and / or methylation-dependent restriction enzymes. More specifically, WO 2011 / 070441 discloses a method for classifying DNA samples based on methylation differences, comprising: (A) digesting a DNA sample with a methylation-sensitive and / or methylation-dependent restriction endonuclease; (B) performing PCR on the digested DNA to co-amplify at least two genomic loci, at least one of which is a restriction locus that is differentially methylated between different DNA classes; (C) determining the signal intensity of each amplified product; (D) calculating a signal ratio between the signal intensities generated by the loci; and (E) comparing the signal ratio to reference values ​​corresponding to different classes of DNA, wherein the class for which the reference value best corresponds to the signal ratio is determined as the class of the DNA sample. The classes of DNA samples include, for example, DNA from different tissues and / or physiological / pathological states.

[0010] WO 2017 / 006317 and WO 2019 / 142193, assigned to the applicant of the present invention, disclose methods for identifying bladder cancer and lung cancer, respectively, based on DNA methylation changes at selected genomic loci. These methods comprise calculating signal intensity ratios between co-amplified selected loci from a test DNA sample after digestion with at least one methylation-sensitive restriction enzyme, and comparing these ratios to one or more reference ratios.

[0011] There is a need for improved methods for detecting methylation changes in DNA samples that are more sensitive and accurate than existing methods. For example, there is a need for improved detection of low amounts of methylated DNA molecules in a large background of unmethylated DNA. Such methods are highly desirable in the field of disease diagnosis, particularly cancer diagnosis based on circulating DNA derived from tumors. SUMMARY OF THE INVENTION

[0013] The present invention provides methods and systems for detecting methylation changes in DNA samples with improved sensitivity.

[0014] The present inventor has previously developed a method for detecting methylation changes, and the method is based on the signal ratio corresponding to methylation ratio between locus in calculating DNA sample.Specifically, according to some embodiments, the method comprises digesting DNA sample with the restriction endonuclease that methylation is sensitive or methylation is dependent, at least one restriction locus and a control locus (the restriction locus comprises the recognition sequence of restriction endonuclease, and differential methylation between normal and disease DNA) are amplified from the DNA of digestion, the signal intensity of the amplified product of each locus is determined, and the ratio between the signal intensity of restriction locus and control locus is calculated.Calculate in a single reaction mixture, the signal ratio between the restriction locus and the control locus amplified together from identical DNA sample (identical template).Signal ratio can be compared with one or more reference ratios to detect methylation changes and determine that DNA sample is normal or derives from diseased cells, such as tumor cells, and the reference ratio is determined for the same restriction locus and the control locus in the DNA of known source.

[0015] The present invention discloses an improvement to the above-mentioned method, which achieves very high sensitivity when detecting methylated DNA molecules. As disclosed herein, high sensitivity is obtained when the DNA sample analyzed (i.e., the DNA sample after extraction from the biological sample) is substantially devoid of single-stranded DNA. As illustrated below, the presence of ssDNA impairs the digestion efficiency of the sample by the methylation-sensitive / dependent restriction enzyme used in the assay. Therefore, the ability of the assay to accurately detect methylation changes is impaired. The sensitivity that can be obtained using the improved method disclosed herein is illustrated below in an analytical environment in which methylated and unmethylated DNA molecules are mixed in different ratios. The method demonstrates a methylation detection sensitivity as low as 1:200,000, i.e., a single methylated DNA molecule is detected in a background of 200,000 non-methylated molecules. Such sensitivity has not been described to date.

[0016] Thus, the improvements disclosed herein result in a method that is particularly suitable and beneficial for clinical applications requiring analysis of small amounts of methylated DNA, such as analysis of circulating DNA of tumor origin.

[0017] In some embodiments, a DNA sample substantially lacking ssDNA can be obtained by extracting DNA from a test biological sample under non-denaturing conditions and using non-denaturing reagents.

[0018] According to the methods and systems of the present invention, DNA is extracted from a biological sample, such as a plasma sample, to obtain DNA that is substantially devoid of ssDNA. The DNA is then subjected to a methylation ratio analysis, wherein the DNA is digested with at least one methylation-sensitive restriction enzyme or with at least one methylation-dependent restriction enzyme, and then the restriction loci and control loci are co-amplified from the digested DNA. Restriction loci according to the present invention contain recognition sequences for at least one restriction enzyme used in the digestion step and are therefore cleaved (digested) according to their methylation levels. For example, for methylation-sensitive restriction enzymes, whose recognition sequences are only cleaved when unmethylated, DNA samples with high methylation are digested to a lesser extent than DNA samples with low methylation because fewer recognition sequences are digested in the population of DNA molecules comprising the sample.

[0019] According to the restriction locus of the present invention, differential methylation occurs between normal DNA and disease DNA, such as differential methylation occurs between normal DNA and cancer DNA. Therefore, the degree of cutting of the DNA sample from a healthy subject is different from that of the DNA sample from a cancer patient. The difference in digestion efficiency sets up different amplification patterns in subsequent amplification and quantitative steps. The difference in amplification pattern allows for differentiation between DNA from a healthy subject and DNA from a patient (e.g., cancer patient).

[0020] Amplification and quantitative steps according to the method and system of the present invention include amplification of at least one restriction locus and a control locus from the DNA digested. The control locus can be a locus that is not cut by the restriction enzyme used in the digestion step. The signal intensity of the locus amplified is then determined and the ratio between the signal intensity of each restriction locus and the control locus is calculated. DNA from healthy subjects and DNA from patients (e.g., cancer patients) produce different signal ratios.

[0021] The calculated signal ratio of the DNA from the tested subject can be compared with one or more reference ratios of the same restriction locus and control locus in a determined DNA sample of known origin (i.e., from a healthy subject or from a patient, such as a cancer patient). Based on this comparison, the sample tested is identified as being derived from a cancer patient or from a healthy subject. It should be noted that the methods and systems of the present invention do not require determination of the methylation level of the individual locus itself.

[0022] According to one aspect, the present invention provides a method for sensitively detecting methylation changes in a DNA sample, the method comprising:

[0023] (a) providing a DNA sample, wherein the DNA sample contains less than 5% single-stranded DNA (ssDNA); and

[0024] (b) performing a methylation ratio analysis on the DNA sample by digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus from the digested DNA, and comparing a ratio between signal intensities of amplified products of each of the at least one restriction locus and the control locus to at least one reference ratio,

[0025] This allows for detection of methylation changes in DNA samples with a sensitivity of at least 1:100.

[0026] In some embodiments, the DNA is cell-free DNA extracted from a biological fluid sample.

[0027] In some embodiments, the biological fluid sample is plasma, serum, or urine.

[0028] In some embodiments, the DNA sample contains less than 1% ssDNA.

[0029] In some embodiments, the DNA sample contains less than 0.1% ssDNA.

[0030] In some embodiments, the DNA sample contains less than 0.01% ssDNA or no ssDNA.

[0031] In some embodiments, the methylation changes in the sample are detected with a detection sensitivity of at least 1:500.

[0032] In additional embodiments, the methylation changes in the sample are detected with a detection sensitivity of at least 1:1,000.

[0033] In some embodiments, detecting a methylation change comprises determining whether the DNA sample is a normal or disease DNA sample. In some specific embodiments, detecting a methylation change comprises determining whether the DNA sample is a normal DNA sample or a cancer DNA sample.

[0034] In some embodiments, the methylation ratio analysis in step (b) is performed using real-time PCR.

[0035] In some embodiments, the methylation ratio analysis in step (b) is performed using next generation sequencing (NGS).

[0036] In some embodiments, the method comprises amplifying in step (b) more than one restriction locus that is differentially methylated between normal DNA and disease DNA and a single control locus.

[0037] According to another aspect, the present invention provides a method for measuring DNA methylation ratio from a human subject, the method comprising:

[0038] (a) providing a DNA sample from a human subject, wherein the DNA sample contains less than 5% single-stranded DNA (ssDNA); and

[0039] (b) performing a methylation ratio analysis on the DNA sample by digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus from the digested DNA, and calculating a ratio between the signal intensities of amplified products of each of the at least one restriction locus and the control locus using software stored in a non-transitory memory and implemented on a computer processor,

[0040] The methylation ratio of DNA from human subjects is thereby measured with a methylation detection sensitivity of at least 1:100.

[0041] According to another aspect, the present invention provides a system for detecting methylation changes in a DNA sample, the system comprising:

[0042] (a) a DNA sample, wherein the DNA sample contains less than 5% single-stranded DNA (ssDNA); and

[0043] (b) components for performing a methylation ratio analysis, the components comprising: (i) at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease for digesting a DNA sample; (ii) more than one primer pair for co-amplifying more than one genomic loci from the DNA sample after digestion, wherein the more than one genomic loci include at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus; and (iii) computer software stored on a non-transitory computer-readable medium that directs a computer processor to determine a methylation alteration in the DNA sample based on a comparison of a ratio of signal intensities of the restriction loci and the control loci after amplification to a reference ratio,

[0044] The methylation changes were determined with a detection sensitivity of at least 1:100.

[0045] In some embodiments, the DNA is cell-free DNA extracted from a biological fluid sample.

[0046] In some embodiments, the biological fluid sample is plasma, serum, or urine.

[0047] In some embodiments, the DNA sample contains less than 1% ssDNA.

[0048] In some embodiments, the DNA sample contains less than 0.1% ssDNA.

[0049] In some embodiments, the DNA sample contains less than 0.01% ssDNA or no ssDNA.

[0050] In some embodiments, the methylation change is determined with a detection sensitivity of at least 1:500.

[0051] In further embodiments, the methylation change is determined with a detection sensitivity of at least 1:1,000.

[0052] In some embodiments, the more than one locus includes more than one restriction locus that is differentially methylated between normal DNA and disease DNA and a single control locus.

[0053] In some embodiments, the methylation change is determined by calculating the signal intensity of amplified products of the restriction locus and the control locus; calculating the ratio between the signal intensities of the amplified products; and comparing the calculated ratio to one or more reference ratios obtained from DNA samples of known origin.

[0054] In some embodiments, determining the methylation change in a DNA sample comprises providing an indication of whether the DNA sample is a normal or disease DNA sample. In some specific embodiments, determining the methylation change in a DNA sample comprises providing an indication of whether the DNA sample is a normal DNA sample or a cancer DNA sample.

[0055] In some embodiments, the components for performing methylation ratio analysis further include more than one fluorescent probe for detecting amplification products of at least one restriction locus and at least one control locus.

[0056] In some embodiments, the components for performing methylation ratio analysis further include more than one fluorescent probe for detecting amplification products of at least one restriction locus and at least one control locus.

[0057] In some embodiments, the system further comprises a DNA extraction reagent for extracting DNA from the biological sample, wherein the extracted DNA contains less than 5% ssDNA.

[0058] These and further aspects and features of the invention will be apparent from the following detailed description, examples, and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 .The effect of single-stranded DNA on digestion efficiency.

[0061] Figure 2A Bisulfite sequencing of the test loci in HCT-15 (methylated) and plasmid (unmethylated) DNA samples. The recognition sites of the endonucleases used in the assay are indicated. Figure 2B Figure 2. Amplification plots of a mixture of methylated and unmethylated DNA. Plots from six separate PCR reactions are superimposed. An internal reference ("control") was amplified at approximately the same cycles in all reactions, primarily reflecting amplification from 4,000,000 unmethylated DNA template molecules. As the amount of methylated DNA decreased, the test locus amplified with increasing ΔCQ compared to the control locus ("control").

[0062] Figure 3 Linear regression fit of expected ΔCQ vs. calculated ΔCQ between the test locus and the internal reference locus.

[0063] Figure 4.1: Amplification plots of 200,000 methylated:unmethylated DNA samples (A) and pure unmethylated DNA samples (B). Overlay of 34 replicate PCR results.

[0064] Figure 5 Relative copy number of four cancer methylation markers and KRAS mutation status in 8 control and 9 cancer samples using an NGS-based assay. Con = control, CRC = colorectal cancer, Ovar = ovarian cancer, Pan = pancreatic cancer, AML = acute myeloid leukemia, Uterine cancer = uterine cancer, Lung = lung cancer. Detailed Description of the Invention

[0066] The present invention relates to systems and methods for detecting methylation changes in DNA samples with high sensitivity.

[0067] As used herein, "detecting methylation changes" refers to detecting whether a test DNA sample contains methylation changes compared to a reference DNA sample, detecting whether a DNA sample has a different methylation profile at selected genomic loci compared to a reference methylation profile (represented herein by signal ratios between loci), and / or determining whether the methylation profile of a DNA sample (represented herein by signal ratios between selected genomic loci) is normal or contains methylation changes that indicate the presence of a disease.

[0068] The methods and systems of the present invention detect methylation (and subsequently, changes in methylation) with very high detection sensitivity.

[0069] As used herein, "sensitivity" or "detection sensitivity," when referring to methylation detection, indicates the ability to detect (identify) methylated DNA molecules in a sample containing both methylated and unmethylated DNA molecules. Detection sensitivity is expressed as the ratio of the number of methylated molecules to the number of unmethylated molecules. For example, a detection sensitivity of 1:1000 indicates the ability to detect 1 methylated DNA molecule in a background of 1,000 unmethylated DNA molecules.

[0070] In some embodiments, the detection sensitivity of the methods and systems of the present invention is at least 1: 100, preferably at least 1:500, more preferably at least 1: 1000. Each possibility represents a separate embodiment of the present invention.

[0071] Example 3 hereinafter shows an exemplary assay for determining the sensitivity of detection (analytical sensitivity) in an analytical environment, wherein the methylated DNA molecule at the selected genomic locus place of interest is mixed with unmethylated DNA molecule at different ratios, and the ability of detecting methylated DNA molecule has been tested.Methylated DNA molecule can be obtained from, for example, the cell line that selected genomic locus is methylated.Unmethylated DNA molecule can be an unmethylated artificial DNA molecule fully, for example, by cloning the selected genomic locus into the DNA molecule obtained in a plasmid.

[0072] As exemplified below, the method according to the present invention can detect methylated DNA molecules with a detection sensitivity as low as 1:200,000, ie, a single methylated DNA molecule is detected against a background of 200,000 unmethylated molecules.

[0073] In some embodiments, the methods and systems of the present invention have an analytical sensitivity in detecting methylated DNA molecules (e.g., as determined in an assay as described in Example 3 below) of at least 1:50,000, preferably at least 1:100,000, more preferably at least 1:200,000. Each possibility represents a separate embodiment of the present invention.

[0074] According to the present invention, very high sensitivity is achieved by providing a DNA sample for analysis that is substantially devoid of single-stranded DNA.

[0075] The high sensitivity obtained by the present invention is valuable, for example, for analyzing liquid biopsy samples containing circulating DNA of tumor origin, in which tumor DNA is typically present in very low amounts relative to a background of normal DNA. High analytical sensitivity is important not only when conducting actual clinical trials, but also during the development phase when searching for potential biomarkers. Most of the currently published data on methylation levels in samples from normal and diseased subjects were obtained using methods with high genomic coverage but relatively low analytical sensitivity. Therefore, it is impossible to single out genomic loci with very low methylation levels. Therefore, the methods and systems disclosed herein can also be used for biomarker development to identify biomarkers that have "gone under the radar" by conventional methylation assays.

[0076] The methods and systems of the present invention are particularly beneficial because they provide highly sensitive and specific means for screening and / or diagnosing various diseases, such as cancer, in a non-invasive and user-independent manner.

[0077] In addition, compared to conventional methods that utilize methylation analysis to distinguish between tumor-derived DNA and normal DNA (which requires determining the actual methylation level at a specific genomic locus), the method described herein does not require evaluation of absolute methylation levels. Therefore, the method disclosed herein eliminates the need for a standard curve and / or additional laborious steps involved in determining the methylation level itself, thereby providing a simple and cost-effective procedure. The signal ratio obtained by the method of the present invention confers additional advantages over known methods for analyzing methylation, as the signal ratio is calculated between loci amplified from the same DNA template in the same reaction mixture (i.e., under the same reaction conditions). This renders the method insensitive to various "noise" factors such as changes in template DNA concentration, PCR conditions, and the presence of inhibitors. Such noise is inherent in existing methods based on quantifying the methylation level of a locus by comparing signals from different amplification reactions.

[0078] Methylation in the human genome exists in the form of 5-methylcytosine and is limited to cytosine residues that are part of the sequence CG, also known as CpG dinucleotides (cytosine residues that are part of other sequences are not methylated). Some CG dinucleotides in the human genome are methylated, and others are not. In addition, methylation is cell and tissue specific, such that a particular CG dinucleotide can be methylated in a particular cell and unmethylated in a different cell, or methylated in a particular tissue and unmethylated in a different tissue. DNA methylation is an important regulator of gene transcription.

[0079] The terms "DNA from," "DNA derived from," and the like are interchangeable and refer to DNA obtained (eg, extracted or isolated) from a sample (eg, a plasma sample).

[0080] According to the present invention, DNA is obtained from accessible samples without the need for a biopsy. In some embodiments, DNA is obtained from plasma or serum.

[0081] As used herein, the term "identifying a disease (e.g., cancer) in a subject" encompasses any one or more of: screening for a disease, detecting the presence of a disease, detecting the recurrence of a disease, detecting susceptibility to a disease, detecting response to treatment, determining the efficacy of a treatment, determining the stage (severity) of a disease, determining a subject's prognosis for a disease, and early diagnosis. Each possibility represents a separate embodiment of the present invention.

[0082] As used herein, the terms "subject" and "individual" are interchangeable and refer to a human subject. A subject may be suspected of having a disease. In some embodiments, a subject may be at risk of developing a disease, for example, based on a history of the disease, a genetic predisposition, and / or a family history, and / or a subject who exhibits suspected clinical signs of the disease. In some embodiments, a subject may exhibit at least one symptom or characteristic of the disease. In other embodiments, a subject may be asymptomatic.

[0083] As used herein, the term "a plurality of" means 'at least two' or 'two or more'.

[0084] In some embodiments, provided herein is a method for sensitively detecting methylation changes in a DNA sample, the method comprising: (a) providing a DNA sample, wherein the DNA sample contains less than 5% single-stranded DNA (ssDNA); and (b) performing a methylation ratio analysis on the DNA sample by digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus from the digested DNA, and comparing the ratio between the signal intensities of the amplified products of each of the at least one restriction locus and the control locus with at least one reference ratio using software stored in a non-transitory memory and implemented on a computer processor, thereby detecting the methylation changes in the DNA sample with a detection sensitivity of at least 1:100.

[0085] In some embodiments, provided herein is a method for detecting methylation changes in a DNA sample using methylation ratio analysis, comprising: digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus from the digested DNA, and comparing the ratio between the signal intensities of the amplified products of each of the at least one restriction locus and the control locus with at least one reference ratio, characterized in that the DNA sample contains less than 5% ssDNA and the detection sensitivity is at least 1:100.

[0086] Plasma sample collection

[0087] The term "plasma" refers to the fluid remaining after a whole blood sample has been subjected to a separation process to remove blood cells. A plasma sample can be a sample separated from whole blood using any separation method, including, for example, by centrifugation and / or filtration. A plasma sample can be collected using conventional collection containers or tubes.

[0088] DNA extraction

[0089] According to the present invention, the DNA sample for methylation analysis is substantially free of ssDNA. As used herein, "substantially free of ssDNA" or "substantially lacking ssDNA" indicates a DNA sample in which less than 7% of the DNA is ssDNA, preferably less than 5% of the DNA is ssDNA, and more preferably less than 1% of the DNA is ssDNA (i.e., at least 99% of the DNA is double-stranded). In some embodiments, the DNA sample contains less than 1% ssDNA. In some embodiments, the DNA sample contains less than 0.1% ssDNA. In some embodiments, the DNA sample contains less than 0.01% ssDNA. In some embodiments, the DNA sample does not contain ssDNA (does not contain ssDNA). Commercial kits are available for quantifying single-stranded DNA in a sample. An example is the Promega Reagent test kit.

[0090] In some embodiments, the DNA sample is a DNA sample that has been extracted to be substantially devoid of ssDNA. In some embodiments, to avoid single-stranded DNA, the extraction procedure should not contain reagents that denature the DNA and / or should be performed under conditions that denature the DNA. Examples of DNA denaturing reagents include dimethyl sulfoxide (DMSO) and formamide. Conditions that denature the DNA include chemical (e.g., caustic alkaline treatment), physical (e.g., sonication), and thermal (e.g., temperatures above 60°C).

[0091] Thus, in some embodiments, a DNA sample substantially lacking ssDNA can be obtained by extracting DNA from a test biological sample under non-denaturing conditions and using non-denaturing reagents.Exemplary methods are provided in the Examples section herein below.

[0092] As used herein, "non-denaturing" refers to DNA, ie, reagents and / or conditions that are non-denaturing to DNA.

[0093] Another strategy that can be employed to obtain a DNA sample that is substantially devoid of ssDNA is to eliminate single strands in the extracted DNA. This can be done, for example, by treating the extracted DNA with exonuclease I, which digests single-stranded DNA.

[0094] DNA digestion

[0095] According to the present invention, after extraction, the DNA is subjected to digestion with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease. For example, one, two, or three methylation-sensitive or methylation-dependent restriction endonucleases can be used. Each possibility represents a separate embodiment of the present invention.

[0096] In some embodiments, the entire DNA extracted is used for the digestion step. In some embodiments, the DNA is not quantified before undergoing digestion. In other embodiments, the DNA can be quantified before digestion of the DNA.

[0097] "Restriction endonucleases" and "restriction enzymes" are used interchangeably herein to refer to enzymes that cleave DNA at or near specific recognition nucleotide sequences called restriction sites.

[0098] A "methylation-sensitive" restriction endonuclease is one that cleaves its recognition sequence only when it is unmethylated (while methylated sites remain intact). Thus, the extent to which a DNA sample is digested by a methylation-sensitive restriction endonuclease depends on the level of methylation, with higher methylation levels protecting against cleavage and correspondingly resulting in less digestion.

[0099] A "methylation-dependent" restriction endonuclease is one that cleaves its recognition sequence only if it is methylated (while unmethylated sites remain intact). Thus, the extent of digestion of a DNA sample by a methylation-dependent restriction endonuclease depends on the level of methylation, with higher methylation levels resulting in more extensive digestion.

[0100] In some embodiments, the at least one methylation-sensitive restriction endonuclease can be selected from the group consisting of: AatII, Acc65I, AccI, Acil, ACII, Afel, Agel, Apal, ApaLI, AscI, AsiSI, Aval, AvaII, BaeI, BanI, BbeI, BceAI, BcgI, BfuCI, BglI, BmgBI, BsaAI, BsaBI, BsaHI, Bsa I, BseYI, BsiEI, BsiWI, BslI, BsmAI, BsmBI, BsmFI, BspDI, BsrBI, BsrFI, BssHII, BssKI, BstAPI, BstBI, BstUI, BstZl7I, Cac8I, ClaI, DpnI, DrdI, EaeI, EagI, Eagl-HF, EciI, EcoRI, EcoRI-HF, FauI, Fnu4HI, Fs eI, FspI, HaeII, HgaI, HhaI, HincII, HincII, Hinfl, HinPlI, HpaI, HpaII, Hpyl66ii, Hpyl88iii, Hpy99I , HpyCH4IV, KasI, MluI, MmeI, MspAlI, MwoI, NaeI, NacI, NgoNIV, Nhe-HFI, NheI, NlaIV, NotI, NotI-HF, N In some specific embodiments, at least one methylation-sensitive restriction endonuclease comprises HinP1I. In other specific embodiments, at least one methylation-sensitive restriction endonuclease comprises HhaI.

[0101] In some embodiments, the at least one methylation-dependent restriction endonuclease may be selected from the group consisting of: McrBC, McrA, and MrrA. Each possibility represents a separate embodiment of the present invention.

[0102] In some embodiments, the DNA is digested with a single methylation-sensitive restriction endonuclease. In some specific embodiments, the methylation-sensitive restriction endonuclease is HinP1I. In other specific embodiments, the methylation-sensitive restriction endonuclease can be HhaI.

[0103] In some embodiments, DNA digestion can be performed until complete digestion. In some embodiments, the methylation-sensitive restriction endonuclease can be HinP1I, and complete digestion can be achieved after incubation with the enzyme at 37°C for 1 to 2 hours. In other embodiments, the methylation-sensitive restriction endonuclease can be HhaI, and complete digestion can be achieved after incubation with the enzyme at 37°C for 1 to 2 hours.

[0104] Amplification of genomic loci

[0105] As used herein, the terms "genomic locus" or "locus" are interchangeable and refer to a DNA sequence at a specific location on a chromosome. A specific location can be identified by molecular position, i.e., by the numbering of the starting and ending base pairs on the chromosome. As used herein, these terms also include the DNA sequence at a specific location together with a 5' flanking sequence and / or a 3' flanking sequence of up to about 50 bases immediately upstream and / or downstream of the DNA sequence.

[0106] In some embodiments, the 5' flanking sequence can comprise a base between 1 and 50. In other embodiments, the 5' flanking sequence has a base between 10 and 40. For example, the 5' flanking sequence can comprise a maximum of 10 bases, a maximum of 15 bases, a maximum of 20 bases, a maximum of 25 bases, a maximum of 30 bases, a maximum of 35 bases, a maximum of 40 bases, a maximum of 45 bases, or a maximum of 50 bases immediately upstream of the locus. Each possibility represents a separate embodiment of the present invention.

[0107] In some embodiments, the 3' flanking sequence can comprise between 1 and 50 bases. In other embodiments, the 3' flanking sequence has between 10 and 40 bases. For example, the 3' flanking sequence can comprise up to 10 bases, up to 15 bases, up to 20 bases, up to 25 bases, up to 30 bases, up to 35 bases, up to 40 bases, up to 45 bases, or up to 50 bases immediately downstream of the locus. Each possibility represents a separate embodiment of the present invention.

[0108] The variant of the DNA sequence at a given genomic position is called an allele. The alleles of a locus are located at the same site on homologous chromosomes. The locus includes the gene sequence and other genetic elements (e.g., intergenic sequences).

[0109] "Restriction locus" is used herein to describe a locus that contains at least one restriction site, i.e., at least one site having a recognition sequence for at least one restriction enzyme applied in the digestion step. According to the present invention, the restriction locus is differentially methylated between normal DNA and disease DNA, meaning that for a given disease being analyzed, such as a certain type of cancer, the restriction locus has different methylation levels between normal DNA and DNA derived from cancer cells. For example, DNA from cancer cells may have increased methylation levels at the restriction locus compared to normal, non-cancerous DNA. More specifically, the restriction locus contains CG dinucleotides that are methylated to a greater extent in cancer DNA than in normal, non-cancerous DNA. According to the present invention, the differentially methylated CG dinucleotides are located within the recognition site for at least one restriction enzyme applied in the digestion step.

[0110] In some embodiments, the restriction locus according to the present invention comprises at least one restriction site for a methylation-sensitive restriction enzyme, wherein the CG dinucleotides in the DNA from the plasma of a patient suffering from a certain type of cancer are methylated to a greater extent than in the DNA from the plasma of a healthy subject, meaning that a larger amount of DNA molecules in the plasma of a cancer patient are methylated at this position compared to the plasma of a healthy subject. A methylation-sensitive restriction enzyme will only cleave its recognition sequence when its recognition sequence is unmethylated. Therefore, a DNA sample comprising a higher percentage of DNA molecules in which the CG dinucleotides in the restriction site are methylated will be digested to a lower degree than a DNA sample comprising a higher percentage of DNA molecules in which the CG dinucleotides are unmethylated. DNA digestion by methylation-sensitive restriction enzymes is less extensive for DNA from plasma samples of cancer patients than for DNA from normal (healthy) individuals. The difference in digestion efficiency establishes different amplification patterns in subsequent amplification and quantification steps, which achieves the distinction between DNA from cancer patients and DNA from healthy subjects.

[0111] The restriction loci according to the invention may contain additional CG dinucleotides, the methylation status of which has no relevance or influence on the assay - only the methylation at the recognition sequence of the restriction enzyme applied in the digestion step is relevant.

[0112] "Control locus" and "internal reference locus" are interchangeable and are used herein to describe a locus whose digestion by the restriction enzymes applied in the digestion step is independent of the presence or absence of methylation. In some embodiments, the control locus is a locus that lacks a recognition sequence for at least one restriction enzyme applied in the digestion step, and the sequence of the control locus remains intact when the DNA sample is digested, regardless of its methylation status. Thus, the sequence of the control locus exhibits the same digestion and amplification pattern in normal DNA and disease DNA. Advantageously, the control locus is an internal locus, i.e., a locus within the DNA sample being analyzed, thereby eliminating the need for one or more external / additional control samples.

[0113] In some embodiments, the method of the present invention is included in amplifying at least one restriction locus and at least one control locus after digesting the DNA sample.As used herein, "at least one (restriction / control) locus" can encompass a single locus or more than one independent locus.

[0114] In some embodiments, the method comprises amplifying more than one restriction locus (ie, at least two restriction loci) and a single control locus.

[0115] As used herein, "amplification" refers to an increase in the number of copies of one or more specific nucleic acid targets of interest. As is known in the art, amplification is typically performed by polymerase chain reaction (PCR) in the presence of a PCR reaction mixture, which can include a suitable buffer supplemented with a DNA template, a polymerase (typically Taq polymerase), dNTPs, primers, and a probe (as appropriate).

[0116] As used herein, the term "polynucleotide" includes polymeric forms of nucleotides (deoxyribonucleotides or ribonucleotides or analogs thereof) of any length. The term "oligonucleotide" is also used herein to include polymeric forms of nucleotides generally up to 100 bases in length.

[0117] "Amplification product" generally refers to a nucleic acid molecule of a specific target sequence that is produced and accumulated in an amplification reaction. The term typically refers to a nucleic acid molecule produced by PCR using a given set of amplification primers.

[0118] As used herein, "primer" defines an oligonucleotide that can anneal (hybridize) to a target sequence, thereby producing a double-stranded region that can serve as a starting point for DNA synthesis under suitable conditions. The term "primer pair" refers herein to a pair of oligonucleotides selected for use together in amplifying a selected nucleic acid sequence by one of many types of amplification methods (preferably PCR). As is generally known in the art, primers can be designed to bind to complementary sequences under selected conditions.

[0119] In some embodiments, primers can be of any suitable length. In some embodiments, primers can comprise a length of at least 15 nucleotides, preferably a length between 19-25 nucleotides. Primers can be transformed to be suitable for the nucleic acid amplification system selected. As generally known in the art, the oligonucleotide primers (Sambrook etc., the same) can be designed by considering the melting point of the hybridization of the sequence of the oligonucleotide primer and its target.

[0120] In some embodiments, the restriction locus and control locus can be amplified from the same DNA sample (digested sample) using a pair of reverse primers and forward primers that are designed to specifically amplify each locus as known in the art. In some embodiments, primers can be designed to amplify the locus together with its 5' flanking sequence and 3' flanking sequence.

[0121] In some embodiments, the 5' flanking sequence can comprise a base between 1 and 60. In other embodiments, the 5' flanking sequence has a base between 10 and 50. For example, the 5' flanking sequence can comprise 10 bases, 15 bases, 20 bases, 25 bases, 30 bases, 35 bases, 40 bases, 45 bases, or 50 bases immediately upstream of the locus. Every possibility represents a separate embodiment of the present invention.

[0122] In some embodiments, the 3' flanking sequence can comprise a base between 1 and 60. In other embodiments, the 3' flanking sequence has a base between 10 and 50. For example, the 3' flanking sequence can comprise 10 bases, 15 bases, 20 bases, 25 bases, 30 bases, 35 bases, 40 bases, 45 bases, or 50 bases immediately downstream of the locus. Each possibility represents a separate embodiment of the present invention.

[0123] In some embodiments, the primers can be designed to generate an amplification product having a length between 60-150 bp. In some specific embodiments, the primers can be designed to generate an amplification product having a length between 70-140 bp.

[0124] In some embodiments, the method includes amplifying more than one target sequence (at least one restriction locus and a control locus) simultaneously in the same reaction mixture, which is a process referred to as multiplex amplification or co-amplification. This process requires the use of multiple primer pairs simultaneously. As known in the art, primers can be designed so that they can work at the same annealing temperature during amplification. In some embodiments, primers with similar melting temperatures (Tm) are used in the methods disclosed herein. For primers used in a pool, Tm changes between about 3°C ​​and 5°C are considered to be acceptable.

[0125] In some embodiments, all restriction loci and control loci can be amplified in a single reaction mixture. In other embodiments, for example, due to technical limitations of a particular machine, the digested DNA sample can be divided into several aliquots, each aliquot being supplemented with a primer pair for amplifying one or more restriction loci and control loci. Therefore, even if the DNA sample is divided into several aliquots, the control loci are amplified in each aliquot, and the signal ratios of the control loci and restriction loci amplified together (i.e., from the same aliquot) are calculated.

[0126] In some embodiments, amplification of genomic loci can be performed using real-time PCR (RT-PCR), also known as quantitative PCR (qPCR), where amplification and detection of amplification products are performed simultaneously.

[0127] In some embodiments, detection of amplification products in RT-PCR can be achieved using polynucleotide probes (typically fluorescently labeled polynucleotide probes).

[0128] As used herein, " polynucleotide probe " or " oligonucleotide probe " are interchangeable and refer to the polynucleotide of the labelling that is complementary to the specific subsequence in the nucleic acid sequence of the locus of interest (for example, in the sequence of restriction locus or control locus).In some embodiments, detection is based on the reporter and quencher molecule (Roche Molecular Systems Inc.) of combination and is measured by using TaqMan.In such mensuration, polynucleotide probe has the fluorescent moiety (fluorophore) attached to its 5 ' end and the quencher attached to 3 ' end.During PCR amplification, polynucleotide probe selectively hybridizes with its target sequence on template, and along with polymerase, template is copied, due to the 5 '-nuclease activity of polymerase, polymerase also cracks polynucleotide probe.When polynucleotide probe is complete, the close proximity between quencher and fluorescent moiety usually causes low-level background fluorescence.When polynucleotide probe is cracked, quencher and fluorescent moiety decoupling, causes the increase of fluorescence intensity.Fluorescent signal is relevant to the amount of amplified product, that is, signal increases along with amplified product accumulation.

[0129] As used herein, "selectively hybridizes to" (as well as "selectively hybridizes," "specifically hybridizes to," and "specifically hybridizes") refers to a nucleic acid molecule (such as a primer or probe) preferentially binding, duplexing, or hybridizing to a particular complementary nucleotide sequence under stringent conditions. The term "stringent conditions" refers to conditions under which a nucleic acid molecule will preferentially hybridize to its target sequence, and to other non-target sequences to a lesser extent or not at all. "Stringent hybridization" in the context of nucleic acid hybridization is sequence-dependent and will vary under different conditions, as is known in the art.

[0130] The length of polynucleotide probe can change.In some embodiments, polynucleotide probe can comprise the base between 15-30.In other embodiments, polynucleotide probe can comprise the base between 25-30.In some embodiments, polynucleotide probe can comprise the base between 20-30, for example 20 bases, 21 bases, 22 bases, 23 bases, 24 bases, 25 bases, 26 bases, 27 bases, 28 bases, 29 bases, 30 bases.Every kind of possibility represents a separate embodiment of the present invention.

[0131] Polynucleotide probes can be designed to bind to either strand of the template. Additional considerations include the Tm of the polynucleotide probe, which should preferably be compatible with the Tm of the primer. Primers and probes can be designed using computer software.

[0132] As described above, the methods disclosed herein can include simultaneously amplifying more than one target sequence (at least one restriction locus and one control locus) in the same reaction mixture. In order to distinguish more than one (multiple) target sequences amplified in parallel, polynucleotide probes labeled with different fluorescent colors can be used.

[0133] In some embodiments, the polynucleotide probes form fluorophore / quencher pairs as are known in the art and include, for example, FAM-TAMRA, FAM-BHQ1, Yakima Yellow-BHQ1, ATTO550-BHQ2, and ROX-BHQ2.

[0134] In some embodiments, the dye combination may be compatible with selected RT-PCR thermal cyclers.

[0135] In some embodiments, fluorescence can be monitored during each PCR cycle, providing an amplification curve that shows the change in fluorescent signal from the probe as a function of cycle number.

[0136] In the context of real-time PCR, the following terms are used:

[0137] "Quantitative cycle" ("Cq") refers to the number of cycles in which fluorescence increases above a threshold value, which is set automatically by the software or manually by the user. In some embodiments, the threshold value can be constant for all loci and can be set in advance before amplification and detection. In other embodiments, the threshold value for each locus can be defined after the run based on the maximum fluorescence level of each locus detected during the amplification cycles.

[0138] "Threshold" refers to the fluorescence value used for Cq determination. In some embodiments, the threshold can be a value above baseline fluorescence and / or above background noise and within the exponential growth phase of the amplification curve.

[0139] "Baseline" refers to the initial cycles of PCR where there is little to no change in fluorescence.

[0140] Computer software can be used to analyze amplification curves and determine baseline, threshold, and Cq.

[0141] In some embodiments, when a methylation-sensitive restriction enzyme is used, after digestion with the restriction enzyme, the gene locus in which the CG dinucleotide in the enzyme's recognition site is methylated is efficiently amplified because the DNA molecule is protected from digestion. The result is a relatively low Cq value because a detectable amplification product is displayed after a relatively small (low) number of amplification cycles. In contrast, a gene locus in which the CG dinucleotide in the enzyme's recognition site is unmethylated is more thoroughly cut during the digestion step and therefore results in a higher Cq value in the amplification and quantification step (i.e., a detectable amplification product is displayed after a relatively high number of amplification cycles).

[0142] In optional embodiments, the detection of amplification and amplified product can be carried out by conventional PCR using fluorescently labeled primers, followed by capillary electrophoresis of amplified product. In some embodiments, after amplification, amplified product is separated by capillary electrophoresis, and quantitative fluorescence signal. In some embodiments, an electrophoretogram can be generated that plots the fluorescence signal changes as a function of size (bp) or the time of injection, wherein each peak in the electrophoretogram corresponds to the amplified product of a single locus. Peak height (such as using " relative fluorescence unit ", rFU provides) can represent the intensity of the signal from the locus of amplification. Computer software can be used to detect peak, and calculates the fluorescence intensity (peak height) of a group of loci that its amplified product runs on capillary electrophoresis machine, and calculates the ratio between the signal intensity subsequently.

[0143] For DNA samples digested with a methylation-sensitive restriction enzyme, loci where the CG dinucleotide in the enzyme's recognition site is methylated produce relatively strong signals (higher peaks) in the electropherogram. Conversely, loci where the CG dinucleotide in the enzyme's recognition site is unmethylated produce relatively weak signals (lower peaks) in the electropherogram.

[0144] In some embodiments, the fluorescent label of the primer includes any one of the following: fluorescein, FAM, lissamine, phycoerythrin, rhodamine, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX, JOE, HEX, NED, VIC and ROX.

[0145] In another alternative embodiment, amplification and detection of amplification products can be performed using next generation sequencing (NGS) technology.

[0146] Next generation sequencing (NGS) refers to a deep, high-throughput, parallel DNA sequencing technology. NGS technology is different from the early Sanger sequencing method because NGS technology provides large-scale parallel analysis from more than one sample at a much lower cost, with extremely high throughput. Next generation sequencing generally includes three basic steps: library preparation by fragmenting DNA / RNA and adding adapter sequences (e.g., by ligation or PCR), sequencing, and data analysis. Illumina, Life Technologies, Roche, etc. currently use parallel synthesis sequencing or connection sequencing platforms (parallelized sequencing-by-synthesis or sequencing-by-ligation platforms). NGS methods may also include nanopore sequencing methods or methods based on electronic detection, such as the Ion Torrent technology commercialized by Life Technologies.

[0147] In order to perform methylation ratio analysis using NGS, in some embodiments, after digesting the DNA sample with at least one methylation-sensitive or methylation-dependent restriction enzyme, a sequencing library is prepared by enriching DNA fragments corresponding to at least one restriction locus and a control locus, and introducing NGS adapter sequences into these DNA fragments. "NGS adapter sequences" are oligonucleotides at the 5' end and 3' end of each DNA fragment in the sequencing library. Adapters typically include platform-specific sequences for fragment recognition by a specific sequencer: for example, sequences that enable library fragments to bind to the flow cell of an Illumina platform. For this purpose, each NGS instrument provider typically uses a specific set of sequences.

[0148] The NGS adapter sequence according to some embodiments also includes a sample index. A "sample index" is a sequence that enables more than one sample to be sequenced together (i.e., multiplexed) on the same instrument flow cell or chip. Each sample index (typically 6-10 bases) is specific to a given sample library and is used for de-multiplexing during data analysis to assign a single sequence read to the correct sample. Depending on the number of libraries being merged and the desired level of accuracy, the adapter can include a single sample index or a double sample index.

[0149] In some embodiments, the NGS adapter sequence is introduced using a 2-step PCR, wherein a first PCR is performed using primers containing a locus-specific sequence and an overhang sequence that introduces a first portion of the NGS adapter sequence, and a second PCR is performed using primers that introduce a second portion of the NGS adapter sequence and an optional sample index.

[0150] The locus-specific primers include a primer specific for each of the at least one restriction locus and a primer specific for a control locus.

[0151] The amplified product of the second PCR is purified, and then the resulting library is sequenced using an NGS machine (e.g., using an Illumina machine) to generate sequence reads corresponding to the restriction locus and the control locus. The number of reads for each locus (also referred to herein as "copy number") represents the signal intensity of the locus.

[0152] In some embodiments, when a methylation-sensitive restriction enzyme is used, loci where the CG dinucleotide is methylated in the enzyme's recognition site are protected from cleavage, and as a result, the copy number of these loci is relatively high. In contrast, loci where the CG dinucleotide is unmethylated in the enzyme's recognition site are more extensively cleaved during the digestion step and therefore result in a lower copy number.

[0153] Computer software can be used to analyze sequence reads, assign them to target loci, and quantify the number of reads (copy number).

[0154] In some embodiments, a method for detecting methylation changes in a DNA sample is provided, the method comprising the steps of:

[0155] (a) digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease to obtain restriction endonuclease-treated DNA;

[0156] (b) generating an NGS sequencing library from the restriction endonuclease-treated DNA, the library comprising DNA fragments corresponding to at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus;

[0157] (c) performing next generation sequencing on the NGS sequencing library and determining the copy number of each of the at least one restriction locus and the control locus; and

[0158] (d) comparing the ratio between the copy numbers of each of the at least one restriction locus and the control locus to at least one reference ratio,

[0159] This allows detection of methylation changes in DNA samples.

[0160] In some embodiments, a method for sensitively detecting methylation changes in a DNA sample is provided, the method comprising:

[0161] (a) providing a DNA sample substantially lacking single-stranded DNA (ssDNA); and

[0162] (b) performing a methylation ratio analysis on the DNA sample by digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, generating an NGS sequencing library from the digested DNA, the library comprising DNA fragments corresponding to at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus, and comparing the ratio between the copy number of each of the at least one restriction locus and the control locus to at least one reference ratio,

[0163] This allows for detection of methylation changes in DNA samples with a sensitivity of at least 1:100.

[0164] In some embodiments, an NGS sequencing library is generated by: (i) co-amplifying at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus from digested DNA using locus-specific primers in a single reaction mixture, wherein the locus-specific primers contain a 5' overhang sequence that introduces a first portion of the NGS adapter sequence; (ii) purifying the amplification product; and (iii) performing a second PCR that introduces NGS adapters (e.g., Illumina adapters) and optionally a sample index.

[0165] In some embodiments, the DNA is not purified between the digestion and amplification steps.

[0166] In some embodiments, the NGS-based assays disclosed herein combine detection of methylation changes with detection of mutations, all in a single assay. The assays advantageously allow combined analysis of small amounts of DNA in a single assay.

[0167] For combined methylation and mutation analysis, in some embodiments, after digesting a DNA sample with at least one methylation-sensitive or methylation-dependent restriction enzyme, a polynucleotide library is prepared by enriching DNA fragments corresponding to at least one restriction locus, a control locus, and one or more loci for which mutation analysis is desired, and introducing NGS adapter sequences into these DNA fragments using two-step PCR as described above.

[0168] The locus-specific primers include a primer specific for at least one restriction locus, a primer specific for a control locus, and a primer specific for at least one locus of interest for which mutation analysis is desired.

[0169] The amplified product of the second PCR is purified, and the resulting library is then sequenced using an NGS machine (e.g., using an Illumina machine) to generate sequence reads corresponding to at least one restriction locus, a control locus, and at least one locus of interest for which mutation analysis is desired. Computer software can be used to detect sequence reads comprising one or more mutations in the locus of interest.

[0170] Signal ratio

[0171] As used herein, the term "ratio" or "signal ratio" refers to the ratio between the intensities of the signals obtained from the co-amplification of a pair of genomic loci (particularly the co-amplification of a restriction locus and a control locus) in a single DNA sample (in the same reaction mixture).

[0172] As used herein, the term "signal intensity" refers to a measure of the amount of the locus-specific amplified product reflecting the initial amount of a copy corresponding to a complete locus. However, signal intensity may not indicate the actual amount of amplified product / complete locus, and may not relate to the calculation of any absolute amount of amplified product / complete locus. Therefore, in order to calculate the ratio of the amplicon signal, a standard curve or reference DNA may not be needed because actual DNA concentration or DNA methylation level itself do not need to be calculated.

[0173] In some exemplary embodiments, amplification and detection of amplification products are performed by RT-PCR, wherein the signal intensity of a particular locus can be represented by the calculated Cq for that locus. The signal ratio in this case can be represented by the following calculation: (对照基因座的Cq-限制性基因座的Cq) .

[0174] In other exemplary embodiments, the detection of amplified products is carried out by capillary electrophoresis, and the signal intensity of the specific locus is the relative fluorescence unit (rfu) number of its corresponding peak. The signal ratio can be calculated by dividing the peak height of each restriction locus by the peak height of the control locus.

[0175] In another exemplary embodiment, amplification and detection of amplification products are performed using next generation sequencing (NGS), wherein the signal intensity of a particular locus can be represented by the number of reads (copy number) of the locus calculated. The signal ratio in this case can be represented by the following calculation:

[0176] Number of reads at the restriction locus / number of reads at the control locus

[0177] In some embodiments, calculating the ratio between the signal intensities of amplified products of a restriction locus and a control locus in a DNA sample comprises: (i) determining the signal intensity of the amplified product of the restriction locus; (ii) determining the signal intensity of the amplified product of the control locus; and (iii) calculating the ratio between the two signal intensities.

[0178] In some embodiments, calculating the ratio between the signal intensities of the amplified products of the restriction loci and the control loci in the DNA sample comprises determining the Cq for each locus and calculating the difference between the Cq of the control locus and the Cq of the restriction locus. In some embodiments, the calculation further comprises applying the following formula: 2^(Cq of the control locus - Cq of the restriction locus).

[0179] In another embodiment, calculating the ratio between the signal intensities of amplified products of a restriction locus and a control locus in a DNA sample includes determining the number of reads (copy number) for each locus, and calculating the ratio between the copy number of reads of the restriction locus and the number of reads of the control locus.

[0180] In some embodiments, calculating a signal ratio can be calculating more than one signal ratio between each restriction locus and a control locus.

[0181] In some embodiments, computer software can be used to calculate the ratio between the signal intensities of amplification products.

[0182] Reference ratio

[0183] The terms "reference ratio" or "reference signal ratio" are used interchangeably and refer to the ratio of signal intensities determined in DNA from a known source. The reference ratio for a given pair of restriction loci and a control locus can be expressed in a variety of ways. In some embodiments, the reference ratio for a given pair of loci can be a single ratio. In some embodiments, the reference ratio for a given pair of loci can be a statistical value obtained from a large set of DNA samples from a known source, such as the average value of a large set of reference ratios, for example, the average value determined in a large group of cancer patients or the average value determined in a large group of healthy individuals.

[0184] In other embodiments, the reference ratio for a given pair of loci can be more than one ratio, such as a distribution of ratios for the pair of loci determined in a large set of DNA samples from a known source. In some embodiments, the reference ratio can be a reference scale.

[0185] In some embodiments, the reference scale of a given pair of loci can include the signal ratio of the pair of loci measured in more than one DNA sample from the same reference source.For example, with reference to the reference scale of cancer patients or with reference to the reference scale of healthy individuals.In other embodiments, the reference scale of a given pair of loci can include the signal ratio from healthy individuals and sick individuals, the single scale that the reference ratio from two sources is combined into one.Usually, when using a single scale, value is distributed so that the value from healthy individuals is at one end of the scale, for example, lower than a cutoff value (cutoff), and the value from the patient is at the other end of the scale, for example, higher than a cutoff value.In some embodiments, the signal ratio of the DNA sample tested from unknown source calculated can be compared with the reference scale of healthy reference ratio and / or disease reference ratio, and scoring can be assigned to the signal ratio of the calculation based on the relative position of the signal ratio calculated in the scale.In some embodiments, the signal ratio calculated is higher, and the scoring assigned to it is higher.

[0186] The terms "disease reference ratio" (e.g., "cancer reference ratio") or "reference ratio in disease DNA" (e.g., "reference ratio in cancer DNA") interchangeably refer to the ratio of signal intensities between a given restriction locus and a given control locus measured in DNA from a sample (e.g., a plasma sample) of a subject suffering from the disease being analyzed, e.g., a subject suffering from a certain type of cancer. The disease reference ratio represents the ratio of signal intensities in disease DNA, i.e., the ratio of signal intensities in DNA from a sample of a subject suffering from the disease. The disease reference ratio can be a single ratio, a statistical value, or more than one ratio (e.g., a distribution), as described in detail above.

[0187] The terms "healthy reference ratio," "normal reference ratio," or "reference ratio in healthy DNA / normal DNA" refer interchangeably to the ratio of signal intensities between a given restriction locus and a given control locus measured in a sample (e.g., a plasma sample) from a normal individual. "Normal" or "healthy" is defined with respect to the specific disease for which it is analyzed. Herein, a "healthy" or "normal" individual is defined as an individual who has no symptoms and / or pathological findings of a detectable disease as determined by conventional diagnostic methods. The healthy reference ratio represents the ratio of signal intensities in normal DNA, i.e., the ratio of signal intensities in DNA from a sample of a healthy individual. The healthy reference ratio can be a single ratio, a statistical value, or more than one ratio (e.g., a distribution), as described in detail above.

[0188] In some embodiments, the methods disclosed herein comprise predetermining a reference ratio from disease DNA. In some embodiments, the methods of the present invention comprise predetermining a reference ratio from normal DNA.

[0189] As described above, the signal ratio can be determined by various methods, including, for example, measuring peaks after capillary electrophoresis, calculating Cq values ​​after RT-PCR, or calculating copy numbers after NGS. It is understood that the reference ratio is obtained using the methods disclosed herein, as well as the ratio of the test sample of unknown origin measured to determine the presence of a disease.

[0190] Disease diagnosis

[0191] In some embodiments, methods of detecting methylation changes according to the present invention comprise identifying the presence of a disease in a subject based on evaluating a calculated signal ratio of DNA from a biological sample of the subject compared to a reference ratio.

[0192] In some embodiments, a method for identifying the cell or tissue origin of a DNA sample is provided (eg, identifying whether the DNA is derived from normal cells or diseased cells / tissues).

[0193] Those skilled in the art will appreciate that the comparison of the calculated signal ratio of a test sample to the corresponding reference signal ratio can be performed in a variety of ways using various statistical methods.

[0194] In some embodiments, comparing the calculated test signal ratio of a given pair of loci with the reference signal ratio comprises comparing the test signal ratio with a single reference value. The single reference value can correspond to the average value of the reference signal ratios obtained from a large population of healthy subjects or subjects suffering from the disease being analyzed. In other embodiments, comparing the calculated test signal ratio of a given pair of loci with the reference signal ratio comprises comparing the test signal ratio with a distribution or scale of more than one reference signal ratio.

[0195] Known statistical methods can be used to determine whether the calculated signal ratio between a given restriction locus and a control locus corresponds to a disease reference ratio or a normal reference ratio. In some embodiments, detecting that the calculated ratio is close to the disease reference ratio identifies the subject as having the disease. In contrast, in some embodiments, detecting that the calculated ratio is close to the normal reference ratio identifies the subject as not having the disease.

[0196] In some embodiments, disease diagnosis according to the present invention is based on whether the signal ratio of the DNA sample tested by analysis is a disease ratio, i.e., indicates the disease in question. In some embodiments, method includes comparing the signal ratio calculated with its corresponding health reference ratio (that is, with the signal ratio determined to the same pair of loci in healthy subjects), to obtain the scoring (probability score) that the signal ratio reflecting calculated is the possibility of the disease ratio. In some embodiments, method includes comparing the signal ratio calculated with its corresponding disease reference ratio (that is, with the signal ratio determined to the same pair of loci in the subject suffering from the disease in question), to obtain the scoring that the signal ratio reflecting calculated is the possibility of the disease ratio. The closer the signal ratio calculated is to the disease reference ratio, the higher the scoring (probability score) and the signal ratio calculated accordingly are that the possibility of the disease ratio is higher. In some embodiments, probability score is based on the relative position of the signal ratio calculated in the distribution of the disease reference ratio.

[0197] In some embodiments, the method comprises comparing more than one calculated signal ratio for more than one restriction locus relative to a control locus to its corresponding healthy and / or disease reference ratio.

[0198] In some embodiments, the pattern of signal ratios can be analyzed using statistical methods and computerized algorithms to determine whether it represents a pattern of the disease in question or a normal healthy pattern. For example, an exemplary algorithm is disclosed in WO 2011 / 070441, assigned to the applicant of the present invention. The algorithm can include, but is not limited to, machine learning and pattern recognition algorithms.

[0199] In some exemplary embodiments, the ratio of each calculation (for every pair of restriction locus and control locus) can be compared with the scale of the reference ratio generated from the individuality of cancer patients, not suffering from cancer, or the large plasma sample group of both.The scale can represent the signal ratio between the restriction locus and the control locus calculated in a large number of samples from cancer patients and / or normal individuals.The scale can present a threshold value (hereinafter also referred to as 'cutoff value' or 'predefined threshold value'), which is higher than the threshold value for the reference ratio corresponding to cancer, and lower than the threshold value for the reference ratio corresponding to healthy individuals, or reversed.

[0200] In some embodiments, the ratio of the lower ratio of the scale bottom and / or lower than the cut-off value can be from the sample of normal individual (health, i.e. not suffering from the cancer in question), and the ratio of the higher ratio of the scale top and / or higher than the predetermined cut-off value can be from cancer patients. For each ratio (ratio between each restriction locus and the control locus), scoring can be provided based on its relative position in the scale, and (each locus) individual scoring is merged to provide a single scoring. In some embodiments, individual scoring can be summed to provide a single scoring. In other embodiments, individual scoring can be averaged to provide a single scoring. In some embodiments, a single scoring can be used to determine whether the experimenter suffers from the cancer in question, wherein the scoring indication cancer is higher than the threshold value defined in advance.

[0201] In some embodiments, the score is a number between 0 and 100 that reflects the probability that the calculated signal ratio is a cancer ratio, where 0 is the lowest probability and 100 is the highest probability. In some embodiments, a threshold score is determined, where a score equal to or above the threshold score is indicative of cancer. The threshold can be, for example, 60, 70, or 80. Each possibility represents a separate embodiment of the present invention.

[0202] In another exemplary embodiment, for each calculated ratio (ratio between each restriction locus and control locus), the probability that it represents cancer DNA can be determined based on a comparison with a corresponding cancer reference ratio and / or a normal reference ratio, and a score (probability score) can be specified. Therefore, the individual probability scores of each ratio (for each locus) calculated are merged (e.g., summed or averaged) to give a merged score. The merged score can be used to determine whether the subject suffers from cancer, wherein a merged score that is higher than a predefined threshold value indicates cancer.

[0203] Thus, in some embodiments, a threshold or cutoff value is determined, above (or below) which a subject is identified as having the disease in question, e.g., the type of cancer in question. The threshold score distinguishes a population of healthy subjects from a population of unhealthy subjects.

[0204] In some embodiments, the methods of the invention comprise providing a threshold score.

[0205] In some embodiments, determining a threshold score comprises measuring signal ratios in a large population of subjects who are healthy or have the disease in question.

[0206] In some embodiments, the threshold value is a statistically significant value. Statistical significance is usually determined by comparing two or more colonies, and determining a confidence interval (CI) and / or p value. In some embodiments, the statistically significant value refers to a confidence interval (CI) of about 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, while preferred p values ​​are less than about 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001 or less than 0.0001. Every possibility represents a separate embodiment of the present invention. According to some embodiments, the p value of the threshold score is at most 0.05.

[0207] As used herein, the term "about" when referring to a measurable value is meant to include variations of + / - 10%, more preferably + / - 5%, even more preferably + / - 1%, and still more preferably + / - 0.1% from the specified value.

[0208] In some embodiments, the method further comprises comparing the calculated signal ratio between a given restriction locus and a control locus to its corresponding normal / healthy reference ratio to obtain a probability score, wherein detecting a low probability score for the ratio relative to the corresponding healthy reference ratio indicates that the subject has the disease being analyzed.

[0209] In some embodiments, the diagnostic sensitivity of the method disclosed herein can be at least about 75%. In some embodiments, the diagnostic sensitivity of the method can be at least about 80%. In some embodiments, the diagnostic sensitivity of the method can be at least about 85%. In some embodiments, the diagnostic sensitivity of the method can be at least about 90%.

[0210] In some embodiments, the "diagnostic sensitivity" of a diagnostic assay as used herein refers to the percentage of diseased individuals that test positive (the percentage of "true positives"). Accordingly, diseased individuals that are not detected by the assay are "false negatives." Subjects who do not have the disease and test negative in the assay are referred to as "true negatives." The "specificity" of a diagnostic assay is one (1) minus the false positive rate, where the "false positive" rate is defined as the proportion of those subjects who do not have the disease that test positive. Although a particular diagnostic method may not provide a definitive diagnosis of a condition, it qualifies if the method provides a positive indication that contributes to the diagnosis.

[0211] In some embodiments, the diagnostic specificity of the method disclosed herein can be at least about 65%. In some embodiments, the diagnostic specificity of the method can be at least about 70%. In some embodiments, the diagnostic specificity of the method can be at least about 75%. In some embodiments, the diagnostic specificity of the method can be at least about 80%.

[0212] Definitive diagnosis

[0213] In some embodiments, after the disease in question is identified according to the methods of the present invention, the subject can undergo a definitive diagnosis of the disease. For example, a definitive diagnosis can be made by biopsy.

[0214] treat

[0215] In some embodiments, after identifying the disease in question according to the methods of the invention, the subject may receive a suitable treatment for the disease. Thus, in some embodiments, a method of treatment is provided comprising identifying a disease in a human subject according to the methods of the invention and administering a suitable treatment to the subject.

[0216] Systems and kits

[0217] In some embodiments, provided herein are systems for detecting methylation changes in a DNA sample. In some embodiments, provided herein are kits for detecting methylation changes in a DNA sample.

[0218] In some embodiments, systems and kits are used to detect methylation changes in a DNA sample according to the methods of the present invention.

[0219] In some embodiments, a system according to the present invention comprises: (a) a DNA sample, wherein the DNA sample is substantially devoid of ssDNA (e.g., contains less than 5% single-stranded DNA (ssDNA), such as less than 1% ssDNA); and (b) components for performing a methylation ratio analysis.

[0220] As used herein, "components" for performing a methylation ratio analysis encompass biochemical components (e.g., enzymes, primers, nucleotides), chemical components (e.g., buffers, probes), and technical components (e.g., PCR systems, equipment such as tubes, vials, plates, pipettes, and also computer software stored on computer-readable media, computer processors, etc.).

[0221] In some embodiments, components for performing a methylation ratio analysis include: (i) at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease for digesting a DNA sample; (ii) more than one primer pair for co-amplifying more than one genomic loci from the DNA sample after digestion, wherein the more than one genomic loci include at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus; and (iii) computer software stored on a non-transitory computer-readable medium that directs a computer processor to determine methylation changes in the DNA sample based on a comparison of the ratio of signal intensities of the amplified restriction loci and the control loci to a reference ratio.

[0222] In some embodiments, components for performing methylation ratio analysis include a machine for performing the amplification and detection steps, such as a PCR machine (e.g., a real-time PCR machine) and / or an NGS machine.

[0223] In some embodiments, components for performing a methylation ratio analysis include more than one polynucleotide probe for detecting amplification products of at least one restriction locus and at least one control locus.

[0224] In some embodiments, the system includes a processor configured to perform the following: determining a methylation change in a DNA sample based on a comparison of a ratio of signal intensities of a restriction locus after amplification and a control locus with a reference ratio. In some embodiments, the processor is coupled to a memory storing more than one reference ratio.

[0225] In some embodiments, a system according to the present invention comprises: (a) at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease for digesting a DNA sample, wherein the DNA sample is substantially devoid of ssDNA (e.g., contains less than 5% single-stranded DNA (ssDNA)); (b) more than one primer pair for co-amplifying more than one genomic locus from the DNA sample after digestion with the restriction endonuclease of (a), wherein the more than one genomic locus comprises at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus; and (c) computer software stored on a non-transitory computer-readable medium that directs a computer processor to determine a methylation change in the DNA sample based on a comparison of a ratio of signal intensities of the amplified restriction loci and the control locus to a reference ratio, wherein the methylation change is determined with a detection sensitivity of at least 1:100.

[0226] In some embodiments, a kit or system according to the present invention comprises a DNA extraction reagent for extracting DNA from a biological sample such that the extracted DNA is substantially devoid of ssDNA, eg, contains less than 5% ssDNA, such as less than 1% ssDNA.

[0227] In some embodiments, a kit or system according to the present invention comprises, in addition to one or more restriction enzymes, components required for DNA digestion, such as one or more buffers.

[0228] In some embodiments, a kit or system according to the present invention comprises, in addition to primers, components required for amplifying a locus, such as a DNA polymerase, a nucleotide mix, and one or more buffers.

[0229] In some embodiments, kits or systems according to the present invention comprise components necessary for detecting amplification products, such as polynucleotide probes, eg, fluorescently labeled polynucleotide probes.

[0230] In some embodiments, a kit or system according to the present invention includes instructions for detecting methylation changes using computer software stored on a non-transitory computer-readable medium, the computer software directing a computer processor to perform the following steps: determining the signal intensity of at least one restriction locus and a control locus after amplification of at least one restriction locus and a control locus; calculating a signal ratio between the signal intensity of each of the at least one restriction locus and the control locus; comparing the calculated signal ratio with at least one reference ratio; and based on the comparison, outputting whether the DNA sample is a normal DNA sample or a DNA sample derived from a diseased cell, such as a tumor cell.

[0231] In some embodiments, the kit or system further comprises a non-transitory computer-readable medium storing computer software that directs a computer processor to perform the following steps: determining the signal intensity of at least one restriction locus and the control locus after amplification of the at least one restriction locus and the control locus; calculating a signal ratio between the signal intensity of each of the at least one restriction locus and the control locus; comparing the calculated signal ratio to at least one reference ratio; and based on the comparison, outputting whether the DNA sample is a normal DNA sample or a DNA sample derived from a diseased cell, such as a tumor cell.

[0232] In some embodiments, computer software according to the present invention receives as input parameters or raw data of a real-time PCR run.In some embodiments, the computer software directs a computer processor to analyze the real-time PCR run to determine signal intensity and signal ratio.

[0233] In some embodiments, computer software according to the present invention receives sequence reads from an NGS run as input. In some embodiments, the computer software directs a computer processor to analyze the NGS run to determine signal intensity and signal ratio.

[0234] Computer software includes processor-executable instructions stored on a non-transitory computer-readable medium. Computer software may also include stored data. A computer-readable medium is a tangible computer-readable medium such as a compact disc (CD), magnetic storage, optical storage, random access memory (RAM), read-only memory (ROM), or any other tangible medium.

[0235] It will be understood that the computer-related methods, steps, and processes described herein are implemented using software stored on non-volatile or non-transitory computer-readable instructions that, when executed, configure or direct a computer processor or computer to perform the instructions.

[0236] Each of the systems, servers, computing devices, and computers described herein can be implemented on one or more computer systems and configured to communicate over a network. They can also all be implemented on a single computer system. In one embodiment, the computer system includes a bus or other communication mechanism for communicating information, and a hardware processor coupled to the bus for processing the information.

[0237] The computer system also includes a main memory, such as a random access memory (RAM) or other dynamic storage device, coupled to the bus for storing information and instructions to be executed by the processor. The main memory may also be used to store temporary variables or other intermediate information during the execution of instructions by the processor. When such instructions are stored in a non-transitory storage medium accessible to the processor, the computer system appears as a special-purpose machine that is customized to perform the operations specified in the instructions.

[0238] The computer system also includes a read-only memory (ROM) or other static storage device coupled to the bus for storing static information and processor instructions. A storage device such as a magnetic disk or optical disk is provided and coupled to the bus for storing information and instructions.

[0239] The computer system may be coupled via a bus to a display for presenting information to a computer user.

[0240] An input device, including alphanumeric and other keys, is coupled to the bus for communicating information and command selections to the processor. Another type of user input device is a cursor control, such as a mouse, trackball, or cursor direction keys, for communicating directional information and command selections to the processor and for controlling cursor movement on a display.

[0241] According to one embodiment, the techniques herein are performed by a computer system in response to a processor executing one or more sequences of one or more instructions contained in main memory. Such instructions may be read into main memory from another storage medium (such as a storage device). Execution of the sequence of instructions contained in main memory causes the processor to perform the processing steps described herein. In alternative embodiments, hard-wired circuitry may be used in place of or in combination with software instructions.

[0242] The term storage media as used herein refers to any non-transitory medium that stores data and / or instructions that cause a machine to operate in a specific manner. Common forms of storage media include, for example, a floppy disk, a diskette, a hard disk, a solid-state drive, magnetic tape or any other magnetic data storage medium, a CD-ROM, any other optical data storage medium, any physical medium with a pattern of holes, RAM, PROM and EPROM, FLASH-EPROM, NVRAM, any other memory chip or cartridge.

[0243] Storage media is distinct from, but can be used in conjunction with, transmission media. Transmission media are involved in the transfer of information between storage media. Examples of transmission media include coaxial cables, copper wires, and optical fibers, including the wires that make up a bus.

[0244] The following examples are presented to more fully illustrate certain embodiments of the present invention. However, they should not be interpreted as limiting the broad scope of the present invention in any way. Those skilled in the art can easily envision many variations and modifications of the principles disclosed herein without departing from the scope of the present invention. Example

[0245] Example 1 - Effect of single-stranded DNA on digestion efficiency

[0246] According to the present invention, detection of methylation changes is based on methylation-sensitive or methylation-dependent enzymatic digestion of DNA, followed by amplification of the target locus and analysis of the amplification signal. The following experiment tested the change in digestion efficiency when different amounts of single-stranded DNA were added to double-stranded DNA samples. Using real-time PCR, the effect of various amounts of single-stranded DNA on the ΔCq between the test locus and the control locus was used to evaluate digestion efficacy. Digestion efficacy reflects the ability of the assay to accurately detect methylation changes.

[0247] Experimental procedures

[0248] Double-stranded DNA from the A-673 cell line was spiked with increasing percentages of synthetic single-stranded DNA oligonucleotides corresponding to the following lung cancer-associated genomic loci:

[0249]

[0250] This lung cancer test locus was previously disclosed in WO2019 / 142193, assigned to the applicant of the present invention. The lung cancer test locus contains a recognition sequence for the methylation-sensitive restriction enzyme HhaI. DNA from the A-673 cell line is unmethylated at the test locus, and therefore DNA from this cell line is expected to be extensively cut by HhaI at the test locus.

[0251] Methylation-sensitive enzymatic digestion was performed on the spiked samples, as well as pure single-stranded DNA samples ("100% single-stranded DNA") and DNA samples from A-673 cells that were not spiked with ssDNA ("100% double-stranded DNA"). Enzymatic digestion was performed at 37°C for 2 hours, followed by heat inactivation of the enzyme at 65°C for 20 minutes.

[0252] Next, real-time PCR was performed on the digested samples to amplify in each sample the test loci detailed above and the control loci as shown below:

[0253]

[0254] A control locus is a locus that does not contain the recognition sequence for Hhal and remains intact when a DNA sample is digested with Hhal, regardless of its methylation status.

[0255] After digestion, each digested sample was supplemented with a primer pair for amplifying the test locus and the control locus. Each amplification reaction (total volume 25 microliters) also contained dNTPs, DNA polymerase, and reaction buffer. In order to detect the amplified product during amplification, a fluorescently labeled polynucleotide probe (one polynucleotide probe per locus) was added to the reaction. Real-time PCR was performed in an ABI7500FastDx instrument according to the following PCR program: 95°C, 10 minutes -> 45X (95°C, 15 seconds) -> 60°C, 1 minute.

[0256] After amplification, data on the level of fluorescent signal from the probes as a function of cycle number are analyzed to calculate the quantification cycle (Cq) and ΔCq, the difference between the Cq of the test locus and the Cq of the control locus, for each locus.

[0257] result

[0258] The results are summarized in Table 1 and Figure 1The ΔCq between the test and control loci in the 100% ssDNA sample was 7.51 cycles, while no test locus amplification was visible in the 100% dsDNA sample, corresponding to a ΔCq between the test and control loci of >18 cycles. As the percentage of ssDNA in the sample decreased, the ΔCq between the test and control loci increased.

[0259] When less ssDNA is present, an increase in ΔCq reflects more efficient digestion of the test locus. When less ssDNA is present, more DNA is digested, resulting in an increase in the Cq of the test locus compared to the Cq of the control locus (an increase in the number of cycles in the assay at which a detectable amplification product appears for the test locus compared to the number of cycles at which a detectable amplification product appears for the control locus).

[0260] Table 1 - ΔCQ test loci versus control loci

[0261]

[0262] This experiment demonstrates that the presence of single-stranded DNA in the sample impairs digestion efficiency. Digestion efficiency reflects the assay's ability to accurately detect methylation changes. This effect is proportional to the amount of single-stranded DNA in the sample—the effect can be observed starting at 6.25% single-stranded DNA in the sample.

[0263] Example 2 - Detecting methylation changes at genomic loci associated with lung cancer

[0264] The following experiment tested the effect of the presence of ssDNA in a DNA sample on the ability to detect methylation changes at a genomic locus associated with lung cancer by methylation ratio analysis as described herein. The lung cancer-associated restriction loci previously disclosed in WO 2019 / 142193, assigned to the applicant of the present invention, include the sequences listed below as SEQ ID NOs: 1-6.

[0265] Table 2 - Restriction loci

[0266]

[0267] Plasma samples were obtained from subjects without lung cancer. The DNA in plasma samples from subjects without lung cancer was mostly unmethylated at the six restriction loci mentioned above. DNA was extracted from plasma samples using the QIAGEN® Circulating Nucleic Acids Kit (QIAGEN, Hilden, Germany). The extraction procedure was performed at or below 60°C using non-denaturing reagents.

[0268] The extracted DNA was divided into aliquots, and each aliquot was spiked with different percentages of synthetic single-stranded DNA oligonucleotides corresponding to each of the above restriction loci, as follows: "0 ssDNA" (no ssDNA), 0.1%, 1%, 10% ssDNA. Each aliquot was then analyzed for methylation ratios as follows:

[0269] Each aliquot was digested with the methylation-sensitive restriction endonuclease HhaI. The digestion reaction (total volume 100 μl) included 80 μl of extracted DNA (not quantified) and HhaI in digestion buffer. Digestion was performed at 37°C for 2 hours.

[0270] Next, the digested aliquots were subjected to real-time PCR to amplify the six restriction loci detailed above and the control locus listed below in SEQ ID NO: 7 in each aliquot.

[0271]

[0272] A control locus is a locus that does not contain the recognition sequence for Hhal and remains intact when a DNA sample is digested with a restriction enzyme, regardless of its methylation status.

[0273] After digestion, each digested aliquot was divided into three (3) sub-aliquots containing 12 microliters. Each sub-aliquot was supplemented with a primer pair for amplifying two of the six restriction loci and a control locus (the control locus was amplified in each sub-aliquot). Amplicons between 77 and 139 bases were amplified. Each amplification reaction (total volume 30 microliters) also contained dNTPs and reaction buffer. In order to detect the amplified products during amplification, fluorescently labeled polynucleotide probes (one polynucleotide probe for each locus) were added to the reaction. The following fluorescent labels were used: FAM, JOE, ROX. Real-time PCR was performed in an ABI 7500FastDx instrument with the following PCR program: 95°C, 10 minutes -> 45X (95°C, 15 seconds) -> 60°C, 1 minute.

[0274] After amplification, data on the level of fluorescent signal from the probes as a function of cycle number are analyzed to calculate the quantification cycle (Cq) for each locus and the ΔCq (the difference between the Cq of the restriction locus and the Cq of the control locus) for each restriction locus.

[0275] For each sample, the ratio between the signal intensity of each restriction locus 1-6 (SEQ ID NO: 1-6) and the signal intensity of the control locus (SEQ ID NO: 7) was calculated as follows: Cq was determined for each restriction locus and the control locus. The Cq value was used in the following formula:

[0276] 2 (对照基因座的Cq-限制性基因座的Cq) .

[0277] The value obtained for each restriction locus relative to the control locus represents the signal ratio (reflecting the methylation ratio) between the restriction locus and the control locus. In total, 6 signal ratios were calculated for each sample.

[0278] Next, a score was calculated for each locus in each sample, which normalizes the signal ratios with respect to a reference ratio so that the highest signal ratio is scored as "100" and the lowest signal ratio is scored as "0." The six scores obtained for each sample were combined into a single score called the "EpiScore," a number between 0 and 100 that reflects the overall relative methylation level of the sample at a panel of six restricted loci. A sample was classified as "lung cancer" if its EpiScore was greater than or equal to 70 (a threshold determined based on information from a previous sample set), and as "healthy" if its EpiScore was less than 70.

[0279] The calculated EpiScore for the "0ssDNA" sample represents the score of the original DNA sample after extraction. Because this sample is mostly unmethylated at the aforementioned restriction loci, its EpiScore is very low. The calculated EpiScore for the "0ssDNA" sample is compared to the calculated EpiScore for the sample spiked with single-stranded DNA to demonstrate the impact of having ssDNA in the DNA sample on the accuracy of the EpiScore, and accordingly, on the ability of the assay to correctly distinguish between healthy and diseased DNA (in this case, lung cancer DNA).

[0280] Example 3 - Analytical Sensitivity

[0281] The analytical sensitivity of the assay was tested on a mixture of methylated and unmethylated DNA species.

[0282] Materials and Methods

[0283] Unmethylated DNA

[0284] Unmethylated DNA contains two DNA fragments (test locus and internal reference, i.e., control locus), each of which is amplified by PCR from DNA of the human cell line HCT-15 and cloned separately into pGEM-T Easy vector (Promega). Plasmid DNA is extracted using the QIAGEN plasmid mini kit to obtain a DNA sample that is essentially free of single-stranded DNA (ssDNA) and quantified using NanoDrop. Purified plasmid DNA is sequenced to verify the sequence of the insert. Equimolar amounts of the two plasmid species are combined to generate the unmethylated DNA sample used in the experiment.

[0285] Methylated DNA

[0286] Methylated DNA was composed of DNA extracted from the HCT-15 cell line. Cells were purchased from Sigma-Aldrich and maintained in culture for 38 generations before harvest. DNA was extracted using the Wizard genomic DNA purification kit (Promega) to obtain a DNA sample substantially free of ssDNA. The extracted DNA was quantified using NanoDrop.

[0287] Bisulfite sequencing

[0288] Using EpiTect bisulfite test kit (QIAGEN), methylated and unmethylated DNA samples were treated with sodium bisulfite. After bisulfite conversion, the test locus was amplified from both DNA species. The PCR products were then purified and sequenced using QIAquick PCR purification kit (QIAGEN).

[0289] A mixture of methylated and unmethylated DNA

[0290] A mixture is constructed by adding appropriate amounts of methylated and unmethylated DNA to produce the desired molar ratio.

[0291] DNA digestion

[0292] 80 μl of each DNA sample was digested in a total volume of 100 μl with 5 μl HinP1I (New England Biolabs), 10 μl CutSmart buffer (New England Biolabs) and 5 μl DDW. Digestion was performed at 37°C for 2 hours and then heat inactivated at 65°C for 20 minutes.

[0293] Real-time PCR

[0294] Each PCR well contained a total of 30 μl, with 0.6 μl AmpliTaq Gold (Thermo Fisher), 3 μl buffer I (Thermo Fisher), 0.6 μl 10 mM dNTP mix (Sigma-Aldrich), 0.2 μM of each primer (test locus forward, test locus reverse, internal reference forward, internal reference reverse), 0.4 μM test probe, 0.2 μM internal reference probe and 12 μl digested DNA sample. PCR was performed in a 7500 Fast Dx real-time PCR instrument (Thermo Fisher) with the following PCR program: 10 minutes at 95°C, followed by 45 cycles of 15 seconds at 95°C and 1 minute at 60°C.

[0295] Signal Analysis

[0296] Fluorescence data in the sds file output by the real-time PCR instrument is analyzed by dedicated software. For each locus, the Cq (quantification cycle) value is calculated, which is equal to the cycle at which the fluorescence data for that locus exceeds the threshold of 50,000 fluorescence units. For each well, the ΔCq value is calculated, which is equal to the Cq of the test locus minus the Cq of the internal reference locus.

[0297] result

[0298] Description of the assay

[0299] The assay comprises three consecutive steps: digestion, amplification, and analysis. In the first step, a DNA sample substantially free of ssDNA is digested with a methylation-sensitive restriction enzyme. An aliquot of the digested DNA is then subjected to real-time PCR amplification, wherein two genomic loci are co-amplified. The first locus analyzed for methylation levels is referred to as a "test locus," or "restriction locus," and contains at least one recognition sequence for the restriction enzyme used in the digestion step. The second locus is a control locus, referred to herein as an "internal reference," which does not contain the recognition sequence for the restriction enzyme used in the digestion step. The extent of digestion of the test locus in the digestion step depends on its methylation level, with higher methylation levels resulting in less digestion. Therefore, higher methylation levels result in more templates for real-time PCR, and therefore lower Cq values ​​(detectable amplification products can be seen after a relatively small number of amplification cycles). In contrast, low methylation levels result in extensive digestion, and therefore less template for real-time PCR, and higher Cq values ​​(detectable amplification products can be seen after a higher number of amplification cycles). The internal reference is not recognized by restriction endonucleases and therefore remains intact regardless of its methylation level. During PCR, the amplification signals (Cq values) of the two loci are differentiated by using different fluorophores for their respective probes. In a third step, the signals are analyzed by dedicated software, which determines the ΔCq between the test locus and the internal reference locus.

[0300] In this experiment, the test locus is a human genomic locus on chromosome 5 that is differentially methylated between lung cancer tissue and normal lung tissue, and is mostly unmethylated in normal human plasma:

[0301]

[0302] A locus on human chromosome 7 was used as an internal reference:

[0303]

[0304] Analytical sensitivity of the assay

[0305] To determine the analytical sensitivity of the assay, mixtures of methylated and unmethylated DNA samples in varying ratios were analyzed. DNA from the human cell line HCT-15 was used as the source of methylated DNA samples because it is methylated at the test loci as determined by bisulfite sequencing ( Figure 2A , figure above).

[0306] The unmethylated DNA sample was constructed from a mixture of two bacterial plasmid DNA samples, containing the test locus and an internal reference locus as inserts. The fact that the E. coli bacteria used to generate the plasmid DNA lack CpG methyltransferase ensured that the plasmid DNA was completely unmethylated at the test locus, which was confirmed by bisulfite sequencing ( Figure 2A , Figure below). The methylated and unmethylated DNA species were then mixed together at molar ratios of 1:8, 1:64, 1:512, 1:4096, 1:32768, and 1:200,000 methylated:unmethylated DNA, and these mixtures were then analyzed using the assay described above. In each PCR well, the number of unmethylated DNA template molecules was 4,000,000, and the number of methylated DNA molecules varied—from 500,000 in the 1:8 mixture to as low as 20 molecules in the 1:200,000 mixture.

[0307] Figure 2B Shown is the amplification graph of the DNA mixture. For the DNA mixture with a 1:8 molar ratio, the ΔCq between the test locus and the internal reference locus is about 3 cycles. As the ratio between the methylated and unmethylated DNA samples increases, the ΔCq also increases until the mixture of 1:200,000 reaches 18.75 cycles. When the calculated ΔCq is plotted against the expected ΔCq (estimated ΔCq=-log2(x) for the methylation level x), assuming that the PCR efficiency of both the test locus and the internal reference locus is 100%, and using the least squares method for linear regression, the resulting fit has an R of 0.9966. 2 value( Figure 3 ), showing that the actual methylation level can be determined from ΔCq.

[0308] In the next step, to demonstrate that the assay was able to consistently detect methylated molecules with a background of unmethylated molecules at a ratio of 1:200,000, a DNA sample mixture with this ratio was tested in 34 separate PCR reactions (replicate) where each well contained 10 methylated (from HCT-15) and 2,000,000 unmethylated (from plasmid DNA) test locus template molecules, and the signal was compared to 34 PCR reactions where each well contained only 2,000,000 unmethylated DNA molecules without any methylated DNA template molecules. Figure 4A-4B The amplification plot for this experiment is shown. In all 34 replicates containing a mixture of methylated and unmethylated DNA samples, the test locus was successfully amplified ( Figure 4A), whereas no amplification of the tested locus was observed in all 34 replicates containing only unmethylated DNA ( Figure 4B ).

[0309] The overall detection rate was 100.0% (68 / 68). The lower limit of the 95% confidence interval (CI) for the one-sided exact binomial was 95.69%, meaning that the true overall detection rate was greater than 95.69% with 95% confidence. The positive and negative detection rates were both 100.0% (34 / 34). The lower limit of the 95% CI for the one-sided exact binomial was 91.57%, meaning that the true positive and true negative detection rates were greater than 91.5% with 95% confidence.

[0310] This work describes a simple and ultrasensitive assay that can detect methylation levels as low as 1:200,000. Such high sensitivity may be valuable for liquid biopsy samples, in which tumor DNA is typically present in very low amounts relative to a background consisting of normal DNA. The clinical utility of methylation assays with extremely high sensitivity is also limited by the amount of input DNA that can be analyzed, the level of background biological noise (i.e., the typical methylation levels obtained from control samples), and the level of biological signal (i.e., the percentage of patients who show abnormal methylation patterns in their tumors). The amount of input DNA sets an upper limit on the actual sensitivity that can be achieved in the assay. For example, a typical sample of 10 ml of venous blood typically produces only ~35 ng of cell-free DNA from 3-4 ml of plasma, corresponding to ~10,000 haploid genome copies. According to the assay of the present invention, the average number of genome copies analyzed in each well is ~1,000, setting the highest sensitivity level achievable with this configuration to ~1:1000 or 0.1%.

[0311] Example 4 - DNA extraction and detection of methylation changes at lung cancer-associated genomic loci

[0312] Detection of methylation changes at genomic loci associated with lung cancer in DNA samples extracted from plasma samples was performed as described in Example 1. DNA extraction from plasma samples was performed by organic DNA extraction to obtain a DNA sample containing less than 1% ssDNA as follows:

[0313] - Place 1 ml of plasma in a tube (15 ml or 50 ml tube);

[0314] - Add 500 μl of extraction buffer (300 mM Tris pH 8.0, 30 mM EDTA, 300 mM NaCl, 6% SDS), 30 μl of proteinase K (20 mg / ml), and 15 μl of 390 nM DTT to the tube;

[0315] - Seal the tube (e.g. with parafilm) and incubate at 56°C for 2 h;

[0316] - In a chemical hood, add 1.5 ml of a mixture of phenol:chloroform:isoamyl alcohol (25:24:1) equilibrated overnight to 2-8°C;

[0317] - Seal the tube (e.g. with parafilm) and shake (vortex) for 30 seconds;

[0318] - allowing the phases to separate (in a centrifuge, 3 min, 10,000 g);

[0319] - In a chemical hood, remove the aqueous phase to another tube and add an equal volume of a mixture of chloroform:isoamyl alcohol (24:1);

[0320] - Seal the tube (e.g. with parafilm) and shake (vortex) for 30 seconds;

[0321] - allowing the phases to separate (in a centrifuge, 3 min, 10,000 g);

[0322] - Remove the aqueous phase to another tube and add 0.1 volume of 3M NaAc and 2-2.4 volumes of ethanol (anhydrous);

[0323] - Incubate the tubes at -20°C for 20 minutes;

[0324] - Precipitate the DNA (in a centrifuge, 20 min, 17,000 g, 4°C);

[0325] - Discard the ethanol / NaAc solution and wash the remaining sample with ethanol (70%);

[0326] - pellet the DNA (in a centrifuge, 15 min, 17,000 g, 4°C);

[0327] - discarding the ethanol and drying the pellet; and

[0328] The pellet was resuspended in ddH2O or 0.04% NaN3 solution.

[0329] Example 5 - Next Generation Sequencing (NGS)-based Assay

[0330] Materials and Methods

[0331] Primer Design for NGS Library Preparation - 1st PCR

[0332] To amplify cancer marker loci for NGS-based assays, primers were designed that contained the following overhang adapter sequences in addition to the locus-specific sequences:

[0333] Forward primer overhang:

[0334]

[0335] Reverse primer overhang:

[0336]

[0337] The overhang adapter sequence is 5' of the locus-specific sequence.

[0338] Between the overhang adapter and the locus-specific sequence, 0, 1, 2 or 3 N nucleotides are added. This addition is to ensure an even distribution of all four bases in each sequencing cycle. The addition of these N nucleotides is in both the forward primer and the reverse primer. Generally speaking, each locus has four forward primers and four reverse primers.

[0339] Four cancer methylation marker loci, a control locus, and the KRAS exon 2 locus were used in this experiment.

[0340] The four cancer methylation marker loci are as follows:

[0341] Table 3 - Cancer methylation marker loci

[0342]

[0343] These loci contain at least one recognition site for the methylation-sensitive restriction enzyme Hhal.

[0344] The control locus is the locus listed in SEQ ID NO: 7. This locus does not include the recognition site for HhaI.

[0345] Primers used for the KRAS locus are as follows:

[0346]

[0347] Sample selection and plasma preparation

[0348] Eight plasma samples from healthy controls and nine plasma samples from cancer patients were used in this experiment.

[0349] 10ml of blood was drawn from each patient in EDTA blood tubes (Becton Dickinson). Each blood tube was centrifuged at 1500x g for 10 minutes at room temperature in a hanging basket rotor without braking. The plasma layer was then transferred to a new 15ml tube and centrifuged again at 1500x g for 10 minutes at room temperature without braking. In order to avoid lymphocyte lysis (which will contaminate cell-free DNA), centrifugation was performed up to 4 hours after blood collection.

[0350] DNA extraction

[0351] DNA extraction from plasma samples was performed using an extraction kit that produces minimal single-stranded DNA, ie, less than 5% ssDNA, during the extraction process (QIAamp Circulating Nucleic Acid Kit - Qiagen).

[0352] Plasma separation test

[0353] Prior to digestion, the extracted DNA was tested for contamination with lymphocyte DNA using a plasma fractionation assay, as described in co-pending application WO 2019 / 162941, assigned to the applicant of the present invention. Such contamination would interfere with the signal from tumor cell-free DNA. Only samples that passed the plasma fractionation assay were used for library preparation.

[0354] DNA digestion

[0355] The extracted cell-free DNA was subjected to methylation-sensitive digestion at 37°C for 2 h. The reaction was stopped by incubation at 65°C for 20 min.

[0356] Library preparation for NGS analysis

[0357] 1st PCR - locus-specific:

[0358] The four cancer methylation marker loci described above, a control locus, and the KRAS locus were amplified from digested DNA samples in two multiplexes (3 loci in each multiplex plus a control locus amplified in each multiplex) using locus-specific primers containing the 5' overhang adapter described above and 0-3 N nucleotides between the locus-specific sequence and the 5' overhang adapter sequence. 10 μl of digested DNA was amplified in a 25-cycle PCR reaction using a high-fidelity DNA polymerase.

[0359] The digested DNA used in this experiment contains high concentrations of magnesium. Magnesium is also commonly present in the PCR buffers used with high-fidelity DNA polymerases. To avoid excess magnesium, which could inhibit PCR, the magnesium concentration in the amplification reaction was adjusted based on the DNA polymerase used.

[0360] PCR purification:

[0361] After locus-specific PCR, PCR products were purified using AMPure XP beads (Beckman Coulter Genomics).After purification, the two multiplex PCR products for each sample were mixed together.

[0362] 2nd PCR - Addition of Illumina adapters and sample indexes:

[0363] To add Illumina adapters and sample indexing, a second PCR was performed using primers from the Nextera NT Indexing Kit (Illumina).

[0364] 5 μl of the mixture of two multiplex PCR products was used in an 8-cycle PCR reaction that also included 5 μl from each Nextera primer (N7 and S5) and 25 μl of KAPA HiFi HotStart Ready mix (KAPABiosystems).

[0365] PCR purification:

[0366] After the second PCR, the PCR product was purified using AMPure XP beads (Beckman Coulter Genomics).

[0367] Quantification, dilution, and library pool preparation:

[0368] The purified products were quantified using a Qubit 3.0 Fluorometer and a dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific).The PCR purified products were diluted to 1 nM.

[0369] 5 μl from each diluted purified product were pooled together to create a pooled library sample.

[0370] NGS run

[0371] DNA libraries were sequenced on the iSeq 100 system (Illumina) using the iSeq 100 kit.

[0372] 45 pM of pooled library sample + 20% PhiX library (Illumina) was inserted into the iSeq 100 flow cell.

[0373] Sequence read analysis

[0374] For each sample, analyze the read files using the software as follows:

[0375] Target allocation:

[0376] The first 10 letters of each read are searched for an exact match to one of the targets. If such a match is found, the target score of the read is increased by 1.

[0377] The search is repeated by moving 5 letters in the read and searching the next 10 letters to find an exact match to one of the targets. If such a match is found, the target score of the read is increased by 1. This process is repeated until the end of the read.

[0378] The target with the highest score (lowest score = 2) is the target selected for the read.

[0379] Locus determination:

[0380] After locus assignment, the software examines the reads and finds reads that are exact matches to the target or have at most 1 point mutation or at most 3 consecutive nucleotide insertions / deletions. These reads go into the "at most 1 mutation" folder. All other reads assigned to the target locus go into the "more than 1 mutation" folder.

[0381] Mutation analysis:

[0382] In this experiment, a nucleotide substitution in the KRAS locus was defined as a “mutation” if more than 1% of the reads in the “at most 1 mutation” file contained the nucleotide substitution.

[0383] Calculation of relative copy number:

[0384] The relative copy number of each locus (from the "max 1 mutation" folder) in each sample was calculated as follows:

[0385] Relative copy number = number of reads at locus X / number of reads at control locus.

[0386] result

[0387] NGS-based methylation assays can distinguish between non-cancer and cancer patients

[0388] Eight healthy control plasma samples and nine cancer patient plasma samples were analyzed for methylation using four cancer methylation markers in an NGS-based assay and analyzed for KRAS mutations (G12, G13). Figure 5 The methylation levels were expressed as the relative copy number of each marker (the ratio between the number of reads for each methylated marker in each sample and the number of reads for the control locus in the sample). Figure 5 Significant differences in the relative copy numbers of the four markers between control and cancer samples (corresponding to significant differences in methylation levels) were shown. A KRAS mutation (G12->R) was detected in one pancreatic cancer sample. No KRAS mutation was detected in the control sample.

[0389] The results show that NGS-based assays as described herein combined with mutation analysis can be used to detect methylation alterations indicative of cancer.

[0390] The above description of the specific embodiments will fully reveal the general nature of the invention so that others can, by applying current knowledge, easily modify and / or adapt such specific embodiments for various applications without undue experimentation and without departing from the general concepts, and therefore, such adjustments and modifications should and are intended to be understood as being within the meaning and range of equivalents of the disclosed embodiments. It should be understood that the phraseology or terminology used herein is for the purpose of description and not limitation. The means, materials and steps for carrying out the various disclosed chemical structures and functions may take various alternative forms without departing from the invention. Sequence Listing <110> Newlakes Ltd. <120> Methods and systems for detecting methylation changes in DNA samples <130> NCLX / 010 PCT <150> IL 265451 <151> 2019-03-18 <150> US 62 / 820,866 <151> 2019-03-20 <160> 11 <170> PatentIn version 3.5 <210> 1 <211> 85 <212> DNA <213> Homo sapiens <400> 1 agtagcgccc actgagcggt ttttcagttg ctgcaccgtt cttagcgccc aacggaacgt 60 ttcccgtacg cggagtccat aagtt 85 <210> 2 <211> 69 <212> DNA <213> Homo sapiens <400> 2 cggtcccgca gcgcccgcca cacacccgcg ccagaggtcc agcgcatgtg cagtgaaatg 60 gcctagccc 69 <210> 3 <211> 72 <212> DNA <213> Homo sapiens <400> 3 cggatagcgc ggcgggcgac agccccccgg ataaccccgc cgagggaggg gcgcttgtaa 60 aaccgagcgg cg 72 <210> 4 <211> 60 <212> DNA <213> Homo sapiens <400> 4 tcctccttgc cttctttcgc cgaaaggggg cgcgctcctc ccaggctgcg ctggtaccta 60 <210> 5 <211> 78 [[ID=3…]]<212> DNA <213> Homo sapiens <400> 5 aggacccgct ccgcaaagcg cccaccctcg agggaggaaa gccgagctgc gcctccgcgc 60 aaggccaggg agtgtggc 78 <210> 6 <211>… <212> DNA <213> Homo sapiens <400> 6 aggccgcgag cgcggcgcga tcagtagcgc ccactaacag ttcgttctgc acggcggagc 60 gcgagaccgc gga 73 <210> 7 <211> 60 <212> DNA <213> Homo sapiens <400> 7 agactaacttttctcttgta cagaatcatc aggctaaatt tttggcatta tttcagtcct 60 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotides <400> 8 tcgtcggcag cgtcagatgt gtataagaga cag 33 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Oligonucleotides <400> 9 gtctcgtggg ctcggagatg tgtataagag acag 34 <210> 10 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 10 ttaaaacaag atttacctct attg 24 <210> 11 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Primers <400> 11 aaatgactga atataaactt gtgg 24

Claims

1. A system for detecting methylation changes in a DNA sample, the system comprising: (a) a DNA sample, wherein the DNA sample contains less than 5% single-stranded DNA (ssDNA); and (b) a component for performing a methylation ratio analysis, the component comprising: (i) at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease for digesting the DNA sample; (ii) more than one primer pair for co-amplifying more than one genomic loci from the DNA sample in a single reaction mixture after digestion, wherein the more than one genomic loci comprise at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus; and (iii) computer software stored on a non-transitory computer-readable medium that directs a computer processor to determine a methylation alteration in the DNA sample based on a comparison of a ratio of signal intensities of the restriction loci and the control loci after amplification to a reference ratio, wherein the methylation change is determined with a detection sensitivity of at least 1:

100.

2. The system of claim 1, wherein the DNA is cell-free DNA extracted from a biological fluid sample.

3. The system of claim 2, wherein the biological fluid sample is plasma, serum, or urine.

4. The system of claim 1 , wherein the DNA sample contains less than 1% ssDNA.

5. The system of claim 1, wherein the DNA sample contains less than 0.1% ssDNA.

6. The system of claim 1, wherein the DNA sample contains less than 0.01% ssDNA or no ssDNA.

7. The system of claim 1, wherein the methylation change is determined with a detection sensitivity of at least 1:

500.

8. The system of claim 1, wherein the methylation change is determined with a detection sensitivity of at least 1:1,000.

9. The system of claim 1, wherein the more than one genomic loci include more than one restriction loci that are differentially methylated between normal DNA and disease DNA and a single control locus.

10. The system of claim 1 , wherein the methylation change is determined by performing the following steps: calculating the signal intensity of amplified products of the at least one restriction locus and the control locus; calculating the ratio between the signal intensities of the amplified products; and comparing the calculated ratio to one or more reference ratios obtained from DNA samples of known origin.

11. The system of claim 1, wherein determining the methylation change in the DNA sample comprises providing an indication of whether the DNA sample is a normal DNA sample or a disease DNA sample.

12. The system of claim 1, wherein determining the methylation change in the DNA sample comprises providing an indication of whether the DNA sample is a normal DNA sample or a cancer DNA sample.

13. The system of claim 1, wherein the components for performing methylation ratio analysis further comprise more than one fluorescent probe, the more than one fluorescent probe being used to detect amplification products of the at least one restriction locus and the at least one control locus.

14. The system of claim 1, further comprising a DNA extraction reagent for extracting DNA from a biological sample, wherein the extracted DNA contains less than 5% ssDNA.

Images