Nucleic acids targeting hepatitis B virus and their uses

Abstract

The present invention relates to the field of biotechnology and discloses a nucleic acid targeting hepatitis B virus and its uses. The nucleic acid of the present invention can effectively inhibit the replication of hepatitis B virus in vitro and in vivo. By applying the RNA interference technology of the nucleic acid of the present invention, specific degradation of HBV mRNA is triggered through targeting, thereby inhibiting the protein expression and virus replication of HBV. It has the advantages of strong specificity, small side effects, and long-lasting drug effect, and also provides a new treatment method for completely clearing HBV genes and curing hepatitis B.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid targeting hepatitis B virus and uses thereof. Background Art

[0002] Hepatitis B, also known as HBV, is a liver disease caused by the hepatitis B virus (HBV). The World Health Organization (WHO) estimates that hundreds of millions of people worldwide are infected with HBV, some of whom suffer from chronic HBV. Approximately one million people die annually from liver failure, cirrhosis, and primary hepatocellular carcinoma caused by HBV infection (Schweitzer A et al. Lancet. 386(10003):1546-1555, 2015; MacLachlan JH and Cowie BC. Cold Spring Harb Pespect Med. 5(5):a021410). The HBV genome is approximately 3.2 kb long and consists of partially double-stranded circular DNA. After HBV invades the human body, it binds to the receptors on the liver cell membrane, removes the envelope, penetrates into the liver cytoplasm, and then removes the capsid. Part of the double-stranded circular HBV DNA enters the liver cell nucleus. Under the action of host enzymes, the positive chain is extended using the negative chain DNA as a template, and the crack area in the positive chain is repaired to form covalently closed circular DNA (cccDNA). Then, using the cccDNA as a template, under the action of the host RNA polymerase II, it is transcribed into several mRNAs of different lengths. Among them, the 3.5kb mRNA contains all the genetic information on the HBV DNA sequence and is called pregenomic RNA. The latter enters the liver cytoplasm as a template and synthesizes negative-strand DNA under the action of HBV reverse transcriptase; then, using the negative-strand DNA as a template, under the action of HBV DNA polymerase, it synthesizes positive-strand DNA to form partial double-stranded circular DNA of the progeny, and finally assembles into a complete HBV and releases it outside the liver cell (Seeger C and Mason W. Viology. 0: 672-686, 2015; Liang TJ. Hepatology. 49: S13-S21, 2009). The partial double-stranded circular DNA of the progeny in the cytoplasm can also enter the liver cell nucleus, and then form cccDNA and continue to replicate. cccDNA has a long half-life and is difficult to completely eliminate from the body (Allweiss L and Dandri M. Virus. 9 (6): 156, 2017; Xia Y and Guo H. Antiviral Res. 180: 104824, 2020).

[0003] HBV contains four partially overlapping open reading frames (ORFs): the pre-S / S region, the pre-C / C region, the P region, and the X region. The pre-S / S region encodes the three envelope proteins: large (pre-S1, pre-S2, and S), medium (pre-S2 and S), and small (S); the pre-C / C region encodes HBeAg and HBcAg; the P region encodes the polymerase; and the X region encodes the X protein (Moolla N et al. J Viral Hepat. 9:323-331, 2002; Lamontagne R et al. Hepatoma Res. 2:163-186, 2016). Figure 1 A schematic diagram of the hepatitis B virus genome is shown. The inner circle shows the +DNA strand (incomplete circle) and -DNA strand (complete circle) of rcDNA, and the outer circle shows three complete viral RNAs: core mRNA (C mRNA / pgRNA), preS / L mRNA, S mRNA, and X mRNA. The proteins expressed by mRNA, core protein, polymerase protein, preS1 / S2 / S protein, and X protein, are shown between the outer and inner circles. Targeting the overlapping area (shaded area) of X mRNA, C mRNA, preS / L mRNA, and S mRNA can effectively inhibit the expression of viral RNA.

[0004] Currently, the main antiviral drugs for HBV are nucleotide analogs and interferon. Nucleotide analogs have a rapid onset of action, but the terminal response rate is not high. They only inhibit the virus in the cytoplasm of hepatocytes and have no effect on ccc-DNA in the nucleus of hepatocytes. Long-term use can lead to drug resistance caused by viral mutation and a high relapse rate after discontinuation of the drug (Menendez-Arias L et al. Current opinion in virology. 8: 1-9, 2014, Yuen M et al. Nat. Rev. Dis. Primers. 4: 18035, 2018). The response rate of interferon is only 30%. Although combining it with nucleotide analogs or increasing the dose can increase the response rate, the side effects are significantly increased, and relapse is likely after discontinuation or reduction of the drug (Woo A et al. Ann Transl Med. 5(7): 159, 2017; Wong V et al. Hepat. 51(6): 1945-1953, 2010). Therefore, there is an urgent clinical need to develop highly effective anti-HBV drugs.

[0005] RNA interference (RNAi) refers to the highly conserved phenomenon in evolution that involves the efficient and specific degradation of homologous mRNAs induced by double-stranded small interfering RNAs (siRNAs). Due to its ability to inhibit the expression of specific genes, RNAi technology has been widely used in the treatment of viral infections (Deng Y et al. Gene. 538 (2014): 217-227, 2013; van den Berg F et al. Viruses. 12 (8): 851-870, 2020). By targeting conserved regions of the HBV genome, siRNA can inhibit the production of HBV proteins, including hepatitis B surface antigen (HBsAg) (Flisiak R et al. Expert Opin Biol Ther. 18 (6): 609-617, 2018; Gornberg Met al. J Hepat. 72: 539-557, 2020). Knockout of these HBV proteins eliminates the immunosuppression of T cells and B cells against HBV, thereby restoring the patient's own immune response to HBV and providing a new treatment method with potential functional cure for chronic HBV patients (Seto WK and Yuen MF. Clin Liver Dis. 8: 83-88, 2016; Grover N. Endpoints News. April 16, 2020; Yuen MF et al. ILC, 12 April 2019, PS-80; Gane et al. Hepatology 68: 6LB-25, 2018). Summary of the Invention

[0006] The purpose of the present invention is to overcome the problems existing in the prior art and provide a new nucleic acid targeting hepatitis B virus and its use.

[0007] In a first aspect, the present invention provides a nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence having 80% or greater sequence identity to the sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, or SEQ ID NO: 29, and the antisense strand comprises a sequence having 80% or greater sequence identity to the sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, or SEQ ID NO: 30. The sequence shown in NO: 30 has a sequence identity of 80% or more.

[0008] A second aspect of the present invention provides a targeted drug delivery system, which comprises a targeting group, a linking group, and the nucleic acid as described above connected to the targeting group via the linking group.

[0009] The third aspect of the present invention provides a pharmaceutical composition comprising the nucleic acid or targeted drug delivery system as described above and a pharmaceutically acceptable carrier.

[0010] A fourth aspect of the present invention provides use of the nucleic acid, targeted drug delivery system or pharmaceutical composition described above in the preparation of a medicament for treating and / or preventing hepatitis B virus infection.

[0011] The fifth aspect of the present invention provides use of the nucleic acid, targeted drug delivery system or pharmaceutical composition described above in the preparation of a drug for reducing serum HBsAg and HBsAg.

[0012] The nucleic acid of the present invention can effectively inhibit hepatitis B virus replication in vitro and in vivo. Traditional drugs can only reversibly reduce HBV replication levels and partially eliminate HBsAg, but are essentially ineffective in clearing HBsAg. The RNA interference technology of the nucleic acid of the present invention can inhibit HBV protein expression and viral replication by targeting and inducing the specific degradation of HBV mRNA. It has the advantages of strong specificity, minimal side effects, and long-lasting efficacy. It also provides a new treatment method for completely eliminating HBV genes (such as the S gene, X gene, P gene, and C gene) and curing hepatitis B. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 A schematic diagram of the HBV genome is shown;

[0014] Figure 2 showed the effect of siRNA in reducing serum HBsAg in rAAV8-1.3HBV mice;

[0015] Figure 3 showed the effect of siRNA in reducing serum HBeAg in rAAV8-1.3HBV mice;

[0016] Figure 4 It was shown that siRNA can dose-dependently reduce serum HBsAg in HBV transgenic mice;

[0017] Figure 5 It was shown that siRNA can dose-dependently reduce serum HBeAg in HBV transgenic mice;

[0018] Figure 6 It was shown that siRNA can reduce serum HBsAg in HBV transgenic mice for a long time. DETAILED DESCRIPTION

[0019] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0020] The present invention provides a (modified or unmodified) nucleic acid comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence having 80% or greater sequence identity to the sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, or SEQ ID NO: 29, and the antisense strand comprises a sequence having 80% or greater sequence identity to the sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, or SEQ ID NO: 30. The sequence shown in NO: 30 has a sequence identity of 80% or more.

[0021] A sequence with greater than 80% sequence identity includes sequences that have 0, 1, 2, 3, or 4 base inconsistencies with the target sequence, and also includes sequences that have 0, 1, 2, 3, or 4 base inconsistencies with the target sequence and further base inconsistencies. Furthermore, the inconsistent bases may be located anywhere in the target sequence, but preferably, along the 5'-3' direction, in the sense strand, the inconsistent bases are located at positions 1-4 from the bottom, and in the antisense strand, the inconsistent bases are located at positions 1-4 from the bottom.

[0022] More preferably, the sense strand has 16-30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) nucleotides (bases).

[0023] More preferably, the antisense strand has 16-30 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30) nucleotides (bases).

[0024] In the present invention, the sense strand and the antisense strand may have the same length or different lengths.

[0025] All nucleotide groups in the above nucleic acid may be chemically unmodified, or may contain at least one modified nucleotide group, and the modification may be on the nucleotide at any position.

[0026] In a preferred embodiment of the present invention, as shown in Table 1, the nucleic acid is selected from siRNA-1 having a sense chain sequence of SEQ ID NO: 1 and an antisense chain sequence of SEQ ID NO: 2, siRNA-2 having a sense chain sequence of SEQ ID NO: 3 and an antisense chain sequence of SEQ ID NO: 4, siRNA-3 having a sense chain sequence of SEQ ID NO: 5 and an antisense chain sequence of SEQ ID NO: 6, siRNA-4 having a sense chain sequence of SEQ ID NO: 7 and an antisense chain sequence of SEQ ID NO: 8, siRNA-5 having a sense chain sequence of SEQ ID NO: 9 and an antisense chain sequence of SEQ ID NO: 10, siRNA-6 having a sense chain sequence of SEQ ID NO: 11 and an antisense chain sequence of SEQ ID NO: 12, siRNA-7 having a sense chain sequence of SEQ ID NO: 13 and an antisense chain sequence of SEQ ID NO: 14, siRNA-8 having a sense chain sequence of SEQ ID NO: 15 and an antisense chain sequence of SEQ ID NO: 16, siRNA-9 having a sense chain sequence of SEQ ID NO: 17 and an antisense chain sequence of SEQ ID NO: 18 NO: 18, siRNA-9 whose sense chain sequence is SEQ ID NO: 19 and antisense chain sequence is SEQ ID NO: 20, siRNA-10 whose sense chain sequence is SEQ ID NO: 21 and antisense chain sequence is SEQ ID NO: 22, siRNA-12 whose sense chain sequence is SEQ ID NO: 23 and antisense chain sequence is SEQ ID NO: 24, siRNA-13 whose sense chain sequence is SEQ ID NO: 25 and antisense chain sequence is SEQ ID NO: 26, siRNA-14 whose sense chain sequence is SEQ ID NO: 27 and antisense chain sequence is SEQ ID NO: 28, and siRNA-15 whose sense chain sequence is SEQ ID NO: 29 and antisense chain sequence is SEQ ID NO: 30.

[0027] The nucleic acid according to the present invention comprises a nucleotide group as a basic structural unit, wherein the nucleotide group comprises a phosphate group, a ribose group, and a base, and preferably, the nucleic acid comprises at least one modified nucleotide group. The modification does not result in loss of the nucleic acid's ability to inhibit hepatitis B virus, or in other words, the nucleic acid's inhibition efficiency against hepatitis B virus after modification is no less than 95% (e.g., 95%, 96%, 97%, 98%, or 99%) of that of the nucleic acid before modification.

[0028] According to the nucleic acid of the present invention, wherein the modified nucleotide group is a nucleotide group in which a phosphate group and / or a ribose group is modified. The modified site can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 of nucleotides 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 of the sense strand and / or the antisense strand.

[0029] For example, phosphate group modification involves the modification of the oxygen in the phosphate group, including phosphorothioate and boranophosphate modifications. As shown in the formulas below, the oxygen in the phosphate group is replaced with sulfur, borane, amine, alkyl, or alkoxy groups. These modifications stabilize the structure of nucleic acids and maintain high base pairing specificity and affinity.

[0030]

[0031]

[0032] In the above structural formula, BASE represents the base A, U, C, G, or T. X can be oxygen (O) or sulfur (S). R in the above structure can be the same or different, for example: hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, amino, cyanoethyl, acetyl, etc. R' and R" can each independently be hydrogen (H), methyl (CH3), ethyl (CH2CH3), propyl (CH2CH3), isopropyl (CH(CH3)2), allyl, propargyl, acyloxybenzyl, or acyloxyethyl.

[0033] Ribose modification refers to the modification of the 2′-hydroxyl group (2′-OH) of the ribose group. The introduction of certain substituents, such as methoxy or fluorine, at the 2′-hydroxyl position of the ribose group makes the nucleic acid less susceptible to cleavage by ribonucleases, thereby increasing its stability and making it more resistant to nuclease hydrolysis. Modifications of the 2′-hydroxyl group of nucleotide pentoses include 2′-fluoro modification (such as 2′-arabino-fluoro modification), 2′-methoxy modification (2′-OME), 2′-methoxyethyl modification (2′-MOE), 2′-2,4-dinitrophenol modification (2′-DNP modification), 2′,4′-constrained ethyl modification, 2′-amino modification, 2′-deoxy modification, BNA, acyclic nucleic acid modification, staggered nucleic acid modification, and L-type nucleic acid modification. BNA (endocyclic bridged nucleotide) refers to a constrained or inaccessible nucleotide. BNA can contain a five-membered ring, a six-membered ring, or a seven-membered ring with a "fixed" C 3'-endo sugar condensed bridge structure. The bridge is usually incorporated into the 2'-, 4'-position of the ribose ring to provide a 2', 4'-BNA nucleotide, such as a locked ethyl modification (LNA), a ring locked ethyl modification (ENA) and an ethyl locked nucleic acid modification (cET BNA). Acyclic nucleic acids are nucleotides formed by opening the sugar ring of the nucleotide, such as unlocked nucleic acid (UNA) nucleotides and glycerol nucleic acid (GNA) nucleotides. Misplaced nucleic acid modification refers to the replacement of a 3', 5'-phosphate bond link by a 2', 5'-phosphate bond chain. L-type nucleic acid modification refers to the replacement of a naturally occurring D-type nucleic acid with its mirror image stereo equivalent, an L-type nucleic acid.

[0034]

[0035]

[0036] Wherein, BASE represents the base A, U, C, G or T. R in the above structure can be the same or different, such as hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, cyanoethyl, acetyl, etc.

[0037] According to the nucleic acid of the present invention, preferably, the nucleotide group in which the ribose group is modified is a nucleotide group in which the 2'-OH of the ribose group is substituted by a methoxy group or a fluorine group.

[0038] According to a particularly preferred embodiment of the present invention, the nucleotide group containing uracil base or cytosine base in the sense strand of the nucleic acid is a nucleotide group in which the ribose group is modified, that is, the 2'-OH of the ribose group in the nucleotide group containing uracil base or cytosine base in the sense strand of the nucleic acid is replaced by a methoxy group or a fluorine. More preferably, the 3' end of the sense strand and the antisense strand of the nucleic acid can be connected with dTdT; or, the 3' end of the antisense strand of the nucleic acid can be connected with AA or UU or a combination of any two nucleic acids (which can be but is not limited to CC, GG or UG), so that the sequence has a specific inducement to mRNA degradation. The nucleic acid with the above modifications shows a more excellent inhibitory effect in vivo, and the above modifications can further reduce the immunogenicity of the nucleic acid of the present invention in vivo.

[0039] The nucleic acids of the present invention may also include modifications that include a nucleoside monophosphate attached to the 5' end of the antisense strand. The 5'-monophosphate at the terminal end of the siRNA guide strand is important for RISC recognition. Phosphorylation of the 5'-hydroxyl group plays a role in the effective loading of siRNA onto Ago2 within cells. The monophosphate at the 5' end of the siRNA guide strand interacts with Argonaute-2 (Ago2) through H-bonding, thereby ensuring accurate targeting and precise cleavage of the mRNA target. Commonly used 5'-monophosphate nucleoside derivatives include the following. These phosphate nucleoside derivatives have been shown to exhibit a certain degree of stability in biological metabolic media and to be effective in promoting the loading of siRNA guide strands onto Ago2 within cells (Nucleic Acids Research, 2015, 43, 2993–3011). In the nucleic acids of the present invention, trans-vinyl phosphate (VP) is preferably used as the primary moiety, but monophosphate nucleoside derivatives other than those mentioned above may also be included.

[0040]

[0041] 5'-methoxymethyl phosphate modification

[0042] In the above structures, BASE represents the base A, U, C, G, or T. R in the above structures can be the same or different, such as hydrogen (H), fluorine (F), methoxy (OME) or methoxyethyl (MOE), hydroxyl, allyl, ethylamino, propargyl, cyanoethyl, amino, acetyl, etc.

[0043] According to a more preferred embodiment of the present invention, the base sequence of the modified nucleic acid and the modification method are as shown in Table 2 (f, s, underline), that is, the positive chain and antisense chain of the modified nucleic acids siRNA-8, siRNA-9, siRNA-11, siRNA-13 and siRNA-14 have the modifications indicated by f, s and underline shown in Table 2, and the 3' end of the antisense chain is further connected with UU.

[0044] In a particularly preferred embodiment, the nucleic acid is selected from siRNA-13, the sense strand base sequence of which is SEQ ID NO: 25 and the antisense strand base sequence of which is SEQ ID NO: 26, and the modifications on the nucleotides are as follows:

[0045] 5'- C s U s AGGA Gf G Cf U Gf UAGGCAUAAA -3'

[0046] 5'- U sUf U Af U Gf CCUACAG Cf C Uf CCUAG s U s U -3'

[0047] Among them, the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a 2'-fluorine-modified nucleotide (that is, the 2'-OH of the pentose of the nucleotide is replaced by fluorine); the lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are connected by a thiophosphate diester bond (that is, the non-bridging oxygen atom in the phosphodiester bond is replaced by a sulfur atom); the underlined nucleotide represents that the 2' hydroxyl group of the nucleotide is replaced by a methoxy group.

[0048] The nucleic acids according to the present invention can be obtained by conventional methods in the art, such as solid phase synthesis and liquid phase synthesis. Solid phase synthesis is commercially available on a custom basis and can therefore be purchased commercially. The modified nucleotide groups can be introduced by nucleotide monomers having corresponding modifications.

[0049] Based on the nucleic acid (siRNA) synthesized above, the present invention can further construct an shRNA expression plasmid having the same or similar function as the above siRNA. The method for constructing the expression plasmid is well known to those skilled in the art and will not be described in detail here.

[0050] The present invention also provides a targeting gene sequence of the nucleic acid described above. In some embodiments, the targeting gene sequence is as shown in any one of the items in column 2 of Table 1.

[0051] Table 1

[0052] serial number Targeted gene loci Sense strand sequence (5'-3') Antisense strand sequence (5'-3') 1 454-472 UCAAGGUAUGUUGCCCGUU(1) AACGGGCAACAUACCUUGA(2) 2 466-484 GCCCGUUUGUCCUCUAAUU(3) AAUUAGAGGACAAACGGGC(4) 3 476-494 CCUCUAAUUCCAGGAUCCU(5) AGGAUCCUGGAAUUAGAGG(6) 4 573-591 CCAAACCUUCGGACGGAAA(7) UUUCCGUCCGAAGGUUUGG(8) 5 694-712 UCAGUGGUUCGUAGGGCUU(9) AAGCCCUACGAACCACUGA(10) 6 761-779 CCAAGUCUGUACAGCAUCU(11) AGAUGCUGUACAGACUUGG(12) 7 1409-1427 GCGGGACGUCCUUUGUUUA(13) UAAACAAAGGACGUCCCGC(14) 8 1688-1708 GACCGACCUUGAGGCAUACUU(15) AAGUAUGCCUCAAGGUCGGUC(16) 9 1692-1710 GACCUUGAGGCAUACUUCA(17) UGAAGUAUGCCUCAAGGUC(18) 10 1772-1790 ACUAGGAGGCUGUAGGCAU(19) AUGCCUACAGCCUCCUAGU(20) 11 1772-1792 ACUAGGAGGCUGUAGGCAUAA(21) UUAUGCCUACAGCCUCCUAGU(22) 12 1773-1791 CUAGGAGGCUGUAGGCAUA(23) UAUGCCUACAGCCUCCUAG(24) 13 1773-1793 CUAGGAGGCUGUAGGCAUAAA(25) UUUAUGCCUACAGCCUCCUAG(26) 14 1775-1795 AGGAGGCUGUAGGCAUAAAUU(27) AAUUUAUGCCUACAGCCUCCU(28) 15 1803-1823 GCACCAGCACCAUGCAACUUU(29) AAAGUUGCAUGGUGCUGGUGC(30)

[0053] Note: (1) in columns 3-4 represents SEQ ID NO: 1, "454-472" in column 2 represents nucleotides 454-472 in the hepatitis B virus gene sequence, and so on.

[0054] Hepatitis B virus gene sequence (MT603404.1, SEQ ID NO: 31):

[0055]

[0056]

[0057] The present invention also provides a targeted drug delivery system, characterized in that the targeted drug delivery system includes a targeting group, a linking group, and the nucleic acid as described above connected to the targeting group via the linking group. Wherein, the targeting group can further improve the targeting of small nucleic acids and can be provided by monosaccharides (such as glucose, mannose, allose, altrose, galactose, galactosamine, N-acetylgalactosamine, talose, fructose, idose, etc.) and / or polypeptides (such as proteins, monoclonal antibodies, nanobodies). The linking group can be selected from -O-[CH2CH2O] n -, -[CH2] m -CONH-[CH2] n O-, -O-[CH2CH2O] m -CONH-[CH2] n O-, -O-[CH2] m -CONH-[CH2H2O] n O-, wherein m and n can each independently be an integer from 1 to 10.

[0058] According to a preferred embodiment of the present invention, the targeted drug delivery system has a structure as shown below, wherein Nu represents a nucleic acid (siRNA) of the present invention, and the compound portion can be connected to the 5' end or 3' end of the sense strand of the siRNA via a phosphodiester bond, or can be connected to the 5' end or 3' end of the antisense strand of the siRNA via a phosphodiester bond. The targeted drug delivery system utilizes the structural characteristics on its left side to improve the cell penetration ability of the nucleic acid drug (Nu), enhance its stability in the cell, and has a simple preparation process and strong practicality.

[0059]

[0060] The present invention also provides a pharmaceutical composition comprising the nucleic acid or targeted drug delivery system described above and a pharmaceutically acceptable carrier. The pharmaceutical composition can be prepared from the nucleic acid and the pharmaceutically acceptable carrier using conventional methods. For example, the pharmaceutical composition can be an injection. The injection can be administered subcutaneously, intramuscularly, or intravenously.

[0061] According to the pharmaceutical composition of the present invention, there is no particular requirement for the amount of the nucleic acid or targeted drug delivery system and the pharmaceutically acceptable carrier. Generally, relative to 1 part by weight of the nucleic acid (or 1 part by weight of the targeted drug delivery system calculated as nucleic acid), the content of the pharmaceutically acceptable carrier can be 1-100,000 parts by weight (such as 1 part by weight, 5 parts by weight, 10 parts by weight, 50 parts by weight, 100 parts by weight, 500 parts by weight, 1,000 parts by weight, 5,000 parts by weight, 10,000 parts by weight, 50,000 parts by weight, 100,000 parts by weight or any value between any two of the above values).

[0062] According to the pharmaceutical composition of the present invention, wherein the pharmaceutically acceptable carrier can be various carriers conventionally used in the art, for example, can include at least one of a pH buffer, a protective agent and an osmotic pressure regulator. The pH buffer can be a tris hydroxymethylaminomethane hydrochloride buffer with a pH of 7.5-8.5 and / or a phosphate buffer with a pH of 5.5-8.5, preferably a phosphate buffer with a pH of 5.5-8.5. The protective agent can be at least one of inositol, sorbitol and sucrose. Based on the gross weight of the pharmaceutical composition, the content of the protective agent can be 0.01-30 weight % (such as 0.01 weight %, 0.05 weight %, 0.1 weight %, 0.5 weight %, 1 weight %, 5 weight %, 10 weight %, 15 weight %, 20 weight %, 25 weight %, 30 weight % or any value between any two of the above values). The osmotic pressure regulator can be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition be 200-700 mOsmole / kg. According to the desired osmotic pressure, those skilled in the art can determine the content of the osmotic pressure regulator.

[0063] According to a preferred embodiment of the present invention, the pharmaceutically acceptable carrier is a liposome. The liposome can be any liposome capable of encapsulating nucleic acid, and its diameter can be 25-1000 nm, and can include but not limited to cholesterol and its analogs or derivatives.

[0064] The dosage of the pharmaceutical composition of the present invention can be a conventional dosage in the art, and can be determined based on various parameters, particularly the age, weight, and sex of the subject. For example, for female mice aged 3-4 months and weighing 25-30 g, the dosage of the pharmaceutical composition can be 0.01-100 mg / kg body weight, preferably 1-10 mg / kg body weight, based on the amount of the nucleic acid in the pharmaceutical composition.

[0065] The present invention also provides the use of the nucleic acid, targeted drug delivery system, or pharmaceutical composition described above in the preparation of a medicament for treating and / or preventing hepatitis B virus infection. In the pharmaceutical composition for treating and / or preventing hepatitis B virus infection, the nucleic acid described above primarily acts through the mechanism of RNA interference.

[0066] The present invention also provides the use of the nucleic acid, targeted drug delivery system or pharmaceutical composition described above in the preparation of a drug for reducing serum HBsAg and HBsAg.

[0067] The present invention also provides a method for inhibiting hepatitis B virus, which comprises administering the above-mentioned nucleic acid and / or pharmaceutical composition to a patient infected with hepatitis B virus. "Inhibition" means silencing viral gene expression, blocking replication, or reducing viral load. The patient can be a mammal, preferably a primate, and more preferably a human. Administration can be through a variety of routes, depending on whether local treatment or systemic treatment is required. The mode of administration can be, but is not limited to, intravenous administration, intra-arterial administration, subcutaneous administration, intraperitoneal administration, transdermal administration (such as by implantation of a device), and administration into soft tissue.

[0068] In addition, the present invention also provides a method for inhibiting hepatitis B virus in vitro, which comprises introducing the above-mentioned nucleic acid and / or pharmaceutical composition into cells.

[0069] The present invention will be described in detail below through examples. Unless otherwise specified, the reagents and culture media used in the present invention are commercially available products, and the nucleic acid electrophoresis and other operations used in the present invention are all performed according to conventional protocols.

[0070] Example 1

[0071] siRNA-1 to siRNA-15 listed in Table 1 were obtained by solid phase synthesis. 0.5 ml of cell culture medium (DMEM, 10% FBS) containing 10 5 Hep3B cells were cultured overnight in a cell culture incubator at 37°C and 5% CO2. RNAiMAX (Lipofectamine TM1-2 μl / well) and the small interfering nucleic acids (siRNAs) 1 to 15 listed in Table 1 were added to the cell culture wells to a final concentration of 33 nM or 100 nM per well. The cells were cultured for 48 hours in a 37°C, 5% CO2 incubator. To extract RNA, the cell culture supernatant was aspirated, washed with PBS, and then extracted according to the instructions of the RNAeasy Mini Kit (QIAGEN, Catalog No. 74104). RT-PCR was performed according to the High Capacity cDNA Reverse Transcription Kits (Thermo Fisher, Catalog No. 4368814), with 0.5 or 1 μg of RNA per reaction. Gene expression was quantified by real-time fluorescence PCR using the HBV TaqMan probe Pa03453405_s1 and the internal reference gene (human HPRT1) probe Hs02800695_m1 (Thermo Fisher Scientific, Waltham, MA, USA). PCR conditions were 1 cycle at 95°C for 20 seconds, followed by 40 cycles of 95°C for 1 second and 60°C for 20 seconds. Real-time PCR was performed using a StepOne Plus (Thermo Fisher). PCSK9 gene expression was calculated using 2-ΔΔCt, with human HPRT1 gene expression serving as an internal control. HBV gene expression was expressed as a percentage of the control group treated with RNAiMAX alone (see Table 2).

[0072] Table 2

[0073] serial number 33nM (%) 100nM (%) 1 101 96 2 99 94 3 65 35 4 110 66 5 98 72 6 73 45 7 53 41 8 32.6 38.3 9 36.5 47.9 10 34.2 38.5 11 35.5 29.7 12 29.4 29.8 13 32.6 35.8 14 35.5 29.7 15 42.2 38.7

[0074] Example 2

[0075] (1) Prepare siRNA drug according to the following steps:

[0076] Synthesis of conjugate (603A)

[0077] 1. Compound 7 was prepared according to the following route

[0078]

[0079] Synthesis of compound oxazoline 5

[0080] N-Acetylgalactosamine tetraacetate 4 (10 g, 25.68 mmol) was dissolved in dichloroethane (60 mL) at room temperature. Trimethylsilyl trifluoromethanesulfonate (8.6 g, 38.66 mmol) was added to the solution with stirring. Stirring was continued and the solution was heated to 50°C. After reacting at 50°C for 2 hours, heating was stopped and stirring was continued at room temperature for 12 hours. The solution was poured into ice water containing saturated sodium bicarbonate and extracted with dichloromethane. The organic phase was washed with water. The organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to dryness under reduced pressure to obtain compound 5 as a brownish-yellow foamy syrup. This compound 5 was used directly in the next reaction.

[0081] Synthesis of compound 6

[0082] Compound 5 (4.26 g, 12.9 mmol) was dissolved in dichloromethane (20 mL) at room temperature and mixed with a solution of triethylene glycol (3.4 g, 19 mmol) dissolved in dry dichloromethane (20 mL) at 0°C. Trimethylsilyl trifluoromethanesulfonate (TMSOTf, 1.4 g, 6.45 mmol) was slowly added to the solution at 0°C and stirred for one hour. The mixture was stirred at room temperature for 14 hours, then poured into ice-cold water containing saturated sodium bicarbonate and extracted with dichloromethane (2 × 50 mL). The organic phase was washed with water. The organic phase was separated, dried over anhydrous sodium sulfate, and concentrated to semi-dryness under reduced pressure by rotary evaporation. Purification was continued by silica gel chromatography using a gradient elution system, initially with a mixed solvent (ethyl acetate / methanol, 10:1, v / v). The product fractions were collected and the solvent was removed under reduced pressure to yield the nearly white compound 6 (5.3 g, 81%). 1 H NMR (CDCl3): δ, 6.15 (d, 1H, NH), 5.32 (d, 1H, sugar-H-4'), 5.07 (dd, 1H, J=11.2Hz, J=3.3 Hz,sugar-H-3'),4.76(d,1H,J=8.6Hz,sugar-H-1'),4.17(m,3H,sugar-H-2',sugar-H-6 '),3.91(m,2H,-CH2O),3.89(m,1H,suager-H-5'),3.76-3.61(m,8H,-CH2O),3.47(m,2H ,-CH2N3),2.16(s,3H,-CH3,NHAc),1.99,2.00,2.05(3xs,9H,-CH3,Ac).HRMS(ESI)m / z,C 20 H 32 N4O 11 (M+H + ) Theoretical value: 505.49, measured value: 505.20.

[0083] Synthesis of compound 7

[0084] Azide compound 6 (522 mg, 1.04 mmol) was dissolved in 10 mL of ethyl acetate, and Pd / C (80 mg) was added to 30 mL of ethyl acetate under nitrogen. The reaction flask was connected to a hydrogen balloon and the atmosphere was replaced with hydrogen several times. The reaction solution was stirred continuously for 3 hours at room temperature. After filtering the Pd / C through Celite, 0.5 mL of 2 M hydrochloric acid was slowly added dropwise to the reaction flask. The solution was stirred for 30 minutes at 0°C. 10 mL of acetonitrile was added to the reaction solution, and the mixture was azeotropically concentrated under reduced pressure twice. The concentrated solution was mixed with dichloromethane (10 mL) and concentrated under reduced pressure twice more to obtain crude product 7 (500 mg) as an oily foam, which was used directly in the next reaction without further purification. 1 H NMR (CDCl3): δ, 8.25 (m, 2H, -NH2), 5.34 (d, 1H, sugar-H-4'), 5.21 (dd, 1H, J=11.2Hz, J=3. 3Hz,sugar-H-3'),4.91(d,1H,J=8.5Hz,sugar-H-1'),4.12(m,3H,sugar-H-6',sugar-H-2 '),4.07(m,2H,sugar-H-5',-NH),3.76(m,2H,-CH2O),3.68(m,2H,-CH2O),3.61(m,2H,-CH 2O),3.58(m,4H,2x-CH2O),3.20(m,2H,NH2),2.09(s,3H,-NHCO2CH3),2.04,1.96,1.89(3x s,9H,-CO2CH3).HRMS(ESI)m / z,C 20 H 34 N2O 11 (M+H + ) Theoretical value: 479.49, measured value: 479.20.

[0085] 2. Compound 12 was prepared according to the following route

[0086]

[0087] Synthesis of compound 9

[0088] Tris(hydroxymethyl)aminomethane 8 (10 g, 82.6 mmol) was dissolved in 15 mL of dioxane. 1.26 mL of 40 wt% potassium hydroxide aqueous solution was added dropwise to the reaction solution with stirring, followed by the addition of 20 mL of dioxane at room temperature. Acrylonitrile (18 mL, 272 mmol) was slowly added dropwise to the reaction flask at 0°C over approximately 1 hour. The reaction solution was stirred at room temperature for 24 hours. The reaction solution was poured into a saturated sodium chloride solution and extracted with dichloromethane (2 × 50 mL). The organic phase was washed with water. The organic phase was separated, dried over anhydrous sodium sulfate, and concentrated to dryness by rotary evaporation under reduced pressure. The product fractions were then purified by silica gel chromatography, eluting first with dichloromethane and then with a mixed solvent (dichloromethane / methanol, 10:1, v / v). Concentration by rotary evaporation under reduced pressure afforded 9 (20 g, 86%) as a light yellow oil. 1 H NMR(CDCl3): δ,3.68(t,6H,J=7.1Hz,3x-CH2O),3.44(s,6H,3x-CH2CNH2),2.61(t,6H,J=6.2Hz,3x–CH2CN),1.70(s,2H,-NH2).HRMS(ESI)m / z,C 13 H 20 N4O3(M+H + ) Theoretical value: 281.32, measured value: 281.20.

[0089] Synthesis of compound 10

[0090] Tris[(cyanoethoxy)methyl]aminomethane 9 (1.2 g, 4.28 mmol) was dissolved in 10 mL of anhydrous ethanol. 2 mL of concentrated sulfuric acid and 10 mL of anhydrous ethanol were slowly added dropwise to the solution in the reaction flask at room temperature. The reaction solution was heated to 80°C and maintained at reflux for approximately 36 hours. After cooling the reaction solution to room temperature, 25 mL of saturated sodium bicarbonate solution on ice was added. The ethanol was removed by rotary evaporation under reduced pressure. The aqueous solution was extracted with ethyl acetate (2 × 50 mL). The resulting organic phase was dried over anhydrous sodium sulfate and concentrated by rotary evaporation under reduced pressure to yield 10 (0.8 g, 46%) as a light yellow oil. This crude product was used directly in the next reaction without further purification.

[0091] Synthesis of compound 11

[0092] The crude product compound 10 (0.8 g, 1.9 mmol) was dissolved in 20 mL of dichloromethane. Di-tert-butyl dicarbonate (2 mL, 8.8 mmol) and 5 mL of triethylamine were added to the reaction solution. The reaction solution was stirred at room temperature for 14 hours. The reaction solution was poured into an aqueous solution containing saturated sodium bicarbonate and extracted with dichloromethane (2×50 mL). The organic phase was washed with water. The organic phase was separated, dried over anhydrous sodium sulfate, and concentrated to semi-dryness by rotary evaporation under reduced pressure. Purification was continued on a silica gel column using a gradient elution, first washing with dichloromethane solvent and then eluting with (dichloromethane / methanol, 96:4, v / v). The product components were collected and the solvent was removed under reduced pressure to obtain a nearly white oil 11 (0.5 g, 51%). 1 H NMR(CDCl3): δ,4.92(b,1H,-CONH-),4.14(m,3x2H,-CO2CH2-),3.69(m,3x2H,-OCH2-),3.63(s,3x2 H,-OCH2-),2.53(m,3x2H,-COCH2-),1.45(s,3x3H,-CH3),1.26(t,3x3H,-CH2CH3).HRMS(ESI)m / z,C 24 H 43 NO 11 (M+H + ) Theoretical value: 522.60, measured value: 522.40.

[0093] Synthesis of compound 12

[0094] Boc-protected compound 11 (0.6 g, 1.43 mmol) was dissolved in 20 mL of anhydrous ethanol. 4 mL of sodium hydroxide (4 M) was slowly added dropwise to the reaction solution, maintaining the reaction solution at 0°C and stirring for 14 hours. The reaction progress was monitored by liquid chromatography-mass spectrometry. After the peak of the reactant disappeared, the ethanol was evaporated under reduced pressure. 10 mL of potassium bisulfate (1 M) was added to the reaction solution and stirring was continued at 0°C for 15 minutes. The reaction solution was extracted with ethyl acetate (2 × 50 mL). The resulting organic phase was dried over anhydrous sodium sulfate and concentrated by reduced pressure rotary evaporation to obtain a viscous product 12 (0.5 g, 81%). This crude product was used directly in the next reaction without further purification. 1H NMR(CDCl3):d,9.40(b,3H,-CO2H),5.0(b,1H,-CONH-),3.70(m,m,3x2H,-OCH2-),3. 65(s,3x2H,-OCH2-),2.60(m,3x2H,-COCH2-),1.42(s,3x3H,-CH3).HRMS(ESI)m / z,C 18 H 31 NO11 (M+H + ) Theoretical value: 438.32, measured value: 438.20.

[0095] Compound 14 was prepared according to the following route

[0096]

[0097] Synthesis of compound 13

[0098] Tricarboxylic acid 12 (0.5 g, 1.14 mmol) was dissolved in 20 mL of dichloromethane. 2-(7-Azobenzotriazole)-N,N,N′,N′-tetramethyluronium hexafluorophosphate (1.3 g, 3.42 mmol) and N,N-diisopropylethylamine (0.2 g, 3.95 mmol) were added, along with 8 mL of dimethylformamide. Amine 7 (2.19 g, 4.08 mmol) was dissolved in 5 mL of dimethylformamide, and 1 mL of N,N-diisopropylethylamine was added. The two solutions were mixed and stirred at room temperature for 14 hours. Chromatographic analysis confirmed the complete disappearance of the reactants. 20 mL of saturated sodium bicarbonate aqueous solution was added to the reaction solution, and extracted with 2×50 mL of dichloromethane. The organic phase was concentrated by rotary evaporation to semi-dryness and further purified by silica gel chromatography using a gradient elution, first washing with dichloromethane solvent, and then eluting with (dichloromethane / methanol, 85:15, v / v). The product components were collected and the solvent was removed under reduced pressure to obtain a nearly yellow oily crude product 13 (2 g, 86%). The crude product 13 was further purified by reverse phase chromatography with the elution solvent being (H2O / MeOH, 1:1, v / v). The product components were collected and concentrated by rotary evaporation to dryness to obtain compound 13 (1.24 g, 60%). 1 H NMR(CDCl3): δ,5.32(d,3H,J=3.0Hz,sugar-H-4'),5.18(dd,3H,sugar-H-3'),4.78(d,3H,su gar-H-1'),4.18-4.06(m,24H,-OCH2,sugar-H-5'),3.93(m,9H,sugar-2xH-6',sugar-H-2') ,3.77,3.64,3.46(m,6H,-CH2NH-),2.44,2.20(m,6H,-COCH2-),2.15(s,9H,-NHCOCH3),2.09 (s,2H,-CH2-),2.05,1.99,1.95(3xs,27H,-OCOCH3),1.81(s,9H,CH3,Boc).HRMS(ESI)m / z,C 78 H 127 N7O41 (M+2H + ) / 2, theoretical value: 910.1, measured value: 910.0.

[0099] Synthesis of compound 14

[0100] Purified compound 13 (2 g, 1.1 mmol) was dissolved in 30 mL of dichloromethane. 1 mL of 4 M hydrochloric acid and 1 mL of dioxane were slowly added to the dichloromethane reaction solution at 0°C. The reaction solution was stirred at 0°C for 30 minutes and then at room temperature for another 30 minutes. The solution was concentrated to dryness by rotary evaporation to afford crude product 14 (1.7 g, 90%) as a white foam. This crude product was used directly in the next reaction without further purification. 1 H NMR (CDCl3): δ, 8.20 (b, 2H, -NH2), 5.35 (d, 3H, J=3.0Hz, sugar-H-4'), 5.22 (dd, 3H, sugar-H -3'),4.80(d,3H,sugar-H-1'),4.13(m,9H,sugar-2xH-6',sugar-H-2'),3.94-3.44(m,24H ,-OCH2,sugar-H-5'),3.77,3.64,3.46(m,6H,-CH2NH-),2.55,2.43(m,6H,-COCH2-),2.15( s,9H,-NHCOCH3),2.09(s,2H,-CH2-),2.05,1.98,1.96(3xs,27H,-OCOCH3).HRMS(ESI)m / z,C 73 H 119 N7O 39 (M+H + ) / 2, theoretical value: 860.4, measured value: 860.0.

[0101] Compound 21 was prepared according to the following route

[0102]

[0103] Synthesis of compound 16

[0104] 4,4′-Dimethoxytrityl chloride (1.8 g, 5.3 mmol) was dissolved in 5 mL of dichloromethane and slowly added dropwise to a solution of 3-hydroxy-2-hydroxymethyl-2-methyl-propionic acid 15 (0.8 g, 5.97 mmol) in anhydrous pyridine (10 mL) at room temperature. The solution was stirred at room temperature for 14 hours. 20 mL of water was added to the reaction mixture, and the mixture was extracted with 2 × 50 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and purified by silica gel chromatography using a gradient elution system, first with n-hexane and then with (n-hexane / ethyl acetate, 1:1, v / v). The product fractions were collected and the solvent was removed under reduced pressure to yield 16 (1.5 g, 58%) as a yellow solid. 16 was used directly in the next reaction.

[0105] Synthesis of compound 19

[0106] Monomethyl adipate 17 (0.16 g, 1 mmol) and tert-butyl N-(tert-butoxycarbonyl)-1,3-diaminopropane N-(3-aminopropyl)carbamate 18 (0.174 g, 1 mmol) were dissolved in 5 mL of anhydrous tetrahydrofuran at room temperature. This solution was mixed with 0.892 mL of 1-propylphosphonic anhydride (0.892 mL, 1.5 mmol, in 50% (1:1 volume ratio) ethyl acetate) and 0.522 mL of N,N-diisopropylethylamine (DIPEA, 0.522 mL, 3 mmol). The reaction mixture was stirred at room temperature for 30 minutes, then diluted with 20 mL of ethyl acetate and 20 mL of saturated brine. The mixture was then extracted with 2 × 20 mL of ethyl acetate. The organic phase was separated, dried over anhydrous sodium sulfate, and concentrated to dryness by rotary evaporation to obtain a pale yellow foamy crude product 19 (0.29 g, 91%). The crude product 19 was used directly in the next reaction without further purification. 1 H NMR(CDCl3), δ,5.89(b,1H,-CONH-),4.97(b,1H,-NHCO-),3.75(s,3H,-CH3),3.27(m,2H),3.15(m,2H),2.34(m,2H),2.19(m,2H),1.67(m 2x2H),1.64(m,2H),1.4(s,9H).HRMS(ESI)m / z,C 15 H 28 N2O5, theoretical value: 316.39, measured value: 316.40.

[0107] Synthesis of compound 20

[0108] Compound 19 (0.8 g, 2.5 mmol) was dissolved in 5 mL of ethyl acetate. The reaction solution was mixed with 3.2 mL of 4 M hydrochloric acid solution, and 5 mL of dioxane was added. The mixture was stirred at room temperature for 30 minutes. After rotary evaporation, a viscous crude product 20 (0.5 g, 92%) was obtained, which was used directly in the next reaction.

[0109] Synthesis of compound 21

[0110] The crude product, compound 20 (0.252 g, 1 mmol), was dissolved in 5 mL of dimethylformamide. The reaction mixture was mixed with 3-O-4,4'-dimethoxytrityl-2-hydroxy-2-methylpropionic acid 16 (0.45 g, 0.9 mmol) at 0°C. 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (0.46 g, 1.2 mmol) and N,N-diisopropylethylamine (0.52 mL) were added and stirred for 20 minutes. The temperature of the reaction solution was slowly raised to room temperature, and stirring was continued for 14 hours. The reaction solution was mixed with 20 mL of saturated sodium chloride aqueous solution and extracted with 2 × 50 mL of ethyl acetate. The organic phase was dried over anhydrous sodium sulfate and concentrated by rotary evaporation to obtain the crude product 21. The product was purified by silica gel chromatography using a gradient elution, first with ethyl acetate and then with (ethyl acetate / methanol, 90:10, v / v). The product components were collected and the solvent was evaporated under reduced pressure to obtain compound 21 (0.38 g, 61%). 1 H NMR(CDCl3): δ, 8.01(b,1H,-CONH-),7.26(m,4H,Trityl),7.05(m,4H,Trityl),6. 67(m,4H,Trityl),6.48(b,1H,-NHCO-),5.25(s,3H,-OCH3),3.78(s,6H,2x-OCH3) , 3.64(s,4H,2X-CH2-), 3.26(m,2H,-NHCH2-), 3.17(m,2H,-CH2NH-), 2.79(m,3H,- OCH3), 2.31(m, 2H), 2.18(m, 2H), 1.65-1.56(m, 6H), 1.25(s, 3H).HRMS(ESI)m / z,C 36 H 46 N2O8,(M+Na + ) Theoretical value: 657.34, measured value: 657.40.

[0111] Compound (603A) was prepared according to the following route

[0112]

[0113] Synthesis of compound 22

[0114] Purified compound 21 (0.7 g, 1.1 mmol) was dissolved in 5 mL of anhydrous methanol, and 1.5 mL of a 2 M solution of lithium chloride in methanol was slowly added to the reaction solution at 0°C. The mixture was stirred at 0°C for 30 minutes, then the reaction solution was warmed to room temperature and stirred at room temperature for 2 hours. At room temperature, the reaction solution was mixed with 2 mL of water and concentrated to semi-dryness by rotary evaporation to remove the methanol. The product was then separated by preparative reverse-phase high-pressure liquid chromatography using a mobile phase of methanol and water (MeOH:H2O, 1:1, v / v). The product fractions were collected and the solvent was removed under reduced pressure to yield compound 22 (0.66 g, 93%) as a yellow solid. 1 H NMR (CDCl3): δ, 7.38 (m, 4H, Trityl), 7.29 (b, 1H, -CONH-), 7.28 (m, 5H, Trityl), 7.16 (b, 1H, -NHCO-), 6.79 (m, 4H, Trityl), 3.76 (s, 10H, 2x-OCH 3, 2x–CH2),3.71(m,2H,-CH2-),3.21(m,2H,-NHCH2-),2.07(m,2H,-CH2NH-),1.87(m,2H),1.50(m,2H),1.27(m,2H),1.21(s,3H).HRMS(ESI)m / z,C 35 H 43 N2O8, (M+H + +Na + ) Theoretical value: 643.72 Measured value: 643.20.

[0115] Synthesis of compound (603A)

[0116] Purified compound 22 (0.65 g, 1.04 mmol) was dissolved in 15 mL of dichloromethane and then mixed with 0.723 mL of N,N-diisopropylethylamine (4.16 mmol) at room temperature. This mixture was then mixed with purified compound 14 (1.83 g, 1.04 mmol), 2-(7-azabenzotriazole)-N,N,N′,N′-tetramethyluronium hexafluorophosphate (0.435 g, 1.1 mmol), and N,N-diisopropylethylamine (0.723 mL, 4.16 mmol) at 0°C and stirred for 30 minutes. Continuing at 0°C, 1 mL of N,N-diisopropylethylamine was added to the reaction solution, and stirring continued for 1 hour. The reaction temperature was gradually increased from 0°C to room temperature, and stirring was continued for 2 hours. The reaction solution was mixed with 5 mL of saturated sodium chloride solution and extracted with 2 × 50 mL of dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated by rotary evaporation under reduced pressure to obtain the crude product 603A. Further purification was performed by silica gel chromatography using a gradient elution system, first with dichloromethane and then with (dichloromethane / methanol / triethylamine, 94:5:1, v / v / v). The product fractions were collected and the solvent was removed under reduced pressure to yield compound 603A (1.56 g, 65%) as a yellow solid. 1 H NMR (CDCl3): δ, 7.38 (m, 3H, -NH-), 7.28 (m, 4H, trityl), 7.26 (m, 1H, -NH-), 7.18 (m, 1H, -NH-), 6.84 (m, 5H, trityl), 6.37 (m, 4H, t rityl), 5.33 (m, 3H, sugar-H-4'), 5.16 (dd, J = 3.4Hz, J = 11.3Hz, 3H, sugar-H-3'), 4.77 (d, J = 8.4Hz, 3H, sugar-H-1'), 4.18-4.07 ( m,3x2H,3x1H,sugar-H-5',sugar-H-6'),3.94(m,3H,sugar-H-2'),3.77-3.53(m,14H),3.42(m,2H,-NHCH2-),3.30-3.19(m,2H,- CH2NH-),2.42(m,2H),2.19(m,4H),2.15(s,9H),2.07(m,2H),2.05(s,9H,2.01(s,9H),1.96(s,9H),1.20(s,3H).HRMS(ESI)m / z,C 87 H 143 N9O 44 ,(M-trityl+H + ) / 2, theoretical value: 1010.55, measured value: 1010.4.

[0117] The conjugate (603B) triethylamine carboxylate was prepared according to the following route

[0118]

[0119] Dissolve compound (603A) (1.5 g, 0.646 mmol) in 30 mL of dry dichloromethane, then add 5 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.159 g, 1.3 mmol) in the reaction solution. Stir and dissolve succinic anhydride (0.13 g, 1.3 mmol) in the reaction solution at room temperature. Stir and react for 8 hours. Add succinic anhydride (32 mg, 0.32 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated brine and extract with 2 × 50 mL of dichloromethane. Separate the organic phase, dry over anhydrous sodium sulfate, and evaporate to dryness under reduced pressure. The product was purified by silica gel chromatography using a gradient elution, first with a mixed solvent (dichloromethane / methanol / triethylamine, 100:2; 1, v / v / v), then with a mixed solvent (dichloromethane / methanol / triethylamine, 100:5:1, v / v / v), and finally with a mixed solvent (dichloromethane / methanol / triethylamine, 100:5:1, v / v / v). The solvent was evaporated under reduced pressure to give a white compound (603B) (1.56 g, 65%). 1 H NMR (CDCl3) δ, 1 H NMR(CDCl3): δ,7.39(m,3H,-NH-),7.28(m,5H,trityl),7.22(m,1H,-NH-),7.10(m,1H,-NH-),6.80(m,4H,trityl),6.37(m,4H,trityl) ,5.32(m,3H,sugar-H-4'),5.29(s,2H),5.15(dd,J=3.4Hz,J=11.3Hz,3H,sugar-H-3'),4.77(d,J=8.4Hz,3H,sugar-H-1'),4.18-4.07( m,3x2H,3x1H,sugar-H-5',sugar-H-6'),3.94(m,3H,sugar-H-2'),3.67(m,9H),3.61-3.53(m,42H),3.42(m,2H,-NHCH2-),3.30-3.19( m,2H,-CH2NH-),2.42(m,2H),2.19(m,4H),2.15(s,9H),2.07(m,2H),2.05(s,9H,2.01(s,9H),1.96(s,9H),1.23(s,3H).HRMS(ESI)m / z,C112 H 165 N9O 49 ,(MH + ) / 2, theoretical value: 1209.27 measured value: 1209.83.

[0120] The solid support of the conjugate molecule (603C) was prepared by attaching the conjugate molecule (603B) to the solid support according to the following process:

[0121]

[0122] The conjugate hemisuccinate (603B) (50 mg, 0.021 mmol) and 2-(7-azabenzotriazole)-N,N,N′,N′-tetramethyluronium hexafluorophosphate (10 mg, 0.026 mmol) were dissolved in 1.25 mL of anhydrous acetonitrile at room temperature. N,N-Diisopropylethylamine (10 μL) was added to the reaction solution. Once all reagents were dissolved, 125 mg of long-chain aminoalkane glass frit (500°A, native lcaa-CPG, Chemgenes, USA) was added to the reaction solution. The solid and liquid phases were stirred at 300 rpm at room temperature. After the reaction was continued for 2 hours, the residual liquid was filtered, and the long-chain aminoalkane glass frit solid support was washed three times with acetonitrile (3 × 1 mL). A 10% (v / v) solution of capping reagent A (acetic anhydride) in tetrahydrofuran and 0.5 mL of capping reagent B (a mixture of N-methylimidazole in pyridine and acetonitrile at a concentration of 15:10:75, v / v / v) were mixed with long-chain aminoalkane glass sand and stirred at room temperature for 1 hour. The reaction solution was filtered, and the long-chain aminoalkane glass sand solid support was rinsed three times with acetonitrile and dried under reduced pressure for 2 hours using a vacuum pump. This resulted in a glass sand solid support (603C, 130 mg). 8.3 mg of the long-chain aminoalkane glass sand 603C solid support was weighed and added to 100 mL of a 3% (v / v) trichloroacetic acid solution in dichloromethane. The mixture was stirred for 30 seconds and allowed to stand for 1 minute. The supernatant was taken and the visible light absorption was measured at 498 nm. The absorbance was 0.309, and the loading of conjugate 603C (ie, the loading of (603B) on CPG) was calculated to be 53.25 μmol / g.

[0123] Preparation of siRNA sense and antisense sequences (preparation of siRNA drugs)

[0124] According to the phosphoramidite solid phase synthesis method, nucleoside monomers are connected one by one in the 3'-5' direction according to the above sequence order. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, and oxidation.

[0125] Solid phase synthesis reagent preparation :

[0126] The deprotection reagent is a 3% v / v solution of trichloroacetic acid or dichloroacetic acid in dichloromethane. The nucleoside monomer is dissolved in anhydrous acetonitrile at a concentration of 0.05M-0.1M, and a small amount of 3A° molecular sieves is added for anhydrous treatment. The coupling activator is 5-ethylthio-1H-tetrazole in anhydrous acetonitrile at a concentration of 0.25M or 0.45M. Other activators include 1H-tetrazole, 5-benzylthio-1H-tetrazole, or 4,5-dicyanoimidazole. Capping reagent A is a 10% v / v solution of acetic anhydride in tetrahydrofuran. Capping reagent B is a mixture of N-methylimidazole in pyridine and acetonitrile at a concentration of 15:10:75 v / v / v. The oxidizing reagents were iodine and pyridine solutions (0.05 M, 95 wt% pyridine in water). The sulfiding reagent was N-(N-(dimethylaminomethylidene)amino)-3H-1,2,4-dithiazoline-3-thione) at a concentration of 0.05 M in pyridine / acetonitrile (2:3, v / v). The cleavage and deprotection reagent was 28 wt% concentrated ammonia.

[0127] Among them, the solid phase carrier for solid phase synthesis of nucleotides is a commercially available general solid phase carrier ( HLUnyLinker TM 300, or 500°A, native lcaa-CPG, manufacturer Chemgenes, USA).

[0128] Steps of solid phase synthesis :

[0129] On the synthesizer, a 4,4'-dimethoxytrityl protecting group on the solid support or the nucleoside monomer attached to the support is mixed with a solution of trichloroacetic acid in dichloromethane (3%, v / v) at a molar ratio of 1:30. Incubate the solid phase reaction at room temperature for 1.5 minutes. Repeat this process three times. Stop adding the deprotection solution when the eluate from the solid support turns from red to colorless. After repeated washing with anhydrous acetonitrile, the nucleoside monomer and the activator (coupling activator, 5-ethylthiotetrazolyl) are added (the ratio of the nucleoside monomer and the activator (molar ratio is 1:20), and the molar ratio of the solid phase support and the nucleoside monomer is 1: (5-6). The reaction time of the reagent and the solid phase at room temperature is 3-4 minutes for one cycle. After two cycles, the reaction is stopped. After washing with anhydrous acetonitrile, the oxidizing reagent solution is added, and the molar ratio of the solid phase support and the oxidizing agent is 1:6. The reaction time of the oxidizing reagent and the solid phase support at room temperature is about 2 minutes, and the operation is repeated twice. After the coupling reaction, if a sulfidation reaction step is required, a sulfiding reagent solution is added, and the molar ratio of the solid phase support and the sulfiding agent is 1:6. The reaction time of the oxidizing reagent and the solid phase support at room temperature is about 4-5 minutes, and the operation is repeated twice. times. Capping protection reaction, add capping reaction reagent, the molar ratio of solid phase carrier and capping reagent is 1:80. The reaction time of capping reagent and solid phase carrier at room temperature is about 1-2 minutes, and the operation is repeated twice. The above deprotection, coupling, oxidation, and capping steps are cycled until the coupling of the last nucleotide is completed. The solid phase carrier carrying the sense chain or antisense chain of the nucleic acid sequence is transferred to a small glass bottle, 28% ammonia solution is added, and the glass lid is screwed tightly to seal. At a temperature of 55°C, the base protecting groups in the sense chain or antisense chain are hydrolyzed and removed, and the sense chain or antisense chain is hydrolyzed and separated from the solid phase carrier. The reaction lasts for 16 hours. The obtained small nucleic acid sequence chain solution is separated from the solid phase carrier by filtration. After concentration, a crude product of the small nucleic acid sequence chain is obtained.

[0130] Purification and desalting by preparative high pressure liquid chromatography

[0131] Small nucleic acids were purified using a preparative anion exchange chromatography column (Source 15Q) by gradient elution with NaBr. Mobile phase A: 20 mM sodium phosphate (pH 8.0), mobile phase B: 20 ​​mM sodium phosphate (pH 8.0), 1 M sodium bromide in 10% acetonitrile in water. The column temperature was 65°C. The flow rate was 10 mL / min. The elution gradient started with mobile phase A, followed by an increase in mobile phase B from 0% to 20% over 12 minutes. Over the next 15 minutes, mobile phase B was increased from 20% to 50%. The product eluate was collected, analyzed, and combined. Desalting was performed using a reversed-phase chromatography purification column or by dialysis. Purified small nucleic acids were obtained after concentration and freeze-drying. The purity of the synthesized sense and antisense chains was tested by anion exchange liquid chromatography (AEX-HPLC), and the molecular weight of the entire sequence was identified and analyzed by reversed-phase liquid chromatography-mass spectrometry (LC-MS). The measured molecular weights were consistent with the theoretical values, confirming the synthesized nucleic acid sequence.

[0132] annealing

[0133] The synthesized sense chain (S chain) and antisense chain (AS chain) were mixed in an equimolar ratio in normal saline for injection, heated at 90°C for 5 minutes, then slowly cooled to room temperature, and stored in a refrigerator at 4°C for 12 hours to form a double-stranded structure through hydrogen bonding, thereby obtaining siRNA drugs 16-20 (nucleotide sequences and modification methods are shown in Table 3).

[0134] Table 3

[0135] serial number Sense strand sequence (5'-3') Antisense strand sequence (5'-3') 16 <![CDATA[ G s A s CCUU Gf A Gf G Cf AUACUUCA -TriGalNAc(17)]]> <![CDATA[ U sGfs AA Gf U Of UGCCU Cf. A Of GGUC s U s U (18+)]]> 17 <![CDATA[ C s U s AGGA Gf G Cf U Gf UAGGCAUAAA -TriGalNAc(25)]]> <![CDATA[ U sUfs U Of U Gf CCUACAG Cf C Ugh CCUAG s U s U (26+UU)]]> 18 <![CDATA[ A s C s UAGG Af G Gf C Uf GUAGGCAUAA -TriGalNAc(21)]]> <![CDATA[ U sUfs A Uf G Cf CUACAGC Cf U Cf CUAGU s U s U (22+UU)]]> 19 <![CDATA[ G s A s CCGA Cf C Uf U Gf AGGCAUACUU -TriGalNAc(15)]]> <![CDATA[ A sAfs G On A On GCCUCAA Gf G On CGGUC s U s U (16+UU)]]> 20 <![CDATA[ A s G s GAGG Cf U Gf U Af GGCAUAAAUU -TriGalNAc(27)]]> <![CDATA[ A sAfs U Ugh U Of UGCCUAC Of G Cf. CUCCU s U s U (28+UU)]]>

[0136] In the sequences shown in Table 3, a lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a 2'-fluorine-modified nucleotide (i.e., the 2'-OH group of the pentose sugar of the nucleotide is replaced by fluorine); a lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are connected by a phosphorothioate diester bond (i.e., the non-bridging oxygen atom in the phosphodiester bond is replaced by a sulfur atom); and underlined nucleotides represent nucleotides whose 2'-hydroxyl group is replaced by a methoxy group. TriGaNAc represents the targeting group and linker group for targeted delivery (i.e., the portion of formula (603) other than Nu).

[0137] The sequence and structure of the synthesized siRNA drug were confirmed by liquid chromatography-mass spectrometry (LC-MS / MS). The modified siRNAs shown in Table 3 possess a more stable nucleic acid structure, with high base pairing specificity and affinity. Furthermore, these modified nucleic acids exhibited superior in vivo inhibitory effects and were able to further reduce the immunogenicity of the nucleic acids described herein.

[0138] (ii) 4-6 week old C5BL / 6 male mice were injected with 1×1011 vg rAAV-1.3HBV (Beijing Weitongda Biotechnology Co., Ltd.), HBV DNA greater than 10 5 Mice were randomly divided into groups based on body weight and injected with 3 mg / kg siRNA 16-20 (dosage calculated as siRNA only) on days 0, 2, and 4. Serum was collected on days 0, 10, 17, and 30 for measurement of serum HBsAg and HBeAg concentrations. Serum HBsAg and HBeAg concentrations were measured using a Hepatitis B Surface Antigen Assay Kit and a Hepatitis B E Antigen Assay Kit (Mike Biotech Co., Ltd.) according to the manufacturer's recommendations. Figure 2 The effect of siRNA in reducing serum HBsAg in rAAV8-1.3HBV mice is shown. Figure 3 The effect of siRNA in lowering serum HBeAg in rAAV8-1.3HBV mice is shown.

[0139] (III) Male HBV transgenic mice aged 4-6 weeks (Beijing Weitongda Biotechnology Co., Ltd.) were randomly divided into groups according to body weight and HBV DNA copy number. Different doses of siRNA 17 (dosage calculated as siRNA only) were injected on day 0. Serum was collected on day 7 for measurement of serum HBsAg and HBeAg concentrations. Serum HBsAg and HBeAg concentrations were measured using a Hepatitis B Virus Surface Antigen Assay Kit and a Hepatitis B Virus e Antigen Assay Kit (Mike Biotech Co., Ltd.), following the manufacturer's recommendations. Figure 4 It was shown that siRNA could dose-dependently reduce serum HBsAg in HBV transgenic mice. Figure 5 It was shown that siRNA could dose-dependently reduce serum HBeAg in HBV transgenic mice.

[0140] (IV) Male HBV transgenic mice aged 4-6 weeks (Beijing Weitongda Biotechnology Co., Ltd.) were randomly divided into groups based on body weight and HBV DNA copy number. SiRNA drug 17 (dosage calculated as siRNA only) was injected at 3 mg / kg on days 0, 7, and 14. Serum was collected on days 0, 10, 14, 21, 28, 42, and 49 for measurement of serum HBsAg concentration. Serum HBsAg concentration was measured using a Hepatitis B Virus Surface Antigen Assay Kit (Mike Biotech Co., Ltd.) according to the manufacturer's recommendations. Figure 6 It was shown that siRNA can reduce serum HBsAg in HBV transgenic mice for a long time.

[0141] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0142] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as disclosed in the present invention and fall within the scope of protection of the present invention. SEQUENCE LISTING <110> Synerk Biotech Limited <120> Nucleic acid targeting hepatitis B virus and use thereof <130> I66085SNKB-CJ <150> 202011455423.4 <151> 2020-12-10 <160> 31 <170> PatentIn version 3.5 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 1 ucaagguaug uugcccguu 19 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 2 aacgggcaac auaccuuga 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 3 gcccguuugu ccucuaauu 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 4 aauuagagga caaacgggc 19 <210> 5 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 5 ccucuaauuc caggauccu 19 <210> 6 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 6 aggauccugg aauuagagg 19 <210> 7 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 7 ccaaaccuuc ggacggaaa 19 <210> 8 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 8 uuuccguccg aagguuugg 19 <210> 9 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 9 ucagugguuc guagggcuu 19 <210> 10 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 10 aagcccuacg aaccacuga 19 <210> 11 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 11 ccaagucugu acagcaucu 19 <210> 12 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 12 agaugcugua cagacuugg 19 <210> 13 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 13 gcgggacguc cuuuguuua 19 <210> 14 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 14 uaaacaaagg acgucccgc 19 <210> 15 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 15 gaccgaccuu gaggcauacu u 21 <210> 16 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 16 aaguaugccu caaggucggu c 21 <210> 17 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 17 gaccuugagg cauacuuca 19 <210> 18 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 18 ugaaguaugc cucaagguc 19 <210> 19 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 19 acuaggaggc uguaggcau 19 <210> 20 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 20 augccuacag ccuccuagu 19 <210> 21 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 21 acuaggaggc uguaggcaua a 21 <210> 22 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 22 uuaugccuac agccuccuag u 21 <210> 23 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 23 cuaggaggcu guaggcaua 19 <210> 24 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 24 uaugccuaca gccuccuag 19 <210> 25 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 25 cuaggaggcu guaggcauaa a 21 <210> 26 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 26 uuuaugccua cagccuccua g 21 <210> 27 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 27 aggaggcugu aggcauaaau u 21 <210> 28 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 28 aauuuaugcc uacagccucc u 21 <210> 29 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 29 gcaccagcac caugcaacuu u 21 <210> 30 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> The sequence is synthesized <400> 30 aaaguugcau ggugcuggug c 21 <210> 31 <211> 3182 <212> DNA <213> Hepatitis B virus <400> 31 ctccacaacc ttccatcaaa ctctgcaaga tcccagagtg agaggcctgt atttccctgc 60 tggtggctcc agttcaggaa cagtgaaccc tgttccgact actgcctctc ccatatcgtc 120 aatcttctcg aggattgggg accctgtgct gaacatgaag aacatcacat caggattcct 180 aggacccctg ctcgtgttac aggcggggtt tttcttgttg acaagaatcc tcacaatacc 240 gcagagtcta gactcgtggt ggacttctct caattttcta gggggaacca ccgtgtgtct 300 tggccaaaat tcgcagtccc caacctccaa tcactcacca acctcctgtc ctccaacttg 360 tcctggttat cgttggatgt gtctgcggcg ttttatcatc ttcctcttca tcctgctgct 420 atgcctcatc ttcttgttgg ttcttctgga ctatcaaggt atgttgcccg tttgtcctct 480 gattccagga tcttcaacca ccagcacggg accatgcaga acctgcacga ctcctgctca 540 aggaacctct atgtatccct cctgttgctg taccaaacct tcggacggaa attgcacctg 600 tattcccatc ccatcatctt gggctttcgg aaaattccta tgggagtggg cctcagcccg 660 tttctcctgg ctcagtttac tagtgccatt tgttcagtgg ttcgtagggc tttcccccac 720 tgtttggctt tcagttatat ggatgatgtg gttttggggg ccaagtctgt ccagcatctt 780 gagtcccttt ttaccgctgt taccaatttt cttttgtctt tgggtgtaca tttaaaccct 840 aacaaaacaa aaagatgggg ttactcttta cattttatgg gctatgtcat tggatgtcat 900 gggtccttgc cacaagatca catcaaacaa aaaatcacag aatgctttag aaaacttcct 960 gttaacaggc ctattgattg gaaagtatgt caacgtattg tgggtctttt gggttttgct 1020 gcccctttta cacaatgtgg ttatcctgct ttaatgcctt tgtatgcctg tattcaatct 1080 aggcaggctt tcactttctc gccaacctac aaggcctttc tgtgtaaaca atacctgaac 1140 ctttaccccg ttgcccggca acggccaggt ctgtgccaag tgtttgctga cgcaaccccc 1200 actggctggg gcttggtcat gggccatcag cgcatgcgtg gaacctttca ggctcctctg 1260 ccgatccata ctgcggaact cctagccgct tgttttgctc gcagcaggtc tggagcaaac 1320 attctcggga cagataactc tgttgttctc tcccgcaaat atacatcatt tccatggctg 1380 ctaggctgtg ctgccaactg gatcctgcgc gggacgtcct ttgtttacgt cccgtcagcg 1440 ctgaatcccg cggacgaccc gtctcggggc cggttgggac tctatcgtcc cctcctccgt 1500 ctgccgtttc gaccgaccac ggggcgcacc tctctttacg cggactcccc gtctgtgcct 1560 tctcatctgc cggaccgtgt gcacttcgct tcacctctgc acgtcgcatg gagaccacct 1620 tgaaagttca tcaatgcttg cccaaggtct tacataagag aactcttgga ctctctgcaa 1680 tgtcaacgac cgaccttgag gcatacttca aagactgttt gtttaaagac tgggaggatt 1740 tgggggagga gcttagatta atgatctttg tactaggagg ctgtaggcat aaattggtct 1800 gcgcaccagc accatgcaac tttttcacct ctgcctaatc atctcttgtt catgtcctac 1860 tgttcaagcc tccaagctgt gacttgaacg gatatgatgc atggacattg accttataa 1920 agaatttgga gcttctgtgg agttactctc gttttgcct gctgacttct ttccttcagt 1980 acgggatctt ctagataccg ccacagctct atacgggac gccttagagt ctcctgaaca 2040 ttgttcacct caccatacag cactcaggca agcaattctt tgctgggggg aattaatgac 2100 tctagctacc tgggtgggtg tgaatttgga agatcaagca tctagggacc aagtagtcag 2160 ttatgtcaac actaatatgg gcctaaagtt cagacaatta ttgtggtttc acgtttcttg 2220 tctcatgttt ggaagacaaa cggtcataga atatttggtg tctttcggag tgtggattcg 2280 cactcctcca gcttatagac caccaaatgc ccctatctta tcaacttc cggagactac 2340 tgttattaga caacgaggca ggtcccctag aacaagaact ccctcgcctc gcagacgaag 2400 gtctaaatcg ccgcgtcgca gaagatctca atctcgggaa cctcaatgtt agtattcctt 2460 ggactcataa ggtgggaaac tttacggggc tttattcttc tactgtgcct gtctttaatc 2520 cacattggaa aacgccctct tttcctaata tacatttaca tcaagacatt atcaaaaaat 2580 gtgaacaatt cgtaggccct ctcacagtca atgagaaaag aagactaaaa ttggttatgc 2640 ctgctaggtt ttatccaaat ggtaccaaat atttgccatt agataagggt attaaacctt 2700 attatccaga acatctagtt aatcattact tccaaaccag acattattta cacactctat 2760 ggaaggcggg tatattatat aagagagaaa caacacatag cgcctcattt tgtgggtcac 2820 catattcttg ggaacaagag ctacagcatg gggcagaatc tttccaccag caatcctctg 2880 ggattctttc ccgaccacca gttggaccca gccttcagag caaacaccgc aaatccagat 2940 tgggacttca atcccaacaa ggacacctgg ccagacgcca acaaggtagg agctggagca 3000 ttcgggctgg gattcacccc acctcacgga ggcctgttgg ggtggagccc tcaggctcag 3060 ggcatactac aaaccttgcc agcaaatccg cctcctgcct ctaccaatcg ccagtcagga 3120 agggagccga ctccgctgtc accacctttg agaaacactc atcctcaggc catgcagtgg 3180 aa 3182

Claims

1. A nucleic acid, which comprises a sense strand and an antisense strand, characterized in that, the nucleic acid is selected from siRNA-13 with a sense strand base sequence of SEQ ID NO: 25 and an antisense strand base sequence of SEQ ID NO: 26, and the modifications on the nucleotides are as follows: 5’- C s U s AGGA Gf G Cf U Gf UAGGCAUAAA -3’ 5’- U sUfs U Af U Gf CCUACAG Cf C Uf CCUAG s U s U -3’ wherein, the lowercase letter f indicates that the nucleotide adjacent to the left of this letter f is a 2'-fluoro-modified nucleotide; the lowercase letter s indicates that the two nucleotides adjacent to the left and right of this letter s are connected by a phosphorothioate diester bond; the underlined nucleotide represents that the 2'-hydroxyl group of this nucleotide is replaced by a methoxy group.

2. A targeted drug delivery system, characterized in that, the targeted drug delivery system comprises a targeting group, a linking group, and the nucleic acid according to claim 1 linked to the targeting group through the linking group.

3. The targeted drug delivery system according to claim 2, wherein, the structure of the targeted drug delivery system is shown as follows: wherein, Nu is the nucleic acid.

4. A pharmaceutical composition, characterized in that, the pharmaceutical composition contains the nucleic acid according to claim 1 or the targeted drug delivery system according to claim 2 or 3 and a pharmaceutically acceptable carrier.

5. Use of the nucleic acid according to claim 1, the targeted drug delivery system according to claim 2 or 3, or the pharmaceutical composition according to claim 4 in the preparation of a drug for the treatment of hepatitis B.

Images