SNP markers regulating the expression of the high temperature response gene ATG7 in Crassostrea gigas and its application in identifying high temperature tolerant oysters

Abstract

The present invention belongs to the field of genetic engineering and genetic breeding, and specifically relates to a SNP marker for the expression regulation of the high temperature response gene ATG7 of long oysters and its application in identifying high temperature tolerant oyster individuals. The SNP marker is the 251st base in the sequence shown in SEQ ID NO:2, and the mutation type is T / C (trans-regulatory site Marker14346-48); or / and the 288th base in the sequence shown in SEQ ID NO:2, and the mutation type is C / T (trans-regulatory site Marker14346-85). The present invention provides two SNP markers significantly correlated with ATG7 gene expression, which has the advantage that the parent shellfish genotype can be identified before seed breeding, thereby improving the offspring's tolerance to high temperature environments. The SNP markers obtained in this study have high credibility and stable results.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and genetic breeding, and specifically relates to an expression regulation SNP marker of a high temperature response gene ATG7 of an oyster and an application thereof in identifying high temperature tolerant oyster individuals. Background Art

[0002] Oysters are globally distributed shellfish, distributed in Asia, Europe, America, and Africa. They are also an important economic species, accounting for 25% of marine aquaculture production in my country. However, since the middle of the last century, large-scale summer deaths have occurred worldwide. Many scholars believe that this phenomenon may be related to the increasingly severe global climate change, and temperature is an important influencing factor. High temperatures can make organisms vulnerable, reduce the immunity of oysters, and make oysters more susceptible to death. Therefore, determining the high temperature regulation mechanism of oysters and how to improve the oysters' ability to resist high temperatures have become urgent problems that the industry needs to solve.

[0003] The long oyster and the Fujian oyster are two sister subspecies that are evolutionarily close. They are also dominant species and main cultivated species distributed along the coast of my country. The long oyster is distributed north of the Yangtze River estuary in my country, while the Fujian oyster is distributed south of the Yangtze River estuary in my country. There are huge differences in the habitat environment between the two, especially the difference in the annual average sea surface temperature can reach 6.6℃, and the difference in the annual average air temperature is as high as 8.7℃. The difference in latitudinal distribution between the two reveals the difference in temperature adaptation between the two. The Fujian oyster has a higher heat stress survival rate, Arrhenius temperature and Q 10 The research team previously constructed a backcross F2 family of the long oyster and the Fujian oyster, used a simplified genome to type 106 offspring individuals, and constructed a high-density genetic map: the above figure has 1,694 markers, the average distance between markers is 0.8cM, and the genome coverage is 98.7%.

[0004] Studies have shown that the genes that respond to high temperature stress in organisms are mainly genes involved in cell homeostasis and energy balance. The research team previously conducted a selection site analysis on two wild long oyster populations with genetic differentiation and population structure in the Bohai Sea and the South Yellow Sea. The results showed that the Fst value of the ATG7 gene was significantly greater than the overall Fst mean, and was strongly selected. Although studies have reported that the ATG7 gene is related to the differentiation of high temperature resistant populations, the expression regulation mechanism of the ATG7 gene is still unclear. Summary of the invention

[0005] The purpose of the present invention is to provide an expression regulation SNP marker of a high temperature response gene ATG7 of an oyster and an application thereof in identifying high temperature tolerant oyster individuals.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A SNP marker for regulating the expression of a high temperature response gene ATG7 in a long oyster, wherein the SNP marker is the 251st base in the sequence shown in SEQ ID NO:2, and the mutation type is T / C (trans-regulatory site Marker14346-48); or / and the 288th base in the sequence shown in SEQ ID NO:2, and the mutation type is C / T (trans-regulatory site Marker14346-85).

[0008] The genotypes of the 251st and 288th bases are homozygous or heterozygous, and the two markers are very close to each other and completely linked, forming three haplotypes: CC, CT or TT.

[0009] A primer set for detecting a SNP marker, the primer set comprising a specific peripheral primer and a single base extension primer sequence,

[0010] Specific peripheral primers are

[0011] Marker14346-48 / 85-F:5'-GATGTAATTTCGTAGATGCGTCG-3';

[0012] Marker14346-48 / 85-R: 5'-AACCCCCTCCTCCCTCCTA-3';

[0013] and at least one of the following single base extension primer gene sequences,

[0014] Marker14346-48:

[0015] 5'-TTAGATCTCAATTTATAAGTTCTACTGGTA-3';

[0016] Marker14346-85:

[0017] 5'-TTTTTTTTTTGTATACAGGTAATACAATGTAGTTGTT-3'.

[0018] A kit for detecting the SNP marker comprises the primer set.

[0019] Application of SNP markers, primer sets or kits in identifying high temperature tolerant oyster individuals.

[0020] A method for identifying high temperature tolerant oyster individuals, comprising: detecting SNP markers in the oysters to be tested, then determining the genotype of the oysters to be tested, and then determining the dominant individuals of the high temperature tolerant oysters based on the genotype.

[0021] Specifically, the method comprises the following steps: extracting the genomic DNA of the oyster to be tested; using the primer set to perform PCR amplification with the genomic DNA of the oyster to be tested as a template, amplifying a fragment containing the target SNP site, and then performing typing detection on the SNP site using a single base primer, thereby identifying the genotype of the oyster to be tested and determining the high temperature tolerant oyster individual.

[0022] Determine the SNP site of the oyster to be tested and perform typing detection:

[0023] a. The extracted DNA sample is used as a PCR template, and the specific primers according to claim 3 are used for peripheral amplification; the peripheral primer sequences are:

[0024] Marker14346-48 / 85-F:5'-GATGTAATTTCGTAGATGCGTCG-3';

[0025] Marker14346-48 / 85-R: 5'-AACCCCCTCCTCCCTCCTA-3';

[0026] PCR reaction system:

[0027]

[0028] The reaction procedure for PCR amplification is:

[0029]

[0030] b. SNaPshot PCR: The PCR product was used as the template for SNaPshot PCR. After the product was purified, each site was detected. The sequence of the single-base primer was:

[0031] Marker14346-48:

[0032] 5'-TTAGATCTCAATTTATAAGTTCTACTGGTA-3';

[0033] Marker14346-85:

[0034] 5'-TTTTTTTTTTTGTATACAGGTAATACAATGTAGTTGTT-3'; Reaction system:

[0035]

[0036] Reaction procedure:

[0037]

[0038] c. Use the above amplification products to identify the genotype of each individual at two markers.

[0039] Advantages of the present invention:

[0040] The present invention predicts the expression level of high temperature response genes of individual oysters by detecting individual genotypes, can quickly screen oysters with different expression levels in large quantities, identify high temperature resistant oysters, and can be applied to breeding to detect parental genotypes before breeding through non-destructive sampling technology, and select individuals with target genotype combination as parents to carry out molecular marker-assisted selection breeding to breed high temperature resistant offspring. It can also be used as a potential marker for predicting the adaptability potential of oysters in the current global warming environment.

[0041] The present invention targets the high temperature response gene ATG7 gene, obtains two potential regulatory markers significantly correlated with its expression level, namely, upstream regulatory sites of ATG7: Marker14346-48 and Marker14346-85, and there is a transcription factor RNF1 about 3kb upstream of Marker14346-48 and Marker14346-85. Studies have reported that the transcription factor can regulate the expression of the ATG7 gene by binding to the promoter region of the ATG7 gene. It can be seen that the two regulatory sites can further regulate the expression of the ATG7 gene by mediating the expression of RNF1; and the best genotype combination is identified, wherein Marker14346-48 marks a superior genotype (TC) that is more favorable than a inferior genotype (TT) ATG7. The gene expression level was 33.8% higher; the expression level of the dominant genotype (CT) of Marker14346-85 was 31.0% higher than that of the inferior genotype (CC) of ATG7. In the future, the genotypes of individual oysters can be identified to screen individuals with different expression levels of ATG7 in response to high temperatures, and then high-temperature resistant oyster parents can be screened for oyster molecular breeding. It can also predict the adaptation potential of individual oysters under current climate change.

[0042] The advantage of screening for potential regulatory SNP sites of oyster high temperature response genes is that it can quickly screen oyster individuals with different expression levels in large quantities, and can identify the genotypes of oysters before breeding, screen high temperature resistant oyster parents, improve the high temperature resistance of offspring, and predict the adaptability of oysters under current climate change. The results of this study are reliable, the SNP sites obtained are highly credible, and the results are stable. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the frequency distribution histogram of ATG7 gene expression levels in 106 oyster individuals from the ZF2-3 family.

[0044] Figure 2 This is the eQTL location map of the ATG7 gene.

[0045] Figure 3 This is a correlation diagram between the ATG7 gene expression level and the genotypes of the regulatory sites Marker14346-48 and Marker14346-85.

[0046] 1. SEQ ID NO: 1 is the complete sequence of the ATG7 gene of Crassostrea gigas, sequence characteristic length: 1721bp, gene ATG7, gene ID: CGI_10025698.

[0047] 2. SEQ ID NO: 2 is the SNP marker sequence for ATG7 gene expression regulation, information sequence characteristic length: 501bp, scaffold 1750, sites 227035 and 227072, 250bp upstream and downstream of site 227035. DETAILED DESCRIPTION

[0048] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0049] The present invention uses the expression level of the high temperature response candidate gene ATG7 measured in 106 F2 progeny individuals of the backcross between the long oyster and the Fujian oyster to construct the genetic map, and then performs eQTL linkage positioning. For the located candidate regulatory SNP sites, the association analysis is performed in another backcross family between the long oyster and the Fujian oyster to verify the results.

[0050] The high-density genetic map above shows 1,694 markers, with an average distance between markers of 0.8 cM and a genome coverage of 98.7%.

[0051] The high temperature response gene: autophagy-related gene ATG7, the sequence of which is shown in NO.1.

[0052] The expression of ATG7 gene in each individual was detected in 106 offspring individuals of the F2 generation of the backcross between the long oyster and the Fujian oyster. Through the linkage analysis of genotype and gene expression, some trans-regulatory sites (trans-eQTLs) were located. The association analysis was verified in 95 offspring individuals of another F2 generation of the backcross between the long oyster and the Fujian oyster: the Marker14346-48 and Marker14346-85 loci were significantly correlated with the expression of the ATG7 gene (p<0.05), which can be used to screen oyster individuals resistant to high temperature.

[0053] The steps for screening SNP markers associated with high temperature response gene expression are:

[0054] Construction of experimental materials: Wild individuals of Crassostrea gigas and Fujian oysters were collected, and two simulated backcross F2 families of Crassostrea gigas and Fujian oysters were constructed: the male parent was a first-generation individual of Crassostrea gigas and Fujian oysters, and the female parent was wild Crassostrea gigas collected in Qingdao.

[0055] Genotyping: The whole genome typing of 106 progeny individuals of one of the proposed backcross families was performed using the reduced genome sequencing (GBS) and a high-density genetic map was constructed.

[0056] Determination of gene expression: The expression level of ATG7 gene was determined by qRT-PCR.

[0057] eQTL linkage analysis: MapQTL6 software was used to perform linkage analysis using interval mapping and multiple QTL mapping methods. The eQTL mapping map is attached. Figure 2 , and obtained two candidate trans-regulatory sites of the ATG7 gene, Marker14346-48 and Marker14346-85.

[0058] From the above, the oyster high temperature response gene: autophagy-related gene ATG7 can be obtained. Two expression regulatory sites of the ATG7 gene, Marker14346-48 and Marker14346-85, were identified by expression quantitative trait mapping (eQTL), and the correlation between these two sites and the expression of the ATG7 gene was further verified by association analysis in another independent population. A method for rapid genotype detection was developed for these two SNP sites. The expression level of the ATG7 gene of the dominant genotype (TC) of Marker14346-48 marker is 33.8% higher than that of the inferior genotype (TT); the expression level of the ATG7 gene of the dominant genotype (CT) of Marker14346-85 marker is 31.0% higher than that of the inferior genotype (CC). The two sites, Marker14346-48 and Marker14346-85, are completely linked and significantly correlated with the expression of the ATG7 gene. Subsequently, the genotypes of individual oysters can be identified to screen individuals with different expression levels of ATG7 in response to high temperatures, and then high-temperature resistant oyster parents can be screened for oyster breeding. In addition, it also provides basic research for predicting the adaptation potential of marine organisms under today's severe global climate change. The present invention provides two SNP markers that are significantly correlated with ATG7 gene expression, which has the advantage that the genotype of parent shellfish can be identified before seed breeding, thereby improving the offspring's tolerance to high temperature environments. The SNP markers obtained in this study are highly credible and the results are stable.

[0059] Embodiment 1:

[0060] The steps for screening SNP markers associated with high temperature response gene expression are:

[0061] A) Construction of experimental materials: Wild individuals of Crassostrea gigas and Fujian oysters were collected, and two F2 generation families ZF2-3 of Crassostrea gigas and Fujian oysters were constructed: the male parent was a first generation individual of Crassostrea gigas and Fujian oysters, and the female parent was a wild Crassostrea gigas collected in Qingdao.

[0062] B) Genotyping: The whole genome of 106 offspring of the family was typed using the reduced genome sequence (GBS) and a high-density genetic map was constructed. For detailed steps, please refer to the article by Wang et al. (Wang et al. 2016).

[0063] 1. Double digestion with restriction endonucleases 2. Design adapters and barcodes 3. Adapter annealing 4. Construction of sequencing libraries 5. Library quality inspection and sequencing 6. SNP typing of raw reads using Stack software 7. Construction of genetic map using JoinMap 4.0

[0064] C) Determination of gene expression: The expression of ATG7 gene was determined by qRT-PCR. The frequency distribution histogram of ATG7 gene expression in 106 oysters of ZF2-3 family is shown in Figure 1 .

[0065] D) eQTL linkage analysis: Linkage positioning was performed using MapQTL6 software by combining interval mapping and multiple QTL positioning. Cofactors were selected based on interval mapping, and multiple QTL positioning was performed by selecting cofactors multiple times until stable results were obtained. The LOD threshold was obtained by 3000 permutation tests. Sites exceeding the threshold at the chromosome level were considered to be regulatory sites significantly associated with the expression of the target gene, and two candidate trans-regulatory sites of the ATG7 gene, Marker14346-48 and Marker14346-85, were obtained. The eQTL positioning map is attached. Figure 2 .

[0066] Example 2

[0067] The above-obtained sites were used to verify their correlation with ATG7 gene expression:

[0068] A) Pretreatment of experimental samples: 95 individuals of the F2 generation of the proposed backcross between the long oyster and the Fujian oyster were collected. The male parent was the first generation of the long oyster and the Fujian oyster, and the female parent was the wild long oyster collected in Qingdao. The individuals were separated and cleaned, and then placed in 35℃ seawater for stress. After 3 hours, the gill tissue was taken and quickly stored in liquid nitrogen, and then stored at -80℃ for later use.

[0069] B) DNA extraction: DNA from 95 oysters was extracted according to the instructions of the Tiangen Marine Animal Tissue Genomic DNA Extraction Kit. DNA concentration was determined using a Nanodrop 2000 spectrophotometer. Quality was identified using 1.0% gel electrophoresis.

[0070] C) Genotyping: SNaPshot (multiple single base extension technology) was used to detect the genotype of each individual target site (Marker14346-48 and Marker-14346-85).

[0071] The target fragment was amplified by peripheral primers using the DNA template extracted above, and then the obtained PCR product was subjected to SNaPshot PCR using specific single-base primers to detect the genotype of the target site on a machine.

[0072] 1) Peripheral primers perform peripheral amplification on the SNP site:

[0073] Template: The extracted DNA sample was diluted to 20 ng / μl and used as PCR template;

[0074] Peripheral primer sequences:

[0075] Marker14346-48 / 85-F:5'-GATGTAATTTCGTAGATGCGTCG-3';

[0076] Marker14346-48 / 85-R: 5'-AACCCCCTCCTCCCTCCTA-3';

[0077] Reaction system:

[0078] Components volume DNA polymerase 22μl Forward primer 1μl Reverse primer 1μl Template DNA 1μl Total 25μl

[0079] Reaction procedure:

[0080]

[0081] 2) Use specific primers to detect the SNP site: SNaPshot PCR: In this reaction system, the primer stops after extending one base.

[0082] Template: The above PCR products were purified and used as reaction templates for SNaPshot PCR.

[0083] Single base extension primer sequence:

[0084] Marker14346-48:

[0085] 5'-TTAGATCTCAATTTATAAGTTCTACTGGTA-3';

[0086] Marker14346-85:

[0087] 5'-TTTTTTTTTTGTATACAGGTAATACAATGTAGTTGTT-3';

[0088] The single-base extension primer was diluted to 10 μM, and equal volumes of the single-base extension primers for each site were mixed to obtain Pooled Primers for SNaPshot PCR.

[0089] Reaction system:

[0090] Components volume DNA polymerase 2μl Mixed primers 2μl Purified PCR product 1μl Total 5μl

[0091] Reaction procedure:

[0092]

[0093] 3) 3730 Sequencer Capillary Electrophoresis: Identify the genotype of each individual in 2 marker reaction systems:

[0094] Components Volume (μl) HiDi(Formamide) 9.09 GS120LIZ (Special Molecular Ruler) 0.91 SNaPshot Products 1 Total 11

[0095] After adding each component in sequence according to the above system, pre-denaturation was performed by heating at 95°C for 5 minutes, and capillary electrophoresis was performed on a 3730 sequencer after cooling at -20°C.

[0096] Results Gene mapper 4.1 software was used to analyze accurate site data, and genotyping was performed according to the corresponding peaks of the SNP sites; the genotypes of each offspring individual of the pseudo-backcross family ZF of the long oyster and the Fujian oyster were obtained. The typing results are shown in Table 1 below.

[0097] Table 1

[0098]

[0099] D) RNA extraction: RNA was extracted using Tiangen RNAprep pure Tissue Kit. DNA concentration was determined using Nanodrop2000 spectrophotometer. Quality was identified using 1.0% gel electrophoresis.

[0100] E) Determination of ATG7 gene expression:

[0101] Quantitative PCR: Quantitative PCR primers were designed based on the sequence of ATG7 gene, and the experiment was carried out using the SYBR fluorescent quantitative kit of TaKaRa Company of Japan. The primer sequence is:

[0102] ATG7-F: 5'-CACTGGACACCCCTGAAC-3'

[0103] ATG7-R: 5'-GCAACAAAGAAACCCTGAT-3'

[0104] Reaction system:

[0105] Reagents Volume (μl) 2×SYBR Premix Ex Taq 10 Forward primer 0.4 Reverse primer 0.4 DyeⅡ 0.4 Dilute cDNA template 20 times 2 DEPC water 6.8 Total 20

[0106] Reaction procedure:

[0107] stage temperature time Number of cycles Pre-denaturation 95℃ 30s 1 transsexual 95℃ 5s 40 Annealing extension 60℃ 30s 40 Insulation 4℃ -- --

[0108] The oyster elongation factor (CgEF) was used as the internal reference gene, and the gene expression level was normalized by the internal reference. -△△CT Methods The relative expression level of the target gene was analyzed to obtain the ATG7 gene expression level of each progeny individual of the pseudo-backcross family ZF of the long oyster and the Fujian oyster. The relevant information is shown in Table 2 below.

[0109] Table 2

[0110] Maximum Minimum average value Standard Deviation ATG7 gene expression 3.815 0.05755 0.9341 0.8610

[0111] E) Association analysis: The genotype data of the 95 oyster individuals in the ZF family obtained above at the Marker14346-48 and Marker14346-85 loci and the ATG7 gene expression data obtained above were imported into Graph Primer software for association analysis. The results of the Mann-Whitney test showed that the Marker14346-48 locus was significantly correlated with the expression of the ATG7 gene (p<0.0001), and the expression level of the ATG7 gene was: TC>TT; the Marker14346-85 locus was significantly correlated with the expression of the ATG7 gene, and the expression level was: CT>CC. The two markers were linked to identify three haplotypes: CC, CT, and TT. Haplotype association analysis showed that the three haplotypes were significantly correlated with the expression of the ATG7 gene (p<0.001). The results are shown in Tables 3, 4 and Figure 2 .

[0112] Table 3

[0113]

[0114]

[0115] Table 4

[0116] Haplotype quantity Beta Standard error R2 T-value P-value CT 69 -0.446 0.085 0.265 -5.238 1.40E-04 CC 43 0.9 0.168 0.274 5.36 8.62E-07 TT 44 0.861 0.171 0.249 5.028 3.20E-06

[0117] From the above Table 1 and Figure 2It can be seen that both the Marker14346-48 and Marker14346-85 regulatory sites are significantly correlated with the expression of the ATG7 gene: the dominant genotype of the Marker14346-48 site is TC, corresponding to a high expression of the ATG7 gene (i.e., the dominant genotype (TC) of the Marker14346-48 marker is 33.8% higher than the genotype (TT) ATG7 gene expression); the dominant genotype of the Marker14346-48 site is CT, corresponding to a high expression of the ATG7 gene (i.e., the dominant genotype (CT) of the Marker14346-85 marker is 31.0% higher than the genotype (CC) ATG7 gene expression). The two markers are completely linked, and three haplotypes were identified, all of which are significantly correlated with the expression of the ATG7 gene.

[0118] Example 3

[0119] The above-mentioned two regulatory sites, Marker14346-48 and Marker14346-85, were significantly correlated with the expression of the ATG7 gene to further verify the relationship between the two marker genotypes and high temperature tolerance: the above two sites were verified in Fujian oysters (high temperature tolerance) and long oysters (high temperature sensitivity) to verify their relationship with high temperature tolerance:

[0120] A) Preparation of experimental samples: 50 wild Fujian oysters and Crassostrea gigas individuals were collected in Xiamen and Qingdao for subsequent experiments.

[0121] B) DNA extraction: DNA from these 100 oysters was extracted according to the instructions of the Tiangen Marine Animal Tissue Genomic DNA Extraction Kit. DNA concentration was determined using a Nanodrop 2000 spectrophotometer. Quality was identified using 1.0% gel electrophoresis.

[0122] C) Genotyping: SNaPshot (multiple single base extension technology) was used to detect the genotype of each individual target site (Marker14346-48 and Marker-14346-85).

[0123] D Difference analysis: The chi-square test was used to test the differences in the genotypes of the two loci between the long oyster and the Fujian oyster, and then to establish the association between the genotype and high temperature tolerance. The results showed that the genotype frequencies of the two loci Marker14346-48 and Marker-14346-85 were significantly different between the long oyster and the Fujian oyster (P<0.01): the dominant genotype (TC) of the Marker14346-48 locus and the dominant genotype (CT) of the Marker14346-85 locus were significantly higher in the Fujian oyster than in the long oyster (see the table below, 0 represents the base type consistent with the reference genome, 1 represents the mutant base type).

[0124]

[0125] As can be seen from the above, the genotype of oyster individuals can be identified through the SNP markers of the present invention to screen individuals with different expression levels of ATG7 in response to high temperature, and then screen high temperature resistant oyster parents for oyster breeding. In addition, it also provides basic research for predicting the adaptation potential of marine organisms under today's severe global climate change. The present invention provides two SNP markers that are significantly correlated with ATG7 gene expression, which has the advantage that the genotype of parent shellfish can be identified before seed breeding, thereby improving the offspring's tolerance to high temperature environments. The SNP markers obtained in this study are highly credible and the results are stable.

[0126] Sequence Listing (1) No. 1 Information sequence characteristic length: 1721 bp

[0127] Type: Nucleic Acid

[0128] Chain type: Single chain

[0129] Topology:

[0130] Molecule type: DNA

[0131] Source: Long Oyster

[0132] Sequence Description:

[0133] GATGGAACAGTTTCTGCAAGCTTATGACACATTCCAAGATGCTCAT CCAACATATCAGGGTTTCTTTTGCTGTCTTCTTTCTAAAGGGAACATTGTAATTGAGGATGTTAAAACATATGAACAAGTTTGAAAATACTC AGGAGAGTGTCATTTCAACAGGTGTACTTTGGATTCTGTGATCCCAGTAATATTGAGGACTATCCAGGTCTGCCTTAGGAATTTCCTGATG TTGATATCCTATCATTGGAAGGGAGACCTGCGAGGTGTAAATGTACTGTGTTTGCGAGATAGGATGGATCGACGGGACTCGAGATATATCAC ACAGTCTTCTGCTTTCCCTTAATGTCCCGGATATTAGGAATGTGCCAGAATGTTCCAAAGTGTGTGGGTGGGGAAAATGAAAATGAAACAAA AGCTGGCTCCAAGATTTGTTAATCTCAGTGCTAGCATGGACCCCAGCCTCAGCTTGTGACCTCAATCTAAAAGCTTATGAGAGCTTCTCCCAGAGCTTGACCTTTATATCAAGGACAA AATGTCTGCTGCTAGGAGCTGGAACTCTTGGATGTAATGTGGCAAGGTGTCTGATGGGCTGGGGGAGTAAGAACCATAACTCTGGTGGACAA TGGCCGCGTGTCTTTACTCTAACCCAGTACGCCAGTCCTTGTTTCAG TTTGAAGACTGTGTAAAGGGAGGTAAGCCAAAGCGGAGGCTGCTGCAGAGGCCATGAAAGATATTCCCTGGAGTGAATGCAAAAGGG TTGAGTTTATCCATTCCTATGCCTGGACATGCAGTACCTGAGAGTGCAATAGAGGGTGTGGAAGAGACGTTGAAACCCTCCAGGATCTGG TGAATTCTCATGATGCAGTGTTTTTACTGTTGGATACGCGGGAGAGCCGTTGGCTTCCTACATTGATGGCAGCAGAAAAACAAAAGATAGTGATATGCTCTGCCCTGGGCTTTGACACATATCTAGTGATGCGCCAC GGCGTGAGGTCAGACACAGAGGGAGCTGACCCTGCCCCCCTGTCCTCTTACAGCTCCATCCCCGGGGATCAGCTAGGCTGCTACTTCTGCA ATGATGTAGTGGCACCAGGGAATTCTTTGAAGGACCGTACTCTGG ACCAGCAGTGTACAGTATCCAGGCCGGGCATCTCCTACATGGCGTCCGCGCTCGCCGTAGAACTCCTTGTGTCCGTGCTCCAGCATCCAGAA CTAGGGAAAGCCCCGGCGGATACAAGCGCTAGTGATGAGCACCTG AGTAAAGACTTTGTCTGCCCCCTAGGGCTGGTCCCTCACCAGCAGATTCGATGCTTTGTGTCCCGCTTCCAGCAAGTGTTACCGGCCTGTAA GGCATTTGATAAATGTACAGCTTGTTCAAAGACTGTGATAGAACA GTTCCGACGGGACGGCTTTGACTTCCTGAGGCGGGCGTTCAATGACCCGTCCTACCTGGAGGATCTTACAGGGCTCACACAGATGCATCAG GAAACCCTCGACGCTGAGGTGTGGGGGTTCAGTGATGACGAGGAATGTAGCAGCATGGAAGTCTCCAGCTCTTGACCCAGTTTTAAATTGT GACCCAACTGAAGACTTTCATTTTTATTTTATTTATTTACCAATCAGACATTTATCAGTGTTATAAGCTTTTCATGGTATTACATGTAATGTACTTTTGTATTACATGTAATAAGTACATTGTAGC

[0134] Sequence listing (1) Information sequence characteristics of NO.2

[0135] Type: Nucleic acid

[0136] Strand type: Single-stranded

[0137] Topology:

[0138] Molecular type: DNA

[0139] Source: Long Oyster

[0140] Sequence Description:

[0141] AGTTAAATAAAACATCATTTAAATTCCAATTTTTGTGGATTGTGCG TTTTTTGCTTAATCATGGGGATGTAATTTCGTAGATGCGTCGGTTTTCAGTTTCAGTAAGGTAACAAACTCTTTCAAAATTTGTTTTCGTCGA GGATGTAAATTCGTGGGGAAGAGCTACCCACGAAGACAACGAAAATTGAGCCACCATGAATTCAAATTATTCCACAGTAATCAAGATCTCA ATTTATAAGTTCTACTGGTATAAAAAAAATGTATACAGGTAATACAATGTAGTTGTTCATGGTTGTAGTCCAAGTCTTATTTCACCATCTTTC ACTCAAATGTATCGAACTGTACGCCATTGGCAAAACTTTGTTCTAATTCAAAACACTGGATGCACACTTCTTCTGTAGCTACATGTTGATCAATCAATGTTTACCACAATGCATCACTGCCCCTAATAGTTTCGTTGT AGGAGGGAGGAGGGGGTTCATTGCCCATGGCTGGTCGATG. Sequence Listing <110> Institute of Oceanology, Chinese Academy of Sciences <120> SNP markers regulating the expression of the high temperature response gene ATG7 in Crassostrea gigas and its application in identifying high temperature tolerant oysters <140> 2021114191979 <141> 2021-11-26 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1721 <212> DNA <213> Artificial Sequence <400> 1 gatggaacag tttctgcaag cttatgacac attccaagat gctcatccaa catatcaggg 60 tttctttgtt gctgtccttt ctaaagggaa cattgtaatt gaggatgtaa aacatatgaa 120 caagtttgaa aatactcagg agatgtcatt tcaacaggtg tactttggat tctgtgatcc 180 cagtaatatt gaggactatc caggctggcc tcttaggaat ttcctgatgt tgatatccta 240 tcattggaag ggagacctgc gaggtgtaaa tgtactgtgt ttgcgagata ggagtcgaga 300 cgggactcga gatatatcac acagtcttct gctttccctt aatgtcccgg atattaggaa 360 tgtgccagaa tgtccaaagt gtgtgggttg ggagaaaaat gaaaaacaaa agctggctcc 420 aagatttgtt aatctcagtg ctagcatgga ccccacaaga ctggcagcct cagctgttga 480 cctcaatcta aagcttatga gatggaggct tctcccagag cttgaccttg accttatatc 540 aaggacaaaa tgtctgctgc taggagctgg aactcttgga tgtaatgtgg caaggtgtct 600 gatgggctgg ggagtaagaa ccataactct ggtggacaat ggccgcgtgt cttactctaa 660 cccagtacgc cagtccttgt ttcagtttga agactgtgta aagggaggta agccaaaagc 720 ggaggctgct gcagaggcca tgaagaagat attccctgga gtgaatgcaa aagggttgag 780 tttatccatt cctatgcctg gacatgcagt acctgagagt gcaatagagg gtgtgaagaa 840 agacgttgaa accctccagg atctggtgaa ttctcatgat gcagtgtttt tactgttgga 900 tacgcgggag agccgttggc ttcctacatt gatggcagca gaaaaacaaa agatagtgat 960 atgctctgcc ctgggctttg acacatatct agtgatgcgc cacggcgtga ggtcagacac 1020 agagggagct gaccctgccc ccctgtcctc ttacagctcc atccccgggg atcagctagg 1080 ctgctacttc tgcaatgatg tagtggcacc agggaattct ttgaaggacc gtactctgga 1140 ccagcagtgt acagtatcca ggccgggcat ctcctacatg gcgtccgcgc tcgccgtaga 1200 actccttgtg tccgtgctcc agcatccaga actagggaaa gccccggcgg atacaagcgc 1260 tagtgatgag cacctgagta aagactttgt ctgcccccta gggctggtcc ctcaccagca 1320 gattcgatgc tttgtgtccc gcttccagca agtgttaccg gcctgtaagg catttgataa 1380 atgtacagct tgttcaaaga ctgtgataga acagttccga cgggacggct ttgacttcct 1440 gaggcgggcg ttcaatgacc cgtcctacct ggaggatctt acagggctca cacagatgca 1500 tcaggaaacc ctcgacgctg aggtgtgggg gttcagtgat gacgaggaat gtagcagcat 1560 ggaagtctcc agctcttgac ccagttttaa attgtgaccc aactgaagac tttcattttt 1620 attttattta tttaccaatc agacatttat cagtgttata agcttttcat ggtattacat 1680 gtaatgtact tttgtattac atgtaataag tacattgtag c 1721 <210> 2 <211> 501 <212> DNA <213> Artificial Sequence <400> 2 agttaaataa aacatcattt aaattccaat ttttgtggat tgtgcgtttt ttgcttaatc 60 atggggatgt aatttcgtag atgcgtcggt tttcagtttc agtaaggtaa caaactcttt 120 caaaatttgt tttcgtcgag gatgtaaatt cgtggggaag agctacccac gaagacaacg 180 aaaattgagc caccatgaat tcaaattatt ccacagtaat caagatctca atttataagt 240 tctactggta taaaaaaaat gtatacaggt aatacaatgt agttgttcat ggttgtagtc 300 caagtcttat ttcaccatct ttcactcaaa tgtatcgaac tgtacgccat tggcaaaact 360 ttgttctaat tcaaaacact ggatgcacac ttcttctgta gctacatgtt gatcaatcaa 420 tgtttaccac aatgcatcac tgcccctaat agtttcgttg taggagggag gagggggttc 480 attgcccatg gctggtcgat g 501 <210> 3 <211> 501 <212> DNA <213> Artificial Sequence <400> 3 agttaaataa aacatcattt aaattccaat ttttgtggat tgtgcgtttt ttgcttaatc 60 atggggatgt aatttcgtag atgcgtcggt tttcagtttc agtaaggtaa caaactcttt 120 caaaatttgt tttcgtcgag gatgtaaatt cgtggggaag agctacccac gaagacaacg 180 aaaattgagc caccatgaat tcaaattatt ccacagtaat caagatctca atttataagt 240 tctactggta caaaaaaaat gtatacaggt aatacaatgt agttgttcat ggttgtagtc 300 caagtcttat ttcaccatct ttcactcaaa tgtatcgaac tgtacgccat tggcaaaact 360 ttgttctaat tcaaaacact ggatgcacac ttcttctgta gctacatgtt gatcaatcaa 420 tgtttaccac aatgcatcac tgcccctaat agtttcgttg taggagggag gagggggttc 480 attgcccatg gctggtcgat g 501 <210> 4 <211> 501 <212> DNA <213> Artificial Sequence <400> 4 agttaaataa aacatcattt aaattccaat ttttgtggat tgtgcgtttt ttgcttaatc 60 atggggatgt aatttcgtag atgcgtcggt tttcagtttc agtaaggtaa caaactcttt 120 caaaatttgt tttcgtcgag gatgtaaatt cgtggggaag agctacccac gaagacaacg 180 aaaattgagc caccatgaat tcaaattatt ccacagtaat caagatctca atttataagt 240 tctactggta taaaaaaaat gtatacaggt aatacaatgt agttgtttat ggttgtagtc 300 caagtcttat ttcaccatct ttcactcaaa tgtatcgaac tgtacgccat tggcaaaact 360 ttgttctaat tcaaaacact ggatgcacac ttcttctgta gctacatgtt gatcaatcaa 420 tgtttaccac aatgcatcac tgcccctaat agtttcgttg taggagggag gagggggttc 480 attgcccatg gctggtcgat g 501

Claims

1. A primer set for detecting SNP markers regulating the expression of oyster high temperature response gene ATG7, characterized in that: The primer set consists of a specific peripheral primer and a single base extension primer. The specific peripheral primers are: Marker14346-48 / 85-F: 5'-GATGTAATTTCGTAGATGCGTCG-3'; and Marker14346-48 / 85-R: 5'-AACCCCCTCCTCCCTCCTA-3'; The single base extension primer is: Marker14346-48: 5'-TTAGATCTCAATTTATAAGTTCTACTGGTA-3'; and Marker14346-85: 5'-TTTTTTTTTTGTATACAGGTAATACAATGTAGTTGTT-3'; The SNP is located at position 251 in the sequence shown in SEQ ID NO: 2, and the mutation type is T / C; and the SNP is located at position 288 in the sequence shown in SEQ ID NO: 2, and the mutation type is C / T; The gene sequence of the gene ATG7 is shown in SEQ ID NO:

1.

2. A kit for detecting SNP markers regulating the expression of the oyster high temperature response gene ATG7, characterized in that: The kit comprises the primer set according to claim 1.

3. Use of the primer set according to claim 1 or the kit according to claim 2 in identifying high temperature tolerant oyster individuals; the oyster individuals are long oysters or Fujian oysters.

4. A method for identifying individuals of high temperature tolerant oysters, characterized in that: The oysters to be tested are subjected to the SNP marker detection of claim 1, and then the genotype of the oysters to be tested is determined, and then the dominant individual of the high temperature tolerant oysters is determined according to the genotype; wherein the dominant individual is the one with the genotype of TC at the 251st base of the sequence shown in SEQ ID NO: 2, and the dominant individual is the one with the genotype of CT at the 288th base; The oyster is a long oyster or a Fujian oyster.

5. The method for identifying high temperature tolerant oysters according to claim 4, characterized in that: The steps of the method are: 1) extracting genomic DNA from the oyster to be tested; 2) Using the specific peripheral primers described in claim 1, the genomic DNA of the oyster to be tested is used as a template for PCR amplification to amplify a fragment containing the target SNP site; using the single base extension primers described in claim 1 to perform typing detection on the SNP site, thereby identifying the genotype of the oyster to be tested and determining the high temperature tolerant oyster individual.

6. The method for identifying high temperature tolerant oysters according to claim 5, characterized in that: The step 2) is: a. The extracted DNA sample is used as a PCR template, and peripheral amplification is performed using the specific peripheral primers described in claim 1; the sequence of the specific peripheral primers is: Marker14346-48 / 85-F:5'-GATGTAATTTCGTAGATGCGTCG-3'; Marker14346-48 / 85-R:5'-AACCCCCTCCTCCCTCCTA-3'; PCR reaction system: ； The reaction procedure for PCR amplification is: ； b. SNaPshot PCR: The PCR product obtained in step a is used as a template for SNaPshot PCR. After the product is purified, the single base extension primer according to claim 1 is used to detect the SNP site; Reaction system: ； Reaction procedure: ； c. Use the amplified product obtained in step b to identify the genotype of each individual at the two markers.

Images