A method for improving nucleic acid amplification reactions and uses thereof
By adding sodium hexametaphosphate and other additives to the nucleic acid amplification reaction system, the problem of reduced amplification efficiency and specificity caused by non-specific reactions was solved, resulting in more efficient nucleic acid amplification.
Patent Information
- Application Number
- CN202110160935.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-02-05
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2041-02-05
AI Technical Summary
Existing nucleic acid amplification reactions suffer from non-specific reactions, leading to reduced synthesis of the target fragment, decreased specificity, and reduced amplification efficiency.
Sodium hexametaphosphate was added to the nucleic acid amplification reaction system, and optionally additives such as polydocaol, gelatin, single-strand binding protein and DNA mismatch repair protein were added to optimize the reaction conditions.
It improves the amplification efficiency and specificity of nucleic acid amplification reactions and promotes the synthesis of target fragments.
Smart Images

Figure CN114875124B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular biology. Specifically, the present application relates to a method for improving nucleic acid amplification reaction and its application. BACKGROUND
[0002] With the rapid development of biologically related industries and the large-scale application of new technologies, the diagnosis industry closely related to people's life and health has received more and more attention. In further promoting the progress of diagnostic technology, higher requirements are also put forward.
[0003] As one of the foundations of molecular diagnostic technology, PCR technology can exponentially amplify the target fragment in a short time and has a wide range of applications in diagnosis and research in medical diagnosis, etc. Although it has higher amplification efficiency and stronger specificity than other diagnostic technologies, with the continuous updating and iteration of technology, these advantages are facing more and more challenges. How to further improve the nucleic acid amplification reaction to apply it to more scenarios has become a problem that researchers need to solve urgently. SUMMARY
[0004] The present application aims to provide a method for improving nucleic acid amplification reaction and its application.
[0005] In some embodiments, the present application can include one or more of the following:
[0006] 1. A method for improving nucleic acid amplification reaction, wherein the method comprises the step of adding a template to a reaction system containing sodium hexametaphosphate.
[0007] 2. The method according to item 1, wherein the final concentration of sodium hexametaphosphate in the reaction system is 0.005-0.5 (w / v) %.
[0008] Optionally, the final concentration of sodium hexametaphosphate in the reaction system is 0.01-0.35 (w / v) %.
[0009] 3. The method according to any one of items 1-2, wherein the reaction system further contains at least any one of polycarbophil, gelatin, single-strand binding protein, and DNA mismatch repair protein.
[0010] 4. The method according to item 3, wherein,
[0011] the final concentration of polycarbophil in the reaction system is 0.005-0.25 (w / v) %.
[0012] Optionally, the final concentration of gelatin in the reaction system is 0.005-0.5 (w / v) %.
[0013] Optionally, the final concentration of the single-chain binding protein in the reaction system is 2-10 ng / μL;
[0014] Optionally, the final concentration of the DNA mismatch repair protein in the reaction system is 0.05-5 μg / μL.
[0015] 5. The method according to any one of items 1-4, wherein the reaction system further comprises DNA polymerase and Mg 2+ At least one of the following: dNTPs, primers, and buffer solutions.
[0016] 6. The method according to Project 5, wherein the DNA polymerase is a thermostable DNA polymerase.
[0017] 7. The method according to Project 1, wherein the nucleic acid amplification reaction can be, for example, a polymerase chain reaction.
[0018] 8. A composition for improving nucleic acid amplification reactions, wherein the composition is used to prepare the reaction system described in any one of items 1-7.
[0019] 9. A kit comprising the reaction system described in any one of items 1-7, or the composition described in item 8.
[0020] 10. The application of the method described in any one of items 1-7, the composition described in item 8, and the kit described in item 9 in nucleic acid amplification reactions. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the specific embodiments of this application or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0022] Figure 1 The image shows an agarose gel electrophoresis pattern of the amplification product after adding a single additive to a singleton PCR reaction system. Each group of six lanes was processed with a template amount of 10 pg / 100 pg / 1 ng and one replicate for each template gradient.
[0023] Figure 2 The agarose gel electrophoresis image shows the amplification products of multiplex PCR reaction system with two combinations of additives. Each group of three lanes was performed with one replicate well with template addition and NTC without template addition (no template control, the same below).
[0024] Figure 3The image shows agarose gel electrophoresis of amplification products after adding three different additives to a multiplex PCR reaction system. Each group of three lanes was processed with one replicate well for template addition and NTC without template addition. Detailed Implementation
[0025] Non-specific reactions may occur during nucleic acid amplification reactions, leading to reduced synthesis of the target fragment, decreased specificity, and / or reduced amplification efficiency. In some embodiments, the present invention provides an improved method for nucleic acid amplification reactions, including the step of adding a template to a reaction system containing sodium hexametaphosphate.
[0026] In some embodiments, the final concentration of sodium hexametaphosphate in the reaction system is 0.005-0.5 (w / v)%; in some embodiments, the final concentration of sodium hexametaphosphate in the reaction system is 0.01-0.35 (w / v)%; in some embodiments, the final concentration of sodium hexametaphosphate in the reaction system includes, for example, 0.005 (w / v)%, 0.01 (w / v)%, 0.05 (w / v)%, 0.1 (w / v)%, 0.15 (w / v)%, 0.2 (w / v)%, 0.25 (w / v)%, 0.3 (w / v)%, 0.35 (w / v)%, 0.4 (w / v)%, 0.45 (w / v)%, 0.5 (w / v)%, but is not limited thereto.
[0027] In some implementations, the reaction system further contains at least one of podocalcitonin, gelatin, single-stranded binding protein, and DNA mismatch repair protein.
[0028] In some embodiments, the source of the gelatin is not limited; in other embodiments, the gelatin is selected from bovine gelatin, fish gelatin, and / or combinations thereof.
[0029] In some embodiments, the final concentration of polycalool in the reaction system is 0.005-0.25 (w / v)%; in some embodiments, the final concentration of polycalool in the reaction system includes, for example, 0.005 (w / v)%, 0.01 (w / v)%, 0.05 (w / v)%, 0.1 (w / v)%, 0.15 (w / v)%, 0.2 (w / v)%, 0.25 (w / v)%, but is not limited thereto;
[0030] In some embodiments, the final concentration of gelatin in the reaction system is 0.005-0.5 (w / v)%; in some embodiments, the final concentration of gelatin in the reaction system includes, for example, 0.005 (w / v)%, 0.01 (w / v)%, 0.05 (w / v)%, 0.1 (w / v)%, 0.15 (w / v)%, 0.2 (w / v)%, 0.25 (w / v)%, 0.3 (w / v)%, 0.35 (w / v)%, 0.4 (w / v)%, 0.45 (w / v)%, 0.5 (w / v)%, but is not limited thereto;
[0031] In some embodiments, the final concentration of the single-chain binding protein in the reaction system is 2-10 ng / μL; in some embodiments, the final concentration of the single-chain binding protein in the reaction system includes, for example, 2 ng / μL, 3 ng / μL, 4 ng / μL, 5 ng / μL, 6 ng / μL, 7 ng / μL, 8 ng / μL, 9 ng / μL, 10 ng / μL, but is not limited thereto.
[0032] In some embodiments, the final concentration of the DNA mismatch repair protein in the reaction system is 0.05-5 μg / μL; in some embodiments, the final concentration of the DNA mismatch repair protein in the reaction system includes, for example, 0.05 μg / μL, 0.1 μg / μL, 0.125 μg / μL, 0.2 μg / μL, 0.5 μg / μL, 1 μg / μL, 1.5 μg / μL, 2 μg / μL, 2.5 μg / μL, 3 μg / μL, 4 μg / μL, 5 μg / μL, but is not limited thereto.
[0033] In some embodiments, the reaction system of the present invention further comprises one or more polymerases. Such polymerases can be any enzyme capable of replicating DNA molecules. In some embodiments, the reaction system may comprise a DNA-dependent DNA polymerase, an enzyme for reverse transcription (RNA-dependent DNA polymerase), and / or a combination of both types of enzymes. In some embodiments, a combination of DNA-dependent DNA polymerases and / or a combination of RNA-dependent DNA polymerases may be present in the reaction system disclosed herein. In some embodiments, the polymerase used herein is a thermostable DNA polymerase. In some embodiments, the thermostable DNA polymerase used herein does not irreversibly inactivate when subjected to high temperatures for a period of time required to achieve single-stranded nucleic acid instability or double-stranded nucleic acid denaturation during nucleic acid amplification or PCR amplification. Irreversibility of an enzyme refers to a significant loss of enzyme activity. Thermostable DNA polymerases preferably do not irreversibly denature under conditions typically required for PCR amplification.
[0034] In some embodiments, the reaction system of the present invention further comprises Mg 2+ The primer comprises at least one of dNTPs, primers, and buffer. Those skilled in the art can design oligonucleotide chains complementary to the template sequence as primers. In some embodiments, the primers are selected from conventional primers or degenerate primers. Conventional primers are generally used for nucleic acid amplification (e.g., PCR amplification) due to their relatively high specificity and simple structure. However, when amplifying unknown sequences, degenerate primers can only be designed based on conserved sequences. This presents difficulties for specific amplification. In some embodiments, the reaction system of the present invention may contain conventional primers. In some embodiments, the reaction system of the present invention may contain more complex degenerate primers with higher melting temperatures.
[0035] According to the teachings of the present invention, one or more additional components and / or additives may be incorporated into the reaction systems, methods, compositions, and kits of the present invention to optimize nucleic acid amplification. In some embodiments, the reaction system may contain additional components and / or additives (e.g., reagents for promoting or enhancing PCR) capable of promoting or enhancing nucleic acid amplification reactions. Additional components and / or additives may be other organic or inorganic compounds, other peptides, and non-peptide components. Such components and / or additives may include, but are not limited to, sulfur-containing compounds, acetate-containing compounds, dimethyl sulfoxide (DMSO), glycerol, formamide, betaine, tetramethylammonium chloride (TMAC), exoproteins, polyols, surfactants (e.g., Tween 20, NP-40, Triton X-100, and CHAPS), and crowding agents (e.g., Ficoll 70, glycogen, and PEG). Those skilled in the art will be able to identify the additional components and / or additives used in the reaction systems, methods, compositions, and kits of the present invention.
[0036] According to the teachings of the present invention, internal reference materials, quality control materials, and anti-contamination substances (such as uracil DNA glycosylation enzymes and RNases) can be incorporated into the reaction systems, methods, compositions, and kits of the present invention.
[0037] In some embodiments, the nucleic acid amplification of the present invention includes, but is not limited to, primer extension or polymerase chain reaction (PCR). In some embodiments, the nucleic acid amplification reaction may be a polymerase chain reaction. In some embodiments, the PCR is singlet PCR. In some embodiments, the PCR is multiplex PCR. As used herein, the term "singlet" or "singlet PCR" refers to an assay provided for amplifying a single product within a reaction vessel. Different primer pairs are used to initiate the product. A singlet reaction may further include a labeled probe specific to the amplified product, wherein the probe may be detectably labeled with a detectable portion such as a fluorescent dye. As used herein, the term "multiplex" or "multiplex PCR" refers to an assay provided for simultaneously amplifying two or more products within the same reaction vessel. Different primer pairs are used to initiate each product. A multiplex reaction may further include a labeled probe specific to each product, wherein the probe may be detectably labeled with different detectable portions. In some implementations, the nucleic acid amplification methods disclosed herein can be used for a wide range of assays, including the detection, quantification, and / or characterization of target nucleic acids, such as, but not limited to, single nucleotide polymorphisms (SNPs), microsatellite analysis and genotyping, copy number determination and variation analysis, assays for detecting gene expression, and assays for detecting small RNA expression.
[0038] In some implementations, the method for improving nucleic acid amplification reactions also includes the step of providing conditions that allow nucleic acid amplification reactions to occur.
[0039] In some embodiments, the composition of the present invention comprises sodium hexametaphosphate; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate and polidocanol; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate and gelatin; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate and single-stranded binding protein; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate and DNA mismatch repair protein; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate, polidocanol, and gelatin; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate, polidocanol, and single-stranded binding protein; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate, polidocanol, and DNA mismatch repair protein; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate, gelatin, and single-stranded binding protein; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate, gelatin, and DNA mismatch repair protein; in some embodiments, the composition of the present invention comprises sodium hexametaphosphate, single-stranded binding protein, and DNA mismatch repair protein.
[0040] In some embodiments, the present invention provides a kit comprising the reaction system or composition of any of the embodiments. In some embodiments, the kit further comprises labeled probes specific for the detection of nucleic acid amplification (e.g., PCR amplification) products and / or DNA targets.
[0041] In some embodiments, the present invention also provides the use of reaction systems, methods, compositions, and kits comprising any of the embodiments in nucleic acid amplification reactions.
[0042] The present invention will be further described in detail below with reference to specific embodiments. The following embodiments are provided to illustrate implementation methods of the present invention and are not intended to limit the invention. The present invention may optionally include embodiments not shown in the embodiments.
[0043] I. Singleton PCR reaction
[0044] 1. Template preparation
[0045] (1) Cell type: 293T cells;
[0046] (2) Cell collection: Aliquot the cell culture medium into 1.5mL centrifuge tubes, approximately 1×10⁻⁶ cells per tube. 6 One cell, centrifuged to remove the cell slurry;
[0047] (3) Human genome extraction: Extracted using TIANamp Genomic DNA Kit (centrifuge column type).
[0048] 2. Primers
[0049] A pair of primers targeting the β-Globin gene is provided for amplification, as shown below;
[0050] F–5'-TGCTGTTATGGGCAACCCTAA-3', the sequence is shown in SEQ ID NO:1.
[0051] R–5'-GAGCCAGGCCATCACTAAAGG-3', the sequence is shown in SEQ ID NO:2.
[0052] 3. Target gene amplification
[0053] PCR reaction system: 0.5 μL Pfu DNA polymerase (5 U / μL), 2 mM MgCl2, 0.5 μL dNTP (10 mM), 2.5 μL 10-fold upstream and downstream primer mixture, 10 pg / 100 pg / 1 ng human genomic DNA, single-component additives, and ddH2O to a final volume of 25 μL.
[0054] PCR amplification program: 95℃, 2 min 30 s; (98℃, 20 s; 56℃, 20 s; 72℃, 30 s) × 35 cycles; 72℃, 3 min; 4℃, ∞.
[0055] 4. Detection of PCR amplification products
[0056] Example 1: Add 0.25 (w / v)% sodium cholate to a singleton PCR reaction system.
[0057] Example 2: Add 0.1% 40nm gold nanoparticles to a singleton PCR reaction system.
[0058] Example 3: Add 0.5 (w / v)% L-arginine to the singleton PCR reaction system.
[0059] Example 4: Add 0.5 (w / v)% trehalose to the singleton PCR reaction system.
[0060] Example 5: Add 0.01 (w / v)% sodium hexametaphosphate to the singleton PCR reaction system.
[0061] Example 6: Add 0.35 (w / v)% sodium hexametaphosphate to the singleton PCR reaction system.
[0062] Example 7: Add 0.05 (w / v)% fish gelatin to a singleton PCR reaction system.
[0063] Example 8: No additives, control group.
[0064] The amplification effect of adding a single additive (sodium cholate, gold nanoparticles, L-arginine, trehalose, and fish gelatin at optimal dosages) to a singleton PCR reaction system is as follows: Figure 1 As shown: some additives inhibit amplification, such as sodium cholate, gold nanoparticles, and trehalose; some additives have little effect, such as L-arginine; fish gelatin can improve amplification efficiency but increases non-specific bands compared to the control group; while sodium hexametaphosphate can promote both the amplification efficiency and specificity of PCR amplification.
[0065] II. Multiplex PCR Reaction System
[0066] 1. Template preparation
[0067] (1) Cell type: 293T cells;
[0068] (2) Cell collection: Aliquot the cell culture medium into 1.5mL centrifuge tubes, approximately 1×10⁻⁶ cells per tube. 6 One cell, centrifuged to remove the cell slurry;
[0069] (3) Human genome extraction: Extracted using the TIANamp Genomic DNA Kit (centrifuge column type).
[0070] 2. Primers: 20 pairs of primers were used, with sequences as shown in SEQ ID NO:3-42.
[0071] 3. Target gene amplification
[0072] PCR reaction system: 0.5 μL Pfu DNA polymerase (5 U / μL), 2 mM MgCl2, 0.5 μL dNTP (10 mM), 2.5 μL 10-fold upstream and downstream primer mixture, 100 ng human genomic DNA, single-component / two-component / three-component additives, and ddH2O to a final volume of 20 μL.
[0073] PCR amplification program: 98℃, 20 min; (98℃, 15 s; 65℃, 10 min; 68℃, 1 min; 72℃, 1 min) × 6 cycles; (98℃, 15 s; 68℃, 1 min; 72℃, 1 min) × 28 cycles; 72℃, 10 min; 4℃, ∞.
[0074] 4. Detection of PCR amplification products
[0075] Example 9: No additives, control group.
[0076] Example 10: Add 0.25 (w / v)% sodium cholate to a multiplex PCR reaction system.
[0077] Example 11: Add 0.5 (w / v)% trehalose to the multiplex PCR reaction system.
[0078] Example 12: Add 0.1% 40nm gold nanoparticles to a multiplex PCR reaction system.
[0079] Example 13: Add 0.05 (w / v)% sodium hexametaphosphate to the multiplex PCR reaction system.
[0080] Example 14: Add 0.05 (w / v)% fish gelatin to a multiplex PCR reaction system.
[0081] The amplification effects of adding a single additive (sodium cholate, trehalose, gold nanoparticles, and fish gelatin at the optimal dosage) to the multiplex PCR reaction system are shown in Table 1: the amplification effect is optimal when sodium hexametaphosphate is added to the multiplex PCR reaction system.
[0082] Table 1. Amplification Results of Examples 10-14
[0083]
[0084] Examples 10-14 were compared with the control group without additives. " / " indicates that there was basically no effect; "-" indicates an inhibitory effect; "+" indicates a promoting effect; and more symbols indicate a greater degree of effect.
[0085] Example 15: No additives, control group.
[0086] Example 16: Add 0.05 (w / v)% sodium hexametaphosphate + 0.1 (w / v)% polidocanol (combination 1) to the multiplex PCR reaction system.
[0087] Example 17: Add 0.05 (w / v)% sodium hexametaphosphate + 0.05 (w / v)% fish gelatin (combination 2) to the multiplex PCR reaction system.
[0088] Example 18: Add 0.05 (w / v)% sodium hexametaphosphate + 5 ng / μL SSB (combination 3) to the multiplex PCR reaction system.
[0089] Example 19: Add 0.05 (w / v)% sodium hexametaphosphate + 0.125 μg / μL moltS (combination 4) to the multiplex PCR reaction system.
[0090] The amplification effect of adding a two-component combination to a multiplex PCR reaction system is as follows: Figure 2 As shown, the two additive combinations further promoted multiplex PCR amplification compared to adding sodium hexametaphosphate alone.
[0091] Example 20: No additives, control group.
[0092] Example 21: Add 0.05 (w / v)% sodium hexametaphosphate + 0.1 (w / v)% polidocanol + 0.125 μg / μL MutS (combination 5) to the multiplex PCR reaction system.
[0093] Example 22: Add 0.05 (w / v)% sodium hexametaphosphate + 0.05 (w / v)% fish gelatin + 0.125 μg / μL MutS (combination 6) to the multiplex PCR reaction system.
[0094] Example 23: Add 0.05 (w / v)% sodium hexametaphosphate + 5 ng / μL SSB + 0.125 μg / μL MutS (combination 7) to the multiplex PCR reaction system.
[0095] The amplification effect of adding three additives to a multiplex PCR reaction system is as follows: Figure 3 As shown, the three-combination additives significantly promoted multiplex PCR amplification.
[0096] Example 24: Replace the Pfu DNA polymerase in the multiplex PCR reaction system of Example 22 with 0.5 μL Taq DNA polymerase (5 U / μL).
[0097] Example 25: The amount of sodium hexametaphosphate added in Example 11 was changed to 0.005 (w / v)%.
[0098] Example 26: The amount of sodium hexametaphosphate added in Example 11 was changed to 0.5% (w / v)%.
[0099] Example 27: The amount of polydextrose added in Example 15 was changed to 0.005 (w / v)%.
[0100] Example 28: The amount of fish gelatin added in Example 16 was changed to 0.005% (w / v)%.
[0101] Example 29: The amount of polydicarboxylic acid added in Example 20 was changed to 0.25 (w / v)% and the amount of MutS added was changed to 0.05 μg / μL.
[0102] Example 30: The amount of fish gelatin added in Example 21 was changed to 0.5 (w / v)% and the amount of MutS added was changed to 5 μg / μL.
[0103] Example 31: The amount of SSB added in Example 22 was changed to 2 ng / μL.
[0104] Example 32: The amount of SSB added in Example 24 was changed to 10 ng / μL.
[0105] Replacing the additives (concentration) and / or DNA polymerase in the PCR reaction system will result in a substantially similar promoting effect on PCR amplification.
[0106] Table 2. Amplification Results of Examples 24-32
[0107] Examples Amplification efficiency Twenty-four ++++ Twenty-five ++++ Twenty-six ++++ Twenty-seven ++++ Twenty-eight ++++ Twenty-nine ++++ Thirty ++++ Thirty-one ++++ Thirty-two ++++
[0108] Examples 24-32 are all compared with the control group without additives. "+" indicates a promoting effect; more symbols indicate a deeper degree.
[0109] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. sequence list <110> Guangdong Feipeng Biotechnology Co., Ltd. Feipeng Biotechnology Co., Ltd. <120> An Improved Method for Nucleic Acid Amplification Reactions and Its Application <160> 42 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Primer() <400> 1 tgctgttatg ggcaacccta a 21 <210> 2 <211> twenty one <212> DNA <213> Primer() <400> 2 gagccaggcc atcactaaag g 21 <210> 3 <211> 25 <212> DNA <213> Primer() <400> 3 ccaataacac ttcagacttc ggatg 25 <210> 4 <211> 25 <212> DNA <213> Primer() <400> 4 tgtttacgct tatcctcttg ttgtg 25 <210> 5 <211> 25 <212> DNA <213> Primer() <400> 5 gcattgagga agggttggtt ttaaa 25 <210> 6 <211> 25 <212> DNA <213> Primer() <400> 6 catgttgctt tgtgtctgtg tactt 25 <210> 7 <211> 25 <212> DNA <213> Primer() <400> 7 tgggtgtttt gctatttttg gagtt 25 <210> 8 <211> 25 <212> DNA <213> Primer() <400> 8 aaacagttgt aagccagtga atctg 25 <210> 9 <211> twenty two <212> DNA <213> Primer() <400> 9 tgagggtcaa gcattccata cc 22 <210> 10 <211> 25 <212> DNA <213> Primer() <400> 10 gcagttagag gatgaacatt ccatc 25 <210> 11 <211> 25 <212> DNA <213> Primer() <400> 11 tgagtctcag atgtgactta taggg 25 <210> 12 <211> 25 <212> DNA <213> Primer() <400> 12 gagaacgcca ttagaacatc agaag 25 <210> 13 <211> 25 <212> DNA <213> Primer() <400> 13 gaaaacttac tgatcgtgac tgcag 25 <210> 14 <211> twenty one <212> DNA <213> Primer() <400> 14 ccctatcatg gggaaagcct c 21 <210> 15 <211> 25 <212> DNA <213> Primer() <400> 15 ggcaggaaat gagtctaatg agtct 25 <210> 16 <211> 25 <212> DNA <213> Primer() <400> 16 gtgccttttt catcagttgc atttt 25 <210> 17 <211> 25 <212> DNA <213> Primer() <400> 17 caagccaaac cgcctaatta taaga 25 <210> 18 <211> 25 <212> DNA <213> Primer() <400> 18 ttgtaaagct tttgtgtgtt ctgct 25 <210> 19 <211> twenty four <212> DNA <213> Primer() <400> 19 caagagacag tagggaggca tttc 24 <210> 20 <211> 25 <212> DNA <213> Primer() <400> 20 aggtggcagg atattgaagtttcta 25 <210> twenty one <211> 25 <212> DNA <213> Primer() <400> twenty one caggtaatta aaactgggga aaggc 25 <210> twenty two <211> 25 <212> DNA <213> Primer() <400> twenty two tttacacttg aaaacctgga gtcac 25 <210> twenty three <211> 25 <212> DNA <213> Primer() <400> twenty three aaactaaaac ccatgtgagc caaat 25 <210> twenty four <211> twenty three <212> DNA <213> Primer() <400> twenty four atcaggaagg tggctctctg aag 23 <210> 25 <211> 25 <212> DNA <213> Primer() <400> 25 aaaggaaagg aaattgctcc tgatg 25 <210> 26 <211> twenty one <212> DNA <213> Primer() <400> 26 gacctgggag acgtctcttt t 21 <210> 27 <211> 25 <212> DNA <213> Primer() <400> 27 aagttgtgag aagaacacag aggaa 25 <210> 28 <211> 25 <212> DNA <213> Primer() <400> 28 ctagtgaagtctccagggtcttaag 25 <210> 29 <211> 25 <212> DNA <213> Primer() <400> 29 aaacaaaagc aaacaaacca aggtg 25 <210> 30 <211> twenty two <212> DNA <213> Primer() <400> 30 atcctggtct ccaaggcaaa at 22 <210> 31 <211> 25 <212> DNA <213> Primer() <400> 31 gatacacagt cctaaccact tgagt 25 <210> 32 <211> 25 <212> DNA <213> Primer() <400> 32 agcagaaact aaacattgtc actgg 25 <210> 33 <211> 25 <212> DNA <213> Primer() <400> 33 cccaatccaa tcatctttgc tcttt 25 <210> 34 <211> 25 <212> DNA <213> Primer() <400> 34 aaactgaccttggatggaatggaaa 25 <210> 35 <211> 25 <212> DNA <213> Primer() <400> 35 ccatggggat tgtcttctaa tttgg 25 <210> 36 <211> 25 <212> DNA <213> Primer() <400> 36 gctggaacat ttgcttttct caaaa 25 <210> 37 <211> 25 <212> DNA <213> Primer() <400> 37 gtaggagaca cagtagcaga gagag 25 <210> 38 <211> 25 <212> DNA <213> Primer() <400> 38 cagtgcatgg aattttggaa acttc 25 <210> 39 <211> 25 <212> DNA <213> Primer() <400> 39 agctgctaaa tcagtctgtt aactt 25 <210> 40 <211> twenty two <212> DNA <213> Primer() <400> 40 agaaagcaca gtcttcaggg ag 22 <210> 41 <211> 25 <212> DNA <213> Primer() <400> 41 tcaaatctga ctggtagaaa tgcct 25 <210> 42 <211> 25 <212> DNA <213> Primer() <400> 42 gctaaggctg cagtaagatt agaaa 25
Claims
1. An improved method for nucleic acid amplification reaction, characterized in that, The process includes the step of adding a template to a reaction system containing sodium hexametaphosphate; the final concentration of sodium hexametaphosphate in the reaction system is 0.005-0.5% (w / v)%; the reaction system also contains DNA polymerase and Mg. 2+ The nucleic acid amplification reaction consists of dNTPs, primers, and buffer; the reaction is a polymerase chain reaction.
2. The method according to claim 1, characterized in that, The final concentration of sodium hexametaphosphate in the reaction system was 0.01-0.35 (w / v)%.
3. The method according to any one of claims 1-2, characterized in that, The reaction system further contains at least one of podocalcitonin, gelatin, single-stranded binding protein, and DNA mismatch repair protein.
4. The method according to claim 3, characterized in that, The final concentration of polydextrose in the reaction system was 0.005-0.25 (w / v)%.
5. The method according to claim 3, characterized in that, The final concentration of gelatin in the reaction system is 0.005-0.5 (w / v)%.
6. The method according to claim 3, characterized in that, The final concentration of the single-chain binding protein in the reaction system was 2-10 ng / μL.
7. The method according to claim 3, characterized in that, The final concentration of DNA mismatch repair protein in the reaction system was 0.05-5 μg / μL.
8. The method according to claim 1, characterized in that, The DNA polymerase is a thermostable DNA polymerase.
9. A reagent combination for improving nucleic acid amplification reactions, characterized in that, The reagent combination contains sodium hexametaphosphate; the final concentration of sodium hexametaphosphate in the reagent combination is 0.005-0.5% (w / v)%; the reagent combination also contains DNA polymerase and Mg. 2+ The nucleic acid amplification reaction consists of dNTPs, primers, and buffer; the reaction is a polymerase chain reaction.
10. The reagent combination according to claim 9, characterized in that, The final concentration of sodium hexametaphosphate in the reagent combination is 0.01-0.35 (w / v)%.
11. The reagent combination according to any one of claims 9-10, characterized in that, The reagent combination further contains at least one of podocalcitonin, gelatin, single-stranded binding protein, and DNA mismatch repair protein.
12. The reagent combination according to claim 11, characterized in that, The final concentration of polidocanol in the reagent combination is 0.005-0.25 (w / v)%.
13. The reagent combination according to claim 11, characterized in that, The final concentration of gelatin in the reagent combination is 0.005-0.5 (w / v)%.
14. The reagent combination according to claim 11, characterized in that, The final concentration of the single-chain binding protein in the reagent combination is 2-10 ng / μL.
15. The reagent combination according to claim 11, characterized in that, The final concentration of the DNA mismatch repair protein in the reagent combination is 0.05-5 μg / μL.
16. The reagent combination according to claim 9, characterized in that, The DNA polymerase is a thermostable DNA polymerase.
17. A reagent kit, characterized in that, It comprises the reagent combination according to any one of claims 9-16.
18. The use of the method of any one of claims 1-8, the reagent combination of any one of claims 9-16, or the kit of claim 17 in nucleic acid amplification reactions.
Citation Information
Patent Citations
Nucleic acid isolation using polidocanol and derivatives
CN102776173A
Nucleic acid isolation and inhibitor removal from complex samples
CN112313344A
Abstract:
WO2006098428A1