Application of JWA polypeptide in the preparation of anti-tumor drug synergist

Abstract

The present invention relates to the use of JWA polypeptide in the preparation of an anti-tumor drug synergist. The amino acid sequence of the polypeptide is shown in I or II: I: FPGSDRF-Z; II: X-FPGSDRF-Z; wherein the amino acid S is phosphorylated, X and Z are amino acids or amino acid sequences respectively; X is selected from one of F, (R)9, (R)9-F, 6-aminocaproic acid, 6-aminocaproic acid-F, 6-aminocaproic acid-(R)9, and 6-aminocaproic acid-(R)9-F; and Z is selected from one of (G) n ‑RGD, A‑(G) n ‑RGD, n is an integer greater than or equal to 0, and the value range of n is 0-10. The above polypeptide can improve the hypoxia state of the tumor microenvironment, promote the normalization of tumor blood vessels to inhibit the initiation and occurrence of tumor metastasis, increase the effective perfusion of drugs in the tumor, and can be used as an anti-tumor drug synergist to provide new clinical drug possibilities for the treatment of tumors.

Description

Technical Field

[0001] The present invention relates to the application of JWA polypeptide in the preparation of anti-tumor drug synergistic enhancer, belonging to the technical field of anti-tumor auxiliary drugs. Background Art

[0002] In recent years, emerging tumor diagnostic and therapeutic technologies have significantly improved the cure rate of primary tumors, and some have even completely inhibited tumor growth at certain stages [1,2]. However, tumor metastasis is the main cause of death in cancer patients [3]. Once metastasis occurs, existing treatments are unlikely to benefit patients. Due to the limited treatment strategies for tumor metastasis, preventing the initiation of metastasis may be a major unmet clinical need in tumor treatment [4,5]. The pre-colonization stage of tumor cell metastasis is a complex multi-step process, including tumor cells detaching from the primary tumor, penetrating the basement membrane, and entering the blood vessels [6]. Breaking through the basement membrane and entering the vascular system is the core of initiating tumor metastasis [7]. The immaturity and instability of the tumor microenvironment vasculature provides the prerequisite for primary tumor cells to enter the vasculature and metastasize to distant organs [8,9]. Therefore, remodeling disordered blood vessels into mature and stable blood vessels can effectively inhibit the occurrence of tumor metastasis. Tumor angiogenesis is a regenerative process that is highly influenced by tumor cells and promotes tumor growth and metastasis

[10] . Cytokines secreted by tumor cells interact with perivascular cells and transform them into fibroblasts, thereby causing these cells to lose their ability to protect blood vessels [11,12]. In addition, tumor cells release pseudo-endothelial signals to stimulate endothelial cell migration, resulting in discontinuity of endothelial lining and defects in basement membrane

[13] . All of these characteristics are manifestations of vascular immaturity and dysfunction. Therefore, the high permeability of blood vessels facilitates the invasion of tumor cells into blood vessels. Normalization of tumor blood vessels can keep endothelial cells surrounded by mature pericytes in a quiescent state. Endothelial cells and pericytes are separated by basement membranes and filled with various adhesion proteins to maintain vascular stability

[14] . Normalization of tumor blood vessels inhibits metastasis by reducing tumor cell invasion of blood vessels [15,16]. In addition, regular and mature blood vessel distribution in the tumor microenvironment promotes blood perfusion and relieves hypoxia and acidosis

[17] . IL8 is a known chemotactic cytokine that has been reported to be highly expressed in a variety of tumors [18,19]; IL8 can promote the proliferation and metastasis of malignant tumors and play a key regulatory role in the tumor microenvironment [20,21]. IL8 also aggravates tumorigenicity by mediating crosstalk between ECFC and TNBC

[22] . The hepatitis B virus-encoded gene (HBX) induces high IL8 production by activating MEK-ERK signaling, leading to increased endothelial cell permeability and promoting tumor vascular invasion

[23] . More importantly, IL8-mediated vascular immaturity induces hypoxia in the tumor microenvironment, which in turn stimulates tumor cells to secrete IL8

[24] , leading to a vicious feedback of hypoxia in the tumor microenvironment, IL8 secretion, and vascular disorder. Therefore, inhibiting IL8 may be an effective treatment for correcting vascular disorder in the tumor microenvironment.

[0003] JWA is a tumor suppressor gene that can inhibit the growth and metastasis of melanoma, gastric cancer, breast cancer and other malignant phenotypes[25-27]. JWA regulates AMPK / FOXO3a / UQCRC2 signals, promotes mitochondrial metabolic reprogramming, improves hypoxia in the tumor microenvironment, and thus inhibits tumor metastasis

[28] . The anti-tumor peptide JP1 designed based on the JWA functional sequence can effectively inhibit melanoma metastasis

[29] . However, the mechanism by which the anti-tumor peptide JP1 inhibits tumor metastasis is still unclear, and whether the anti-tumor peptide JP1 can be used as a synergist of existing anti-tumor drugs also needs further exploration and research. In this regard, the inventor's research group has the latest research results and applied for the patent of this invention based on them.

[0004] References

[0005] 1.Hall WA, Paulson E, Li XA, Erickson B, Schultz C, Tree A, et al. Magneticresonance linear accelerator technology and adaptive radiation therapy: An overview for clinicians. CA: a cancer journal for clinicians.

[0006] 2022;72(1):34-56.

[0007] 2.Chong C, Coukos G, and Bassani-Sternberg M. Identification of tumorantigens with immunopeptidomics.

[0008] Nature biotechnology.2021.

[0009] 3.Sung H,Ferlay J,Siegel RL,Laversanne M,Soerjomataram I,Jemal A,etal.Global Cancer Statistics

[0010] 2020:GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36Cancers in 185Countries.CA:

[0011] a cancer journal for clinicians.2021;71(3):209-49.

[0012] 4.Massague J,and Ganesh K.Metastasis-Initiating Cells andEcosystems.Cancer discovery.

[0013] 2021;11(4):971-94.

[0014] 5.Abdul Pari AA,Singhal M,and Augustin HG.Emerging paradigms inmetastasis research.The Journal ofexperimental medicine.2021;218(1).

[0015] 6.Massague J,and Obenauf AC.Metastatic colonization by circulatingtumour cells.Nature.

[0016] 2016;529(7586):298-306.

[0017] 7.Klein CA.Cancer progression and the invisible phase of metastaticcolonization.Nature reviews Cancer.

[0018] 2020;20(11):681-94.

[0019] 8.Yip RKH,Rimes JS,Capaldo BD,Vaillant F,Mouchemore KA,Pal B,etal.Mammary tumour cellsremodel the bone marrow vascular microenvironment tosupport metastasis.Nature communications. 2021;12(1):6920.

[0021] 9.Tavora B,Mederer T,Wessel KJ,Ruffing S,Sadjadi M,Missmahl M,etal.Tumoural activation ofTLR3-SLIT2 axis in endothelium drivesmetastasis.Nature.2020;586(7828):299-304.

[0022] 10.Eelen G,Treps L,Li X,and Carmeliet P.Basic and Therapeutic Aspectsof Angiogenesis Updated.

[0023] Circulation research.2020;127(2):310-29.

[0024] 11.Bakir B,Chiarella AM,Pitarresi JR,and Rustgi AK.EMT,MET,Plasticity,and Tumor Metastasis.Trendsin cell biology.2020;30(10):764-76.

[0025] 12.Vieugue P,and Blanpain C.Recording EMT Activity by Lineage Tracingduring Metastasis.

[0026] Developmental cell.2020;54(5):567-9.

[0027] 13.Genova T,Grolez GP,Camillo C,Bernardini M,Bokhobza A,Richard E,etal.TRPM8 inhibits endothelialcell migration via a non-channel function bytrapping the small GTPase Rap1.The Journal of cell biology.

[0028] 2017;216(7):2107-30.

[0029] 14.Xu Z,Guo C,Ye Q,Shi Y,Sun Y,Zhang J,et al.Endothelial deletion ofSHP2 suppresses tumorangiogenesis and promotes vascular normalization.Naturecommunications.2021;12(1):6310.

[0030] 15.La Porta S,Roth L,Singhal M,Mogler C,Spegg C,Schieb B,etal.Endothelial Tie1-mediatedangiogenesis and vascular abnormalization promotetumor progression and metastasis.The Journal ofclinical investigation.2018;128(2):834-45.

[0031] 16.Cartier A,Leigh T,Liu CH,and Hla T.Endothelial sphingosine 1-phosphate receptors promote vascularnormalization and antitumortherapy.Proceedings of the National Academy of Sciences of the UnitedStatesof America.2020;117(6):3157-66.

[0032] 17.Park JS,Kim IK,Han S,Park I,Kim C,Bae J,et al.Normalization ofTumor Vessels by Tie2 Activationand Ang2 Inhibition Enhances Drug Deliveryand Produces a Favorable Tumor Microenvironment.Cancercell.2016;30(6):953-67.

[0033] 18.Yuen KC,Liu LF,Gupta V,Madireddi S,Keerthivasan S,Li C,et al.Highsystemic and tumor-associatedIL-8 correlates with reduced clinical benefit ofPD-L1 blockade.Nature medicine.2020;26(5):693-8.

[0034] 19.Gao S,Jiang J,Jin C,Gao J,Xiong D,Yang P,et al.Interleukin-8 as acandidate for thymomaidentification and recurrence surveillance.Naturecommunications.2020;11(1):4881.

[0035] 20.Xu Y,Ren W,Li Q,Duan C,Lin X,Bi Z,et al.LncRNA Uc003xsl.1-mediatedactivation of theNF-kappaB / IL8 axis promotes progression of triple-negativebreast cancer.Cancer research.2021.

[0036] 21.Han ZJ,Li YB,Yang LX,Cheng HJ,Liu X,and Chen H.Roles of the CXCL8-CXCR1 / 2 Axis in theTumor Microenvironment and Immunotherapy.Molecules.2021;27(1).

[0037] 22.Kim ES,Nam SM,Song HK,Lee S,Kim K,Lim HK,et al.CCL8 mediatescrosstalk between endothelialcolony forming cells and triple-negative breastcancer cells through IL-8,aggravating invasionandtumorigenicity.Oncogene.2021;40(18):3245-59.

[0038] 23.Zhang C,Gao Y,Du C,Markowitz GJ,Fu J,Zhang Z,et al.Hepatitis B-Induced IL8 PromotesHepatocellular Carcinoma Venous Metastasis andIntrahepatic Treg Accumulation.Cancer research.

[0039] 2021;81(9):2386-98.

[0040] 24.Watanabe K,Shiga K,Maeda A,Harata S,Yanagita T,Suzuki T,etal.Chitinase 3-like 1 secreted fromcancer-associated fibroblasts promotestumor angiogenesis via interleukin-8 secretion in colorectal cancer.

[0041] International journal of oncology.2022;60(1).

[0042] 25.Lu J,Tang Y,Farshidpour M,Cheng Y,Zhang G,Jafarnejad SM,et al.JWAinhibits melanomaangiogenesis by suppressing ILK signaling and is anindependent prognostic biomarker for melanoma.

[0043] Carcinogenesis.2013;34(12):2778-88.

[0044] 26.Wang S,Wu X,Chen Y,Zhang J,Ding J,Zhou Y,et al.Prognostic andpredictive role of JWA and XRCC1

[0045] expressions in gastric cancer.Clinical cancer research:an officialjournal of the American Association forCancer Research.2012;18(10):2987-96.

[0046] 27.Liang Y,Qian C,Xie Y,Huang X,Chen J,Ren Y,et al.JWA suppressesproliferation intrastuzumab-resistant breast cancer by downregulatingCDK12.Cell death discovery.2021;7(1):306.

[0047] 28.Wang X,Ding K,Wang Z,Li A,Chen D,Zhou J.JWA regulates energymetabolism reprogramming andinhibits migration of pancreatic cancer cell.JNanjing Med Univ.2019;39(12):1728-36.

[0048] 29.Cui J,Shu C,Xu J,Chen D,Li J,Ding K,et al.JP1 suppressesproliferation and metastasis of melanomathrough MEK1 / 2 mediated NEDD4L-SP1-Integrin alphavbeta3 signaling.Theranostics.

[0049] 2020;10(18):8036-50. Summary of the invention

[0050] The main purpose of the present invention is to propose an application of JWA polypeptide in the preparation of anti-tumor drug synergistic enhancers in view of the problems existing in the prior art, which can improve the hypoxic state of the tumor microenvironment, promote the normalization of tumor blood vessels to inhibit the initiation and occurrence of tumor metastasis, and can be used in combination with chemotherapy drugs to increase the effective perfusion amount of drugs in the tumor, exert a synergistic effect, and provide new clinical drug possibilities for the treatment of tumors.

[0051] The technical solution of the present invention to solve the technical problem is as follows:

[0052] A use of a polypeptide, characterized in that the use is used for preparing an anti-tumor drug synergist;

[0053] The amino acid sequence of the polypeptide is shown in I or II:

[0054] I: FPGSDRF-Z;

[0055] II: X-FPGSDRF-Z;

[0056] Wherein, the amino acid S is phosphorylated, and X and Z are amino acids or amino acid sequences, respectively;

[0057] X is selected from one of F, (R)9, (R)9-F, 6-aminocaproic acid, 6-aminocaproic acid-F, 6-aminocaproic acid-(R)9, and 6-aminocaproic acid-(R)9-F;

[0058] Z is selected from (G) n -RGD, A-(G) n -RGD, n is an integer greater than or equal to 0, and the value range of n is 0-10.

[0059] Preferably, the function of the anti-tumor drug synergist is to improve the hypoxia of the tumor microenvironment by promoting oxidative phosphorylation of tumor cells and thus reducing the secretion of IL8, and to improve the hypoxia of the tumor microenvironment by regulating the mitochondrial metabolic reprogramming of tumor cells through the AMPK / FOXO3a / UQCRC2 signaling pathway.

[0060] Preferably, the function of the anti-tumor drug synergist is to promote the normalization of tumor blood vessels by inhibiting IL8, reduce the chance of tumor cells entering blood vessels, and thus inhibit the initiation and occurrence of tumor metastasis.

[0061] Preferably, the function of the anti-tumor drug synergist is to increase the effective perfusion amount of the drug in the tumor.

[0062] Preferably, the anti-tumor drug targeted by the anti-tumor drug synergist is a chemical drug, antibody drug, or cell drug used for tumor treatment.

[0063] More preferably, the anti-tumor drug targeted by the anti-tumor drug synergist is paclitaxel.

[0064] Preferably, the tumor targeted by the anti-tumor drug synergist is a pan-solid tumor having at least one of the following characteristics:

[0065] Feature 1: hypoxia in the tumor microenvironment, disordered vascular distribution, and low intratumoral drug perfusion;

[0066] Feature 2: Mitochondrial energy metabolism in tumor cells is disrupted, with decreased oxidative phosphorylation and enhanced glycolysis metabolism;

[0067] Feature 3: Abnormal increase in IL8 secretion and destruction of the integrity of the vascular wall within the tumor.

[0068] More preferably, the tumor targeted by the anti-tumor drug synergist is melanoma or lung cancer.

[0069] Preferably, the N-terminus of the polypeptide is modified by acetylation, and the C-terminus is modified by amidation; the amino acids of the polypeptide are L-type natural amino acids or D-type non-natural amino acids.

[0070] Preferably, the amino acid sequence of the polypeptide is FPGSDRF-RGD, wherein the amino acid S is phosphorylated.

[0071] The polypeptide involved in the present invention is a part of the series of polypeptides recorded in the Chinese invention patent with patent number CN201310178099X and authorization announcement number CN103239710B. The inventor has found through practical research that the above polypeptide can regulate mitochondrial metabolic reprogramming through the AMPK / FOXO3a / UQCRC2 signaling pathway, and reduce the secretion of interleukin-8 (IL8) by promoting oxidative phosphorylation of tumor cells, thereby improving the hypoxia of the tumor microenvironment; the oxygen-rich tumor microenvironment inhibits the secretion of IL8 by tumor cells and promotes the normalization of tumor blood vessels; blood vessel normalization can make blood vessels mature and distribute normally, so that the tumor microenvironment forms a benign feedback of blood vessel regularization, full perfusion, and oxygen-rich microenvironment, preventing tumor cells from entering blood vessels and inhibiting the initiation of metastasis. In addition, the above polypeptide combined with paclitaxel (PTX) can maintain a certain blood vessel density in the tumor, promote the normalization of tumor blood vessel growth, increase the delivery of oxygen and drugs, and enhance the anti-tumor effect. Therefore, the above-mentioned polypeptides can be used as synergistic enhancers of anti-tumor drugs, providing new technical means to overcome the bottleneck of poor efficacy caused by reduced intratumor drug infusion due to hypoxia in the tumor microenvironment, abnormal vascular structure and distribution, increased IL8 expression, etc. in the treatment of tumors, especially solid tumors, and have good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1The diagram shows the implementation process and results of Example 1 of the present invention. The key points of each diagram are as follows: (A) Schematic diagram of B16F10 (melanoma cells) / LLC (lung adenocarcinoma cells) allogeneic transplantation, a two-stage model of active metastasis after Ctrl-R or JP1 treatment. (BC) Quantitative results (n=6) of mice with lung metastasis after surgical resection of primary B16F10 (B) or LLC tumors (C) for designated treatment. (DE) Kaplan-Meier survival analysis (n=10) results of B16F10 (D) and LLC (E) tumor mice. (F) Flow cytometric detection of GFP+B16F10 cells transfected with GFP-specific plasmids. (G) Schematic diagram of CTC clone counting and flow cytometric analysis. (H) Quantitative results (n=6) of CTC colony formation after Ctrl-R or JP1 treatment. (I) After Ctrl-R or JP1 treatment, each 1.5×10 7 Results of CTC quantification of blood cells (n=6). (JK) CTCs from 6 mice were subjected to migration and invasion assays, and the quantitative results of migrating cells (J) and invasive cells (K) per 30,000 cells were plotted. (*P<0.05; **P<0.01; ns: the difference was not statistically significant).

[0073] Figure 2 The figures are the results of Example 1 of the present invention. The key points of each figure are as follows: (AB) B16F10 tumor body weight and tumor volume measurement results after treatment with Ctrl-R or JP1. (C) Representative lung HE staining images of each group, used to detect the starting point of B16F10 tumor metastasis, scale: 500μm. (DE) LLC tumor body weight and tumor volume measurement results after treatment with Ctrl-R or JP1. (F) Representative lung HE staining images of each group, used to detect the starting point of LLC tumor metastasis, scale: 500μm.

[0074] Figure 3 The results of Example 1 of the present invention are shown in the figure. The key points of each figure are as follows: (A) Representative images of CTC clone formation after Ctrl-R or JP1 treatment. (B) Representative images of CTC quantification per 1.5×107 blood cells by FACS analysis after Ctrl-R or JP1 treatment. (C) Representative images of CTC migration after Ctrl-R or JP1 treatment. (D) Representative images of CTC invasion after Ctrl-R or JP1 treatment.

[0075] Figure 4The results of Example 2 of the present invention are shown in the figure. The key points of each figure are as follows: (A) Representative fluorescence images of α-SMA (green), claudin5 (green), desmin (green), CD31 (red) and DAPI nuclear staining of B16F10 tumor nodules treated with Ctrl-R or JP1. (BD) Result graphs of α-SMA coverage (B), claudin5 coverage (C), and desmin coverage (D) of the stromal microenvironment of B16F10 tumor nodules, scale bar: 100μm. (E) Representative fluorescence images of α-SMA (green), claudin5 (green), desmin (green), CD31 (red) and DAPI nuclear staining of LLC tumor nodules treated with Ctrl-R or JP1. (FH) Result graphs of α-SMA coverage (F), claudin5 coverage (G), and desmin coverage (H) of LLC tumor nodules, scale bar: 100μm. (IJ) Schematic diagram of vascular permeability analysis (I) and quantitative graph of vascular permeability (J). (*P<0.05; **P<0.01).

[0076] Figure 5 The results of Example 3 of the present invention are shown in the figure. The key points of each figure are as follows: (A) Heat map of 60 genes involved in tumor vascular normalization in B16F10 cells treated with Ctrl-R or JP1. (BC) Quantitative graph of IL8 protein in B16F10 (B) and LLC (C) cells after treatment with specified concentrations of JP1 for 48 hours. (DE) Western Blot detection of IL8 protein extracted from B16F10 (D) and LLC (E) tumor nodules, and quantitative results of IL8 protein concentration. (F) Representative images of human melanocytic nevi and melanoma stained with immunofluorescence of α-SMA (green) and IL8 (red), scale bar: 200μm. (GH) Quantitative determination of IL8 between human melanocytic nevi and melanoma + Area (G) and α-SMA +Area (H). (I) Schematic diagram of B16F10(IL8WT) and B16F10(IL8KO) cell xenografts treated with Ctrl-R or JP1 (n=6). (JK) Tumor growth curves and tumor / body weight (%) results of each group are shown. (LM) Representative fluorescence images of α-SMA (green), CD31 (red), and DAPI nuclear staining in each group (L), and the quantification of α-SMA coverage is shown in the figure (M), and the scale bar is 100μm. (NO) Representative fluorescence images of desmin (green), CD31 (red), and DAPI nuclear staining in each group (N); the figure (O) shows the quantification of desmin coverage, and the scale bar is 100μm. (*P<0.05; **P<0.01; ***P<0.001; ns: the difference is not statistically significant).

[0077] Figure 6 The figures are the results of Example 3 of the present invention. The key points of each figure are as follows: (AB) Representative Western Blot analysis of whole cell lysates from B16F10 (A) and LLC (B) cells after treatment with specified concentrations of JP1 to evaluate the expression of IL8. (CD) Representative Western Blot analysis results of IL8 protein extracted from B16F10 (C) and LLC (D) tumor nodules. (EF) Quantitative results of IL8 mRNA after B16F10 (E) and LLC (F) cells were treated with specified concentrations of JP1. (GH) The expression of IL8 mRNA in B16F10 (G) and LLC (H) tumor tissues was detected by qPCR, and IL-8 mRNA expression was quantitatively detected. Representative Western Blot analysis showed that IL8 knockout was effective. (J) Body weight of mice in each group. (K) Representative Western Blot analysis of IL8 protein extracted from IL8WT and IL8KO B16F10 tumors after Ctrl-R or JP1 treatment (*P < 0.05; **P < 0.01; ***P < 0.001; ns: the difference was not statistically significant).

[0078] Figure 7The results of Example 4 of the present invention are shown in the figure. The key points of each figure are as follows: (AB) After 48 hours of treatment with JP1 at a specified concentration, the oxidative phosphorylation levels of B16F10 (A) and LLC (B) cells were analyzed by OCR. (CD) Representative immunohistochemical staining of HIF1α in B16F10 tumor nodules (C), HIF1α intensity quantification (D), scale bar: 100μm. (EF) Representative immunohistochemical staining of HIF1α in LLC tumor nodules (E), HIF1α intensity quantification (F), scale bar: 100μm. (GH) In B16F10 (G) and LLC (H) cells, HIF1α was detected by Western Blot after being treated with JP1 at a specified concentration for 48 hours. (IJ) HIF1α protein was extracted from B16F10 (I) and LLC (J) tumor nodules for Western Blot detection; quantitative results of HIF1α protein concentration. (**P<0.01; ***P<0.001; ns: the difference was not statistically significant).

[0079] Figure 8 The results of Example 4 of the present invention are shown in Figure 1. The key points of each figure are as follows: (AB) Representative Western Blot analysis of whole cell lysates from B16F10 (A) and LLC (B) cells after treatment with the specified concentration of JP1 to evaluate the expression of HIF1α. (CD) Representative Western Blot analysis of HIF1α protein extracted from B16F10 (C) and LLC (D) tumor nodules. (EF) Quantification of HIF1α mRNA in B16F10 (E) and LLC (F) cells after treatment with the specified concentration of JP1. (GH) qPCR method was used to detect the mRNA expression of HIF1α in B16F10 (G) and LLC (H) tumors, and the results of quantitative detection of HIF1α mRNA expression were shown. (*P<0.05; **P<0.01; ***P<0.001; ns: the difference was not statistically significant).

[0080] Fig. 9The results of Example 5 of the present invention are shown in the figure. The main points of each figure are as follows: (AB) Western Blot (A) and quantitative RT-PCR (B) analysis of IL8 levels in B16F10 and LLC cells. (CD) Western Blot (C) and quantitative RT-PCR (D) analysis of IL8 levels in B16F10 and LLC cells after 24 hours of Ctrl-R or JP1 treatment under normoxic or hypoxic conditions. (E) Schematic diagram of B16F10 cell allogeneic transplantation Ctrl-R or JP1 treatment under normoxic or hypoxic conditions (n=6). (FG) Tumor growth curves and tumor / body weight (%) result graphs of each group are shown respectively. (HI) Representative immunohistochemical staining of HIF1α in B16F10 tumor nodules of each group (H), quantitative graph of HIF1α intensity (I), scale bar is 50μm. (JK) Western Blot detection of HIF1α (J) and IL8 (K) protein expression results in B16F10 tumor nodules of each group. (LN) Representative fluorescence images of α-SMA (green), desmin (green), CD31 (red), and DAPI nuclear staining in each group (L); Quantification of α-SMA (M) and desmin (N) coverage, scale bar: 50 μm. (*P<0.05; **P<0.01; ***P<0.001; ns: no statistically significant difference).

[0081] Fig.10 The results of Example 5 of the present invention are shown in the figure. The key points of each figure are as follows: (A) Body weight of mice in each group. (B) Representative Western Blot analysis results of HIF-1α and IL8 proteins extracted from B16F10 tumor nodules treated with Ctrl-R or JP1 under normoxic and hypoxic conditions. (C) Representative Western Blot analysis of whole cell lysates from B16F10 and LLC cells after treatment with the specified concentrations of JP1 to evaluate the expression of p-AMPK, AMPK, FOXO3a, UQCRC2, HIF1α and IL8.

[0082] Fig.11The results of Example 6 of the present invention are shown in the figure. The main points of each figure are as follows: (A) Schematic diagram of the B16F10 cell xenograft model. Mice were intraperitoneally injected with JP1 and PTX alone or in combination and related solvents. (BC) Tumor growth curves and tumor / body weight (%) results of each group. (DG) Representative fluorescent images of α-SMA (green), desmin (green), CD31 (red), and DAPI nuclear staining in each group; quantitative graphs of α-SMA, desmin, and CD31 coverage, scale bar: 50μm. (H) Representative HIF1α immunohistochemical staining images in B16F10 tumor nodules in each group, scale bar: 50μm. (I) Quantitative results of HIF1α intensity. (J) Quantitative results of vascular permeability after treatment with solvent, JP1, PTX, and JP1 combined with PTX. (K) According to high-performance liquid chromatography analysis, the PTX standard solution has a peak at the retention time. (L) Quantitative results of PTX concentration in each group of tumors. (M) Illustration of the tumor microenvironment status after treatment with solvent, PTX, and JP1. (N) The working mode of JP1 promoting tumor vascular normalization and thus inhibiting metastasis initiation. (*P<0.05; **P<0.01; ***P<0.001; ns: the difference was not statistically significant).

[0083] Fig.12 The results of Example 6 of the present invention are shown in the figure. The key points of each figure are as follows: (A) Representative HPLC analysis image of PTX at a specified concentration. (B) Linear standard curve of PTX concentration and peak area. (CF) Representative HPLC analysis image of PTX in a specific group. DETAILED DESCRIPTION

[0084] The present invention is further described in detail below with reference to the accompanying drawings and in combination with the examples. However, the present invention is not limited to the examples given. The materials, methods, experimental model conditions and other contents used in each embodiment are attached after each embodiment. In addition, unless otherwise specified, the materials and experimental methods used are conventional materials and conventional experimental methods.

[0085] Example 1: JP1 inhibits metastasis by reducing tumor cell entry into blood vessels

[0086] To determine the role of JP1 in the initiation of metastasis, an active metastasis model was established by surgical resection of the primary tumor, a melanoma model was established using B16F10 cells, and a lung cancer model was established using LLC cells. Figure 1As shown in Figure A, group a is the Ctrl-R group, which had no JP1 intervention from beginning to end; group b was JP1 intervention from the beginning, but JP1 treatment was stopped after the primary tumor was resected; group c was not JP1 intervention at the beginning, but JP1 treatment was given after the primary tumor was resected; group d was the JP1 intervention group from the beginning of tumor bearing, and JP1 treatment was given from beginning to end. Among them, the dosage of JP1 was: 50 mg / kg, intraperitoneal injection, once a day. After the primary tumor was resected, mice developed multi-organ metastasis, the most common of which was lung metastasis. Subsequently, lung tissue staining was performed to obtain the incidence of lung metastasis, and it was found that 5 out of 6 mice in group a (Ctrl-R group) had lung metastasis, while only 1 mouse in group d (JP1 intervention group from the beginning of tumor bearing) had lung metastasis in the melanoma model. Importantly, in group b, where JP1 treatment was stopped after the primary tumor was resected, only 1 out of 6 mice had lung metastasis, while in group c, where JP1 treatment was given after the primary tumor was resected, 4 out of 6 mice had lung metastasis ( Figure 1 Figure B, and Figure 2 This observation was further confirmed in a lung cancer model ( Figure 1 Figure C, and Figure 2 DF graph). In addition, a parallel survival model was established. The study found that compared with the control group, JP1 intervention prolonged the survival time of mice in melanoma and lung cancer models. The JP1 full-course intervention group had the best effect, followed by the JP1 intervention group during the tumor-bearing period. The survival time of these two groups of mice was significantly longer than that of the control group. After the tumor was removed, the JP1 intervention group also had a certain improvement on the survival of mice, but the effect was not as good as that of the early intervention and full-course intervention groups ( Figure 1 These data indicate that JP1 can inhibit the occurrence of tumor metastasis.

[0087] To further verify this hypothesis, a melanoma-bearing model was constructed using GFP-labeled B16F10 cells, and CTCs ( Figure 1 F and G of Figure 1). Among them, the Ctrl-R group did not have JP1 intervention from beginning to end, and the JP1 group was treated with JP1 from beginning to end, and the dosage of JP1 was the same as above. Cell clone analysis showed that 4 out of 6 CTCs extracted from mice in the Ctrl-R group formed clone clusters in vitro, while only 1 out of 6 mice in the JP1 group formed clone clusters ( Figure 1 H graph, Figure 3 In addition, FACS analysis showed that the number of tumor cells from the primary tumor entering the circulatory system was significantly reduced after JP1 treatment ( Figure 1 I-graph, Figure 3 Afterwards, migration and invasion experiments were performed on CTCs, and it was found that the migration ability of CTCs treated with JP1 was weakened ( Figure 1J diagram, Figure 3 C), but the invasive ability remained unchanged ( Figure 1 K-chart, Figure 3 Figure D).

[0088] These results suggest that JP1 inhibits metastasis initiation by reducing tumor cell entry into the vasculature, but has a weaker inhibitory effect on the invasive ability of tumor cells.

[0089] Note: The sequence of JP1 is FPGSDRF-GGGG-RGD, in which the amino acid S is phosphorylated.

[0090] Example 2: JP1 promotes normalization of tumor blood vessels

[0091] In order to study the function of JP1 in reducing the entry of tumor cells into blood vessels, this example evaluates the morphology of tumor blood vessels extracted from melanoma and lung cancer samples, wherein the Ctrl-R group was not intervened by JP1 from beginning to end, and the JP1 group was treated with JP1 from beginning to end, and the dosage of JP1 was the same as that in Example 1. Immunofluorescence staining showed that in melanoma (B16F10), the coverage of α-SMA (mural cell marker), Claudin 5 (endothelial cell marker), and Desmin (pericyte marker) increased after JP1 treatment ( Figure 4 This observation was further confirmed in lung cancer (LLC) ( Figure 4 These results indicate that, compared with the control group, the tumor exhibited a phenotype close to normal vascular structure after JP1 treatment. Further vascular permeability experiments were performed and it was found that JP1 reduced vascular permeability compared with Ctrl-R treatment ( Figure 4 Figure I and Figure J).

[0092] In summary, JP1 can reduce the chance of tumor cells entering blood vessels by promoting the normalization of tumor blood vessels, thereby inhibiting the occurrence of tumor metastasis.

[0093] Example 3: JP1 promotes normalization of tumor blood vessels by inhibiting IL8

[0094] In order to obtain the downstream target molecules of JP1, angiogenesis array analysis was performed on the differentially regulated genes after JP1 treatment, wherein the Ctrl-R group was not intervened by JP1 from beginning to end, and the JP1 group was treated with JP1 from beginning to end, and the dosage of JP1 was the same as that in Example 1. The results showed that IL8 was the most downregulated gene ( Figure 5 Western blot analysis showed that as the concentration of JP1 increased, IL8 decreased significantly ( Figure 5 Figures B and C of Figure 6A and B of the study); this finding was subsequently confirmed in mouse tumor samples ( Figure 5 Figure D and Figure E, Figure 6 RT-PCR quantitative analysis also confirmed the results of in vitro and in vivo experiments ( Figure 6 EH Figures). We further examined the expression of IL8 in human melanocytic nevus and melanoma tissue microarrays. As expected, the expression of IL8 in melanoma was significantly higher than that in melanocytic nevus ( Figure 5 In contrast, the coverage of parietal cells in melanoma tissue was low ( Figure 5 These results suggest that IL8 is inversely correlated with vascular normalization upon inhibition of JP1.

[0095] To further explore how IL8 is regulated by JP1, Crispr-Cas9 was used to knock out the IL8 gene in B16F10 cells ( Figure 6 I), and observed whether JP1 could still promote normalization of tumor blood vessels in the absence of IL8. Among them, the Ctrl-R group was not intervened by JP1 from beginning to end, and the JP1 group was treated with JP1 from beginning to end, and the dosage of JP1 was the same as that in Example 1. Then, a melanoma tumor model was constructed using B16F10 cells containing IL8WT and IL8KO ( Figure 5 The results showed that the growth rate of IL8KO B16F10 cells was significantly lower than that of IL8WT B16F10 cells. In addition, compared with IL8WT B16F10 cells, JP1 significantly inhibited the growth of melanoma, but had no significant inhibitory effect on IL8KO B16F10 cells ( Figure 5 The J and K graphs of Figure 6 JP1 promoted tumor vascular normalization by increasing the coverage of pericytes and endothelial cells in IL8WT B16F10; however, knockout of IL8 significantly improved tumor vascular normalization, while JP1 treatment did not enhance the vascular normalization index ( Figure 5 LO diagram).

[0096] Taken together, these data suggest that JP1 promotes tumor vascular normalization by inhibiting IL8.

[0097] Example 4: JP1 promotes tumor oxidative phosphorylation and improves tumor microenvironment hypoxia

[0098] Hypoxia is an inevitable result of tumor development, and it has been reported that hypoxia stimulates IL8 secretion. It is known that the JWA gene can inhibit pancreatic cancer metastasis by promoting aerobic respiration to improve tumor microenvironment hypoxia. In order to verify whether JP1 can play a role in promoting oxidative phosphorylation of tumor cells similar to the JWA gene, this example conducted an oxygen consumption rate (OCR) analysis. Figure 7 As shown in Figures A and B, JP1 can effectively promote oxidative phosphorylation in B16F10 and LLC cells. HIF1α staining of melanoma and lung cancer model tumor samples showed that JP1 significantly improved the hypoxia of the tumor microenvironment ( Figure 7 Immunoblotting analysis showed that HIF1α was significantly decreased in B16F10 and LLC cells with increasing JP1 concentrations ( Figure 7 The G and H graphs, Figure 8 Furthermore, this finding was subsequently confirmed in mouse tumor samples ( Figure 7 The I and J graphs of Figure 8 RT-PCR quantitative analysis further verified the regulatory effect of JP1 on HIF1α in vitro and in vivo experiments ( Figure 8 EH diagram). Note: In the control experiment involving the Ctrl-R group and the JP1 group in this example, the Ctrl-R group was not intervened by JP1 from beginning to end, and the JP1 group was treated with JP1 from beginning to end, and the dosage of JP1 was the same as that in Example 1.

[0099] These results indicate that JP1 can effectively promote tumor oxidative phosphorylation and improve tumor microenvironment hypoxia.

[0100] Example 5: Hypoxia induces tumor cells to secrete IL8

[0101] To determine the effect of hypoxia in the tumor microenvironment on IL8 expression, this example used B16F10 and LLC cells to establish normoxic (oxygen content in air 21%) and hypoxic (oxygen content in air 8%) models, and found that IL8 expression increased under hypoxic conditions ( Fig. 9 In addition, JP1 significantly inhibited the expression of HIF1α under normoxic conditions; while under hypoxic conditions, the regulatory effect of JP1 on IL8 was weakened ( Fig. 9 To further prove this hypothesis, this example established a melanoma tumor-bearing model under normoxic and hypoxic conditions ( Fig. 9 The results showed that, compared with the significant inhibitory effect of JP1 on tumor growth under normoxic conditions, JP1 had no significant inhibitory effect on tumor growth under hypoxic conditions ( Fig. 9 The F and G graphs, Fig.10Figure A). HIF1α staining of mouse tumors showed that under normoxic conditions, JP1 significantly improved the hypoxia of the tumor microenvironment; however, under hypoxic conditions, the hypoxia in the tumor was severe and JP1 could not reverse the hypoxia of the tumor microenvironment ( Fig. 9 This result was confirmed by immunoblotting analysis ( Fig. 9 J diagram, Fig.10 In addition, under hypoxic conditions, IL8 expression in tumor samples was significantly increased ( Fig. 9 K-chart, Fig.10 Vascular morphology evaluation showed that under hypoxic conditions, the vascular normalization index was lower than that under normoxic conditions, regardless of whether JP1 was treated or not ( Fig. 9 L and M of the figure). Note: In this example, the Ctrl-R group was not intervened by JP1 from beginning to end, and the JP1 group was treated with JP1 from beginning to end, and the dosage of JP1 was the same as that in Example 1; Normoxia refers to the normal oxygen condition, and Hypoxia refers to the hypoxic condition.

[0102] These results suggest that JP1 improves tumor microenvironment hypoxia by promoting oxidative phosphorylation in tumor cells and thereby reducing the secretion of IL8.

[0103] In addition, in terms of mechanism, this example verifies the expression of related molecular proteins in B16F10 and LLC cells. As we expected, JP1 regulates mitochondrial metabolic reprogramming of B16F10 and LLC cells through the AMPK / FOXO3a / UQCRC2 signaling pathway, thereby improving the hypoxic state of the tumor microenvironment ( Fig.10 Figure C).

[0104] Example 6: JP1 promotes intratumoral delivery of paclitaxel (PTX) and enhances anti-tumor effects

[0105] Normalization of tumor vascular structure reduces its permeability, which can reduce the invasion of tumor cells into blood vessels and inhibit tumor metastasis. In addition, normalization of tumor vascular distribution also promotes the entry of drugs into the tumor and enhances the anti-tumor effect. In order to evaluate the effect of JP1 in promoting the normalization of tumor blood vessels so that drugs can enter the tumor, this example completes the combined treatment of JP1 and paclitaxel (PTX) in a melanoma model ( Fig.11 The results showed that the anti-tumor effects of JP1 and PTX alone were 37% and 49.7%, respectively, and the inhibitory effect of combined treatment was 65.4%, suggesting that JP1 combined with PTX has a better anti-tumor effect ( Fig.11 Figure B and Figure C), that is, JP1 can produce a synergistic effect on PTX in terms of anti-tumor effect. Tumor vascular morphology verification shows that compared with the effect of JP1 in promoting the normalization of tumor blood vessels, PTX promotes the normalization of blood vessels within the range of inhibiting the total number of blood vessels ( Fig.11 DG graph). In addition, this example performed hypoxia analysis on tumor tissue and found that although PTX can promote the normalization of tumor blood vessels, its inhibitory effect on blood vessels cannot improve the hypoxic state, while the combined treatment of JP1 and PTX significantly improved the hypoxic state of the tumor microenvironment ( Fig.11 H and I), and vascular permeability experiments further verified this observation ( Fig.11 In order to further prove that JP1 promotes drug delivery into the tumor, the content of PTX in the tumor was detected by HPLC in this example. It was found that compared with the combined treatment with JP1, the delivery of PTX into the tumor was significantly reduced after 11 days of PTX treatment, while the combined treatment with JP1 and PTX significantly increased the delivery of PTX in the tumor ( Fig.11 KN, Fig.12 ). Note: In this example, the Vehicle group was the control group without JP1 and PTX intervention; the JP1 group was treated with JP1 only, with a dose of 50 mg / kg, intraperitoneal injection, once a day; the PTX group was treated with PTX only, with a dose of 10 mg / kg, intraperitoneal injection, twice a week (Monday and Thursday); the JP1+PTX group was a group treated with JP1 and PTX together, with the dose of JP1 being the same as the JP1 group, and the dose of PTX being the same as the PTX group.

[0106] These results indicate that PTX inhibits metastasis initiation by promoting tumor vascular normalization, but its inhibitory effect on blood vessels reduces the delivery of drugs into tumors; the combination of JP1 and PTX can not only promote tumor vascular normalization to inhibit metastasis initiation, but also increase the delivery of PTX into tumors.

[0107] Example 7

[0108] In this example, each JWA polypeptide shown in the table below was used for detection according to Examples 1 to 6, and the amino acid S of each JWA polypeptide was phosphorylated.

[0109]

[0110] Due to space limitations, this example does not list specific experimental data. The experimental data obtained show that the test results of the above JWA polypeptides are basically consistent with those of JP1.

[0111] in conclusion

[0112] As can be seen from the above embodiments, the present invention confirms that the series of JWA polypeptides represented by JP1: (1) improve the hypoxia of the tumor microenvironment by promoting oxidative phosphorylation of tumor cells and thus reducing the secretion of IL8, and regulate the mitochondrial metabolic reprogramming of tumor cells through the AMPK / FOXO3a / UQCRC2 signaling pathway to improve the hypoxic state of the tumor microenvironment; (2) promote the normalization of tumor vascular structure and intratumoral distribution by inhibiting IL8, reduce the chance of tumor cells entering blood vessels, thereby inhibiting the initiation and occurrence of tumor metastasis; (3) can increase the effective perfusion amount of drugs in the tumor. Therefore, JWA targeting peptides not only exhibit effective anti-tumor activity when used alone, but can also be combined with other therapies such as chemical drugs, antibody drugs, and cell drugs to exert synergistic tumor inhibition. These unique biological characteristics of JWA polypeptides will provide new clinical drug possibilities for the treatment of tumors, especially solid tumors, and have good application prospects.

[0113] The materials, methods, experimental model conditions, etc. used in the above examples are shown below.

[0114] 1. Cell lines and cell culture: Mouse melanoma B16F10 and lung cancer LLC cells were purchased from ATCC (MD, USA). IL8KO (IL8 knockout) B16F10 cells were generated using IL8-specific CRISPR / Cas9 plasmids (synthesized by Corues Biotechnology). Sequencing analysis and western blot experiments confirmed that the gene knockout was complete. GFP-B16F10 cells were generated by GFP-specific plasmids (synthesized by Shanghai Genechem Co., Ltd.). All cell lines were maintained in DMEM medium supplemented with streptomycin 100 μg / ml, penicillin 100 U / ml and 10% fetal bovine serum, and stored in a 37°C, 5% CO2 incubator.

[0115] 2. Mouse allograft tumor model: All care and treatment of experimental mice were approved by the guidelines of the Animal Care and Use Committee of Nanjing Medical University (IACUC: 1811067-1). Experimental mice were purchased from the Shanghai SLAC Laboratory Animal Center and maintained in the Animal Core Facility of Nanjing Medical University. Melanoma growth model: B16F10, IL8WT B16F10, IL8KO B16F10, and GFP-B16F10 cells (5×10 5 ) were injected subcutaneously into C57BL / 6 male mice: Lung cancer growth model: LLC cells (5×10 6 ) were injected subcutaneously into C57BL / 6 male mice. When the tumor volume reached 100 mm 3The mice were randomly divided into groups and intervened at the same time. Body weight and tumor size were measured every other day. After the experiment, the mice were humanely killed and the tumors were measured and recorded. An oxygen concentration controller (purchased from Shanghai Yuyan Instrument Co., Ltd.) created an environment with an oxygen content of 8%, and the mice stayed for 6h / d to establish a hypoxia model. The melanoma / lung cancer active metastasis model was performed using the general protocol described previously.

[0116] 3. CTC (circulating tumor cell) analysis and sorting: GFP-labeled B16F10 cells were used to construct a melanoma model. When the tumor volume reached 2000mm 3 At 4 pm, 500 μl of blood was collected from each mouse to lyse red blood cells (red blood cell lysis buffer was purchased from Fcmacs Biotech Co., Ltd.). FACS analysis was performed using an LSRII flow cytometer (BD Biosciences) to detect CTCs in every 1.5 million cells, and the data were analyzed using FlowJo software (Tree Star Inc.). FACS sorting was performed using an Aria III instrument (BD Biosciences).

[0117] 4. Cell proliferation, migration and invasion analysis: Blood from mice carrying melanoma was collected, red blood cells were lysed, and then directly added to DMEM medium and cultured for 21 days for proliferation experiments. Migration and invasion experiments were performed using CTCs sorted by FACS. In the migration experiment, CTCs were inoculated in Transwell TM The filter (purchased from Corning, USA) was placed in serum-free medium in the upper chamber, and medium containing 10% FBS was added to the lower chamber. After 12 hours, the cells were fixed with methanol for 1 hour, stained with crystal violet (Beyotime, Shanghai, China) for 30 minutes, and counted. For the invasion assay, a layer of matrix (purchased from BD Biosciences) was placed on the membrane of the lower chamber.

[0118] 5. Immunohistochemistry and immunofluorescence staining: After soaking in formalin for 24 hours, tissue specimens were embedded in paraffin and sliced ​​(paraffin slicer, Thermo HM340E). After dewaxing and antigen retrieval, the specimens were blocked with 10% normal goat serum at room temperature for 30 minutes and incubated with HIF1α (CST, 36169T) antibody solution at 4°C with gentle shaking for 24 hours. After DAB staining, the specimens were scanned with a pathological section scanner (Pannoramic MIDI). For double immunofluorescence staining, the mouse CD31 (Servicebio, GB12063) antibody solution was incubated with rabbit α-SMA (Servicebio, GB111364), Claudin 5 (Servicebio, GB11290), and Desmin (Servicebio, GB11081) antibody solutions at 4°C with gentle shaking for 24 hours. The images were scanned after incubation with mouse (red) and rabbit (green) fluorescent secondary antibodies. The staining intensity was analyzed using J-graphs.

[0119] 6. Vascular permeability assay: 50 mg / kg Evans Blue solution was injected into melanoma-bearing mice via the tail vein.

[0120] Blood was collected after 1 hour, and the supernatant was centrifuged and diluted with formamide at 1:100. Evans blue was dissolved in formamide (0ng / ml, 125ng / ml, 250ng / ml, 500ng / ml, 1000ng / ml, 5000ng / ml, 10000ng / ml, 25000ng / ml, 50000ng / ml) to make a standard curve. The absorbance of the supernatant was measured at 620nm, and the concentration of Evans blue in the blood was calculated. After blood collection, the mice were quickly exposed to the heart, and 10ml of 0.9% saline was perfused into the heart to flush the Evans blue in the blood vessels. 200mg of tumor tissue was placed in a 60℃ oven for 5h, 200μl of formamide was added, and it was continuously placed in a 60℃ oven for 18h. The supernatant was centrifuged, the absorbance was measured at 620nm, and the Evans blue content of the tumor tissue was calculated. The formula for calculating vascular permeability is:

[0121] Vascular permeability [μl / (g×h)]=[Evans blue (μg) / tumor dry weight (g)] / [Evans blue concentration in blood (μg / μl)×circulation time (h)].

[0122] 7. Angiogenesis array analysis: Angiogenesis array GS1000 (GSH-ANG-1000-1, Ray Biotech Inc.) was used according to the manufacturer's instructions. Briefly, the slides were taken out of the box and equilibrated to room temperature in a sealed plastic bag for 20-30 min.

[0123] Remove the slide from the plastic bag, peel off the cover film, and air dry for 1-2 hours. Collect the standard or sample and incubate with the array at 4°C with gentle shaking for 24 hours. The chemiluminescent signal is captured by the InnoScan 300 microarray scanner (Innopsys). Data extraction uses the microarray analysis software ScanArray Express.

[0124] 8. Quantitative RT-PCR and Western Blot analysis: Total RNA from cells and tissues was extracted using TRIzon (Thermo Fisher Scientific, 10296010) and reverse transcribed using a reverse transcription kit (Vazyme, R323-01). RT-PCR was performed using SYBR (Vazyme, TSE202) for AB RT-PCR (Q5). Finally, the difference value was calculated by GAPDH standardization.

[0125] The primers used in RT-PCR were: HIF1α-F (ACGTTCCTTCGATCAGTTGTCACC), HIF1α-R

[0126] (GGCAGTGGTAGTGGTGGCATTAG), IL8-F(tcctgctttcctc), IL8-R

[0127] (GGGTGGAAAGGTGTGGAATG), GAPDH-F (gctctctgctcctcctgttttc), GAPDH-R

[0128] (ACGACCAAATCCGTTGACTC). Western Blot analysis was performed as previously reported. Briefly, cells and tissue samples were lysed with cell lysis buffer and tissue protein extraction reagent (purchased from ThermoFisherScientific, 78510), respectively. A total of 40 proteins were processed for subsequent analysis. The antibodies used were: Hif1α (CST, 36169T), IL8 (Abcam, ab106350), p-AMPK (CST, 2535T), AMPK (Abcam, 32047), FOXO3A (Abcam, 53287), UQCRC2 (Abcam, ab203832), Tubulin (Beyotime, AF0001).

[0129] 9. Mitochondrial oxygen consumption rate (OCR) analysis: OCR analysis of B16F10 and LLC cells was performed using Seahorse XFp Analyzer (Seahorse XF96). B16F10 cells (6000) and LLC cells (10000) were seeded onto seahorse plates and placed in growth medium for 24 h. In XF matrix containing 1 mM sodium pyruvate, 2 mM l-glutamine, and 10 mM glucose, oligomycin (1 μM) and FCCP (B16F10: 1.5 μM, LLC: 1 μM) were added in sequence to measure mitochondrial oxygen consumption.

[0130] 10. High performance liquid chromatography analysis: Paclitaxel (PTX) was purchased from Selleck (NSC 125973), HPLC (chromatographic column: Agilent Zorbax Exlipse Plus C18, 100×4.6 mm, 3.5 μM particle size; flow rate: 1 ml / min; wavelength: UV254 nm; mobile phase: CH3OH 0.1% TFA / H2O 0.1% TFA, 0 min: 10: 90, 0-15 min: 10: 90~100: 0, 15-20 min:

[0131] 100:0) to determine the peak time of PTX. 20mg / kg PTX solution was injected into tumor-bearing mice through the tail vein. 200mg of tumor was taken out after 5min and dissolved in 1ml methanol solution. PTX was dissolved in methanol solution (200μg / ml, 100μg / ml, 50μg / ml, 25μg / ml, 12.5μg / ml, 6.25μg / ml, 3.125μg / ml, 1.56μg / ml) to make a standard curve.

[0132] The standard or sample was measured by HPLC to calculate the concentration of paclitaxel in the tumor.

[0133] 11. Statistical analysis: All data were analyzed as mean ± SEM of individual samples using GraphPad Prism8 and SPSS

[0134] 20 software was used for analysis. Unpaired two-tailed Student's t-test or one-way analysis of variance (ANOVA) was used to determine the statistical differences between experimental groups. P < 0.05 was considered statistically significant. (*P < 0.05; **P < 0.01; ***P < 0.001; ns: not significant).

[0135] In addition to the above embodiments, the present invention may also have other implementation modes. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. Use of a combination of a polypeptide and paclitaxel in the preparation of a drug for treating melanoma, wherein the amino acid sequence of the polypeptide is as shown in I or II: I: FPGSDRF-Z; II: X-FPGSDRF-Z; in, The amino acid S is phosphorylated, and X and Z are amino acids or amino acid sequences, respectively; X is selected from one of F, (R)9, (R)9-F, 6-aminocaproic acid, 6-aminocaproic acid-F, 6-aminocaproic acid-(R)9, and 6-aminocaproic acid-(R)9-F; Z is selected from (G) n -RGD, A-(G) n -RGD, n is an integer greater than or equal to 0, and the value range of n is 0-10.

2. The use according to claim 1, characterized in that: The function of the drug is to improve the hypoxia of the tumor microenvironment by promoting oxidative phosphorylation of tumor cells and thus reducing the secretion of IL8, and to improve the hypoxic state of the tumor microenvironment by regulating the mitochondrial metabolic reprogramming of tumor cells through the AMPK / FOXO3a / UQCRC2 signaling pathway.

3. The use according to claim 1, characterized in that: The function of the drug is to promote the normalization of tumor blood vessels by inhibiting IL8, reduce the chance of tumor cells entering blood vessels, and thus inhibit the initiation and occurrence of tumor metastasis.

4. The use according to claim 1, characterized in that: The function of the drug is to increase the effective perfusion amount of the drug in the tumor.

5. The use according to any one of claims 1 to 4, characterized in that: The N-terminus of the polypeptide is modified by acetylation, and the C-terminus is modified by amidation; the amino acids of the polypeptide are L-type natural amino acids or D-type non-natural amino acids.

6. The use according to any one of claims 1 to 4, characterized in that: The amino acid sequence of the polypeptide is FPGSDRF-RGD, wherein the amino acid S is phosphorylated.

Images