A sustainable genotyping standard for multi-locus use

Abstract

This invention belongs to the field of gene sequencing standard technology, and provides a genotyping standard for sustainable use at multiple loci. The standard includes PTC-HEX, PTC-FAM, and PTC-H; wherein, the PCR products of PTC-HEX include rs25487(G), rs1042522(C), and rs1048943(A); the PCR products of PTC-FAM include rs25487(A), rs1042522(G), and rs1048943(T); and the PCR product of PTC-H includes PTC-HEX. This standard, with modified DNA structure, can be used for multi-locus SNP genotyping and is a sustainable genotyping standard. The standard can be replicated using single-primer PCR amplification, thus enabling sustainable use and significantly reducing the cost of standard re-preparation.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological technology genotyping, and specifically discloses a standard product suitable for multi-site genotyping. Background Art

[0002] SNP (Single nucleotide polymorphism) is a point mutation caused by the conversion, translocation, insertion or deletion of a single base at a specific nucleotide position in genomic DNA, which leads to differences between groups and individuals. With the rapid development of sequencing technology and bioinformatics analysis, massive genomic data has laid the foundation for SNP molecular markers. Tens of thousands of SNP polymorphic sites are being continuously discovered and widely used in genetic disease diagnosis, pathogenic candidate gene research, drug screening research, molecular marker-assisted breeding, population genetics research, etc. Therefore, the authenticity verification of SNP markers and their subsequent development and utilization have become particularly important.

[0003] Common SNP sites generally have two alleles, also known as biallelic genes. Therefore, in a population, each individual's SNP site generally has three genotypes: the genotype of the site before mutation (homozygous type 1), the genotype of the site after mutation (homozygous type 2), and the coexistence of genotypes before and after mutation (heterozygous type). SNP detection technology is usually used to determine which of the three genotypes the genotype of each SNP site of each individual belongs to. There are three common SNP detection platforms: high-throughput sequencing platform, medium-throughput gene chip detection platform, low-throughput electrophoresis detection platform, fluorescence quantitative PCR detection platform, enzyme label detection platform, etc. Among them, the low-throughput SNP detection platform is the most widely used and popular. Summary of the invention

[0004] Low-throughput SNP detection platforms often require three genotype standards for each SNP site as references to assist SNP detection. There are two common SNP detection standards: one is to screen three genotype samples from samples with known genotypes as standards; the other is to synthesize gene sequences with known genotypes as standards. However, both of these standards have their disadvantages when facing multi-site SNP detection: the former requires three genotype standards for each SNP site, resulting in a large number of tubes of multi-site SNP standards, which are difficult to store and prone to errors; and after each batch of standards is used up, it is necessary to resample and extract DNA to prepare standards, which may cause difficulties in re-obtaining samples and increase the cost of DNA extraction. The latter has a high cost of gene synthesis, especially the cost of multi-site gene synthesis is even higher. After the standard is used up, high-cost gene synthesis is required again.

[0005] The present invention aims at the insufficiency of the existing SNP standard products and strives to develop a low-cost genotyping standard product that can be used for multi-site SNP typing and can be used sustainably. The standard product has only 3 tubes in a set and is easy to store.

[0006] A genotyping standard for sustainable use at multiple sites, comprising PTC-HEX, PTC-FAM and PTC-H; wherein the PCR product of PTC-HEX comprises rs25487 (G), rs1042522 (C) and rs1048943 (A); the PCR product of PTC-FAM comprises rs25487 (A), rs1042522 (G) and rs1048943 (T), and the PCR product of PTC-H comprises PTC-HEX, wherein:

[0007] The gene sequence of rs25487 (G) is: 5'-[HEX]CGGCTGCCCTCCCGGAGGTAAG[BHQ1];

[0008] The gene sequence of rs1042522 (C) is: 5'-[HEX]CTGCTCCCCCCGTGGCCCC[BHQ1];

[0009] The gene sequence of rs1048943 (A) is: 5'-[HEX]CGGTGAGACCATTGCCCGCT[BHQ1]; the gene sequence of rs25487 (A) is: 5'-[6FAM]CGGCTGCCCTCCCAGAGGTAAG[BHQ1]; the gene sequence of rs1042522 (G) is: 5'-[6FAM]CTGCTCCCCGCGTGGCCCC[BHQ1]; the gene sequence of rs1048943 (T) is: 5'-[6FAM]CGGTGAGACCGTTGCCCGCT[BHQ1].

[0010] Among them, the concentration of rs25487 (G) is 52.2-65.3 ng / μL, the concentration of rs1042522 (C) is 59.5-74 ng / μL, the concentration of rs1048943 (A) is 47-82.1 ng / μL, the concentration of rs25487 (A) is 48.1-53.2 ng / μL, the concentration of rs1042522 (G) is 53.2-59.5 ng / μL, the concentration of rs1048943 (T) is 42.9-69.6 ng / μL, the concentration of PTC-HEX is 52.4-73.2 ng / μL, and the concentration of PTC-HEX is 47.7-60 ng / μL;

[0011] The genotyping standard is used to simultaneously and continuously detect three SNP sites, which are rs25487 (G / A), rs1042522 (C / G), and rs1048943 (A / G).

[0012] Beneficial Effects

[0013] Low-throughput SNP detection platforms often require three genotype standards for each SNP site as references to assist SNP detection. There are two common SNP detection standards: one is to screen three genotype samples from known genotype samples as standards; the other is to synthesize gene sequences with known genotypes as standards. However, both of these standards have their disadvantages when facing multi-site SNP detection: the former requires three genotype standards for each SNP site, resulting in a large number of tubes of multi-site SNP standards, which are difficult to store and easy to use. In addition, after each batch of standards is used up, it is necessary to resample and extract DNA to prepare standards, which may be difficult to re-obtain samples and increase the cost of DNA extraction. The latter has a high cost of gene synthesis, especially the cost of multi-site gene synthesis is even higher. After the standard is used up, it needs to be synthesized again at a high cost. In order to solve the existing problems mentioned above, we have developed a genotyping standard for sustainable use at multiple sites. This invention has three major advantages: First, based on the cost of preparing standard products, this invention provides standard products for different numbers of SNP sites, thereby greatly reducing the cost of preparing standard products. Second, a set of new standard products has only 3 tubes, each tube incorporates a genotype of each SNP site, which is easy to store and suitable for multi-site SNP detection. Third, the new standard products have been modified in DNA structure, and the standard products can be replicated by single-primer PCR amplification, so that the standard products can be used sustainably and the cost of re-preparing the standard products is greatly reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 : Example 1 Standard genotyping verification results.

[0015] Figure 2 :Commonly used adapter sequences for sequencing on the illumina platform.

[0016] Figure 3 : Example 2 Standard genotyping verification results. DETAILED DESCRIPTION

[0017] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further explained below in combination with specific details.

[0018] All raw materials in the present invention have no particular restrictions on their sources, and can be purchased on the market or prepared according to conventional methods known to those skilled in the art. All raw materials in the present invention have no particular restrictions on their purity, and the present invention preferably uses analytically pure or conventional purity used in the field of composite materials.

[0019] The embodiment uses the "Cancer Suppression Satellite TV" genotyping detection product on the market for detailed description. The "Cancer Suppression Satellite TV" genotyping detection product contains three SNP sites, whose names (genotypes) are rs25487 (G / A), rs1042522 (C / G), and rs1048943 (A / G).

[0020] Based on cost considerations, the preparation of standards for 5 or less SNP sites is preferably performed in Example 1; the preparation of standards for more than 5 SNP sites is preferably performed in Example 2.

[0021] Example 1

[0022] 1. SNP site primer design

[0023] For primer design, you can directly use the primer sequence of TaqMan probe or other fluorescence quantitative PCR detection platform probe products as the basis (Table 1), and add a unified amplification primer sequence to its 5' end (Table 2). You can also obtain its gene sequence through the RS number, use primer design software or website to design primers yourself, and add a unified amplification primer sequence to the 5' end of the designed primer sequence (Table 2).

[0024] In this embodiment, the ThermoFisher TaqMan probe was used for the experiment. The primers were directly selected from the primer sequences provided by the ThermoFisher TaqMan probe product, and a unified amplification primer sequence was added to the 5' end.

[0025] The information is as follows:

[0026] Table 1: Primer and probe sequence information table of ThermoFisher TaqMan probe products

[0027]

[0028] Table 2: Fusion primer information table for preparing universal primer sequence by adding standard products to the 5' end

[0029]

[0030] 2. Sample Preparation

[0031] For each of the three SNP sites, two samples of homozygous genotypes were prepared. The sample information is as follows.

[0032] Table 3: Sample information table

[0033] Sample name genotype Amplification primers Probe Fluorophore 1 rs25487(G) rs25487-primerpair HEX 2 rs25487(A) rs25487-primerpair 6FAM 3 rs1042522(C) rs1042522-primerpair HEX 4 rs1042522(G) rs1042522-primerpair 6FAM 5 rs1048943(A) rs1048943-primerpair HEX 6 rs1048943(T) rs1048943-primerpair 6FAM

[0034] 3. SNP sequence amplification

[0035] The corresponding PCR amplification primers were used to amplify the SNP gene sequences of the samples and purified using 0.8X magnetic beads. After purification, the names of the amplified products were consistent with the genotype names in Table 3. The DNA content of the amplified products was detected using the Qubit 3.0 instrument.

[0036] 1) PCR amplification system:

[0037] Table 4: PCR amplification system

[0038]

[0039]

[0040] 2) PCR amplification procedure:

[0041] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 45 sec, for a total of 25 cycles; final extension at 72°C for 5 min; storage at 4°C.

[0042] 3) 0.8X magnetic bead purification solution:

[0043] The product of the present invention is purified using VAHTS DNA Clean Beads. Before purification, the magnetic bead solution is taken out from 2 to 8 ° C 30 minutes in advance and allowed to stand to balance its temperature to room temperature. Vortex the magnetic bead solution to fully

[0044] Mix well, pipette 40μl of magnetic bead solution and add it to 50μl of DNA amplification product, use a pipette to gently pipette 10 times to mix thoroughly, incubate at room temperature for 10 minutes to allow DNA to bind to the magnetic beads. Place the sample on the magnetic stand, wait for the solution to clarify (about 5 minutes), and carefully remove the supernatant. Keep the sample on the magnetic stand, add 200μl of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Add 200μl of freshly prepared 80% ethanol to rinse the magnetic beads again, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Keep the sample on the magnetic stand, open the lid and dry the magnetic beads at room temperature for about 5-10 minutes. Remove the sample from the magnetic stand, add 50μl Nuclease-free Water, vortex or use a pipette to mix thoroughly, and let it stand at room temperature for 2 minutes. Let it stand on the magnetic stand for 5 minutes until the solution is clear, carefully pipette the supernatant into a new nuclease-free centrifuge tube, mark it for use.

[0045] 4) PCR product quality control

[0046] Table 5: Quality control results of amplified products

[0047] PCR product name Concentration ng / μL Volume μL Total μg rs25487(G) 52.2 50 2.61 rs25487(A) 48.1 50 2.405 rs1042522(C) 59.5 50 2.975 rs1042522(G) 53.2 50 2.66 rs1048943(A) 47.0 50 2.35 rs1048943(T) 42.9 50 2.145

[0048] 4. Preparation of multi-site standards

[0049] The above 6 tubes of amplified products were prepared into 3 tubes of multi-site standards. The mixing scheme is as follows:

[0050] Table 6: Multi-site standard mixing plan

[0051]

[0052]

[0053] The concentration of the prepared standard was detected using the Qubit 3.0 instrument and diluted to 10 ng / μL for later use.

[0054] 5. Genotyping Verification

[0055] The present invention uses ABIQuantStudio6 real-time fluorescence quantitative PCR instrument to perform standard sample genotyping verification experiments, and each standard sample is repeated three times.

[0056] 1) Genotyping system:

[0057] Table 7: Standard genotyping verification system

[0058]

[0059] 2) Genotyping procedure:

[0060] Pre-Amp: 60℃ / 30s, Amplication: 95℃ / 10min; 95℃ / 30s, 60℃ / 1min*,

[0061] 40 cycles; Post-Amp: 60℃ / 30s.

[0062] 3) Genotyping results: see Figure 1

[0063] 6. Continuous use of standard products

[0064] The standard prepared in this scheme obtains the standard SNP sequence by fusion primer amplification. The fusion primer structure consists of two parts, one is the universal primer sequence prepared by the standard, and the other is the SNP site gene amplification primer sequence. When the volume of the standard is too small, only 1ul of the standard is needed, and the universal primer is prepared by the standard for PCR amplification and purification before continued use.

[0065] The standard product of this invention not only has the advantages of merging each gene of multi-site SNP into one tube, which is easy to store and use, but also can be used to prepare a new round of standard products through simple single primer PCR, so that the standard products can be used continuously. Compared with the preparation of standard products by gene synthesis, the preparation cost is greatly reduced.

[0066] Example 2

[0067] 1. SNP site primer design

[0068] For primer design, you can directly use the primer sequences that come with TaqMan probes or other fluorescence quantitative PCR-based detection platform probe products. You can also obtain its gene sequence through the RS number and use primer design software or websites to design primers yourself.

[0069] The present invention uses Thermo Fisher TaqMan probes for experiments, and the primers directly use the primer sequences that come with the ThermoFisherTaqMan probe product. Detailed information is the same as Table 1: Primer probe sequence information table that comes with the Thermo Fisher TaqMan probe product.

[0070] 2. Sample Preparation

[0071] For each of the three SNP sites, two samples of homozygous genotypes were prepared, and the sample information was the same as that in Table 2 .

[0072] 3. SNP sequence amplification

[0073] Use the corresponding PCR amplification primers to amplify the SNP gene sequence of the sample and perform 0.8X

[0074] Magnetic bead purification. After purification, the name of the amplified product is consistent with the genotype name in Table 3. The DNA content of the amplified product was detected using the Qubit3.0 instrument.

[0075] 1) PCR amplification system is shown in Table 8.

[0076] Table 8: PCR amplification system

[0077]

[0078] 2) PCR amplification procedure:

[0079] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 45 sec, for a total of 25 cycles; final extension at 72°C for 5 min; storage at 4°C.

[0080] 3) 0.8X magnetic bead purification solution:

[0081] The product of the present invention is purified using VAHTS DNA Clean Beads. Before purification, the magnetic bead solution is taken out from 2 to 8 ° C 30 minutes in advance and allowed to stand to balance its temperature to room temperature. Vortex the magnetic bead solution to fully

[0082] Mix well, pipette 40μl of magnetic bead solution and add it to 50μl of DNA amplification product, use a pipette to gently pipette 10 times to mix thoroughly, incubate at room temperature for 10 minutes to allow DNA to bind to the magnetic beads. Place the sample on the magnetic stand, wait for the solution to clarify (about 5 minutes), and carefully remove the supernatant. Keep the sample on the magnetic stand, add 200μl of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Add 200μl of freshly prepared 80% ethanol to rinse the magnetic beads again, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Keep the sample on the magnetic stand, open the lid and dry the magnetic beads at room temperature for about 5-10 minutes. Remove the sample from the magnetic stand, add 50μl Nuclease-free Water, vortex or use a pipette to mix thoroughly, and let it stand at room temperature for 2 minutes. Let it stand on the magnetic stand for 5 minutes until the solution is clear, carefully pipette the supernatant into a new nuclease-free centrifuge tube, mark it for use.

[0083] 4) PCR product quality control

[0084] Table 9: Quality control results of amplification products

[0085] PCR product name Concentration ng / μL Volume μL Total μg rs25487(G) 65.3 50 3.27 rs25487(A) 53.2 50 2.66 rs1042522(C) 74 50 3.70 rs1042522(G) 59.5 50 2.98 rs1048943(A) 82.1 50 4.11 rs1048943(T) 69.6 50 3.48

[0086] 4. Preparation of multi-site standards

[0087] The above 6 tubes of amplified products were prepared into 3 tubes of multi-site standards. The mixing scheme is as follows:

[0088] Table 10: Multi-site standard mixing plan

[0089]

[0090] The concentration of the prepared standard was detected using the Qubit 3.0 instrument and diluted to 10 ng / μL for later use.

[0091] 5. Construction of Standard Library

[0092] The standard library of the present invention is constructed using VAHTSTM Universal DNA Library Prep Kit for

[0093] V3 (ND607) kit, through end repair, A linker ligation, purification, PCR amplification,

[0094] After product purification, the construction of the standard library is completed. In the successfully constructed standard library, all SNP sequences are uniformly connected to the commonly used adapter sequence for Illumina platform sequencing ( Figure 2 When the subsequent standard products are about to run out, you only need to use the unified primer sequence (Table 11) for PCR amplification and purification, and then you can wait for a new round of standard products, thus achieving the goal of sustainable use of standard products.

[0095] Table 11: Universal primer sequences for standard preparation

[0096] name Primer sequences PrimerF AATGATACGGCGACCACCGAGATC PrimerR CAAGCAGAAGACGGCATACGAGAT

[0097] 6. Genotyping Verification

[0098] The present invention uses ABIQuantStudio6 real-time fluorescence quantitative PCR instrument to perform standard sample genotyping verification experiments, and each standard sample is repeated three times.

[0099] 1) The genotyping system is shown in Table 7.

[0100] 2) Genotyping procedure:

[0101] Pre-Amp: 60℃ / 30s; Amplication: 95℃ / 10min, 95℃ / 30s, 60℃ / 1min*,

[0102] 40 cycles; Post-Amp: 60℃ / 30s.

[0103] 3) Genotyping results: see Figure 3

[0104] 7. Continuous use of standard products

[0105] The standard prepared in this scheme is constructed by PCR product library to obtain a standard library with a unified adapter sequence. When the volume of the standard is too small, only 1ul of the standard is needed, and the universal primer sequence is prepared using the standard for PCR amplification and purification before continued use.

[0106] The standard product of the present invention has the advantages of merging each gene of multi-site SNP into one tube, which is easy to store and use, and can also be used to prepare a new round of standard products through simple single primer PCR, so that the standard products can be used continuously. Compared with the preparation of standard products by gene synthesis, the preparation cost is greatly reduced.

Claims

1. A genotyping standard for sustainable use at multiple sites, characterized in that: The standard includes PTC-HEX, PTC-FAM and PTC-H; wherein PTC-HEX includes PCR products rs25487 (G), rs1042522 (C) and rs1048943 (A); PTC-FAM includes PCR products rs25487 (A), rs1042522 (G) and rs1048943 (G); PTC-H includes PTC-HEX and PTC-FAM, Wherein, the gene sequence of rs25487 (G) is: 5'-CAAGCAGAAGACGGCATACGAGATGGTTGGCGTGTGAGGCCTTACCTCCGGGAGGGCAGCCGCCGACGCATGCGGTGACAGTCCAGCACCCACGATCTCGGTGGTCGCCGTATCATT-3'; The gene sequence of rs1042522 (C) is: 5'-CAAGCAGAAGACGGCATACGAGATCCGGTGTAGGAGCTGCTGGTGCAGGGGCCACGGGGGGAGCAGCCTCTGGCATTCTGGGAGCTTCATCTGGACCTGGGTCTGATCTCGGTGGTCGCCGTATCATT-3'; The gene sequence of rs1048943 (A) is: 5'-CAAGCAGAAGACGGCATACGAGATTAGCCAGGAAGAGAAAGACCTCCCAGCGGGCAATGGTCTCACCGATACACTTCCGCTTGCCCATGCCAAAGATAATCACCGATCTCGGTGGTCGCCGTATCATT-3'; The gene sequence of rs25487 (A) is: 5'-CAAGCAGAAGACGGCATACGAGATGGTTGGCGTGTGAGGCCTTACCTCTGGGAGGGCAGCCGCCGACGCATGCGGTGACAGTCCAGCACCCACGATCTCGGTGGTCGCCGTATCATT-3'; The gene sequence of rs1042522 (G) is: 5'-CAAGCAGAAGACGGCATACGAGATCCGGTGTAGGAGCTGCTGGTGCAGGGGCCACGCGGGGAGCAGCCTCTGGCATTCTGGGAGCTTCATCTGGACCTGGGTCTGATCTCGGTGGTCGCCGTATCATT-3'; The gene sequence of rs1048943 (G) is: 5'-CAAGCAGAAGACGGCATACGAGATTAGCCAGGAAGAGAAAGACCTCCCAGCGGGCAACGGTCTCACCGATACACTTCCGCTTGCCCATGCCAAAGATAATCACCGATCTCGGTGGTCGCCGTATCATT-3'.

2. The genotyping standard for multi-site sustainable use according to claim 1, characterized in that: The concentration of rs25487 (G) was 52.2 ng / μL, the concentration of rs1042522 (C) was 59.5 ng / μL, the concentration of rs1048943 (A) was 47 ng / μL, the concentration of rs25487 (A) was 48.1 ng / μL, the concentration of rs1042522 (G) was 53.2 ng / μL, the concentration of rs1048943 (G) was 42.9 ng / μL, the concentration of PTC-HEX was 52.4 ng / μL, and the concentration of PTC-FAM was 47.7 ng / μL.

3. A use of the multi-site sustainable genotyping standard as claimed in claim 1, characterized in that: The genotyping standard is used for simultaneously and continuously detecting three SNP sites, which are rs25487 (G / A), rs1042522 (C / G), and rs1048943 (A / G), and the application is for non-disease diagnosis and treatment purposes.

Images