A method for rapidly screening high-yield β-glucan yeast strains, strains and applications

Abstract

The invention discloses a method for rapidly screening high-yield beta-glucan yeast strains, the method is by constructing a fusion gene expression vector, introducing red fluorescent protein as an indicator protein, constructing the relationship between the fusion gene and the glucan yield, judging the expression amount of the gene and the yield of glucan by its fluorescence intensity, and screening the strains with different fluorescence intensities from the same batch, sorting their fluorescence intensities, selecting strains with relative fluorescence intensity RFU higher than 25, i.e., high-yield beta-glucan yeast strains. The present invention verifies that there is a good linear relationship between the fusion gene co-expression fluorescence intensity (GAS1-RFP gene sequence) and the beta-glucan yield, the GAS1 gene expression amount increases, the fluorescence intensity increases, the yield of glucan increases, and the bridge between the fluorescence intensity and the beta-glucan yield is constructed. The inventive method is simple to operate, can be quickly and in large quantities screened, reduces the consumption of manpower and material resources, and saves time.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular to a method for rapidly screening a high-yield beta-glucan yeast strain, the strain and application thereof. Background Art

[0002] Yeast β-glucan mainly exists in the cell wall, accounting for about 50-60% of the cell dry weight. Yeast β-glucan is a mixed polysaccharide with β-1,3-glucan as the main component and β-1,6-glucan as the auxiliary component. Its components are water-soluble, alkali-soluble and alkali-insoluble β-glucan. Yeast β-glucan can specifically bind to animal and human immune cells, including monocytes, macrophages, neutrophils and natural killer cells, and enhance the host cell immune function. In addition, yeast β-glucan can improve the intestinal environment, stimulate innate immunity and acquired immunity, absorb fungal toxins, promote wound healing, prevent cancer, and has antioxidant, blood sugar lowering, and blood lipid lowering effects. Therefore, it is very important to screen yeast strains with high β-glucan production.

[0003] According to the existing reports, β-glucan can form fluorescent substances with dyes such as aniline blue and Congo red. This method requires the yeast to be broken during the staining process, which is cumbersome and not suitable for large-scale and rapid screening of high-yield β-glucan strains. Another method of determination requires traditional fermentation, collecting bacteria, and screening by high-temperature hydrolysis-HPLC. This method takes a lot of time and energy, and has high requirements for equipment. Screening by phenol-sulfuric acid method, this method is to decompose polysaccharides into glucose molecules and then convert them into β-glucan, ignoring the influence of other polysaccharide impurities. The test results are not specific, the error is large, and it has certain limitations, and it cannot achieve the purpose of screening bacteria in large quantities. Therefore, how to quickly screen yeast strains with high glucan production is a barrier that needs to be broken through urgently.

[0004] Through searching, no patent publication documents related to the patent application of the present invention have been found. Summary of the invention

[0005] The purpose of the present invention is to overcome the problems existing in the prior art and provide a method for quickly screening a high-yield β-glucan yeast strain, a strain and an application thereof.

[0006] The technical solution adopted by the present invention to solve the technical problem is:

[0007] A method for rapidly screening high-yield β-glucan yeast strains, wherein the method constructs a fusion gene expression vector and introduces a red fluorescent protein as an indicator protein, verifies the influence of some regulatory genes on glucan synthesis, constructs the relationship between the fusion gene and the glucan yield, judges the gene expression amount and the glucan yield by its fluorescence intensity, obtains strains with different fluorescence intensities from the same batch, sorts the fluorescence intensities, and selects strains with a relative fluorescence intensity RFU higher than 25, which are high-yield β-glucan yeast strains;

[0008] The fusion gene expression vector is a universal expression vector constructed by linearization through single enzyme digestion, and then the regulatory gene and the RFP gene are recombinantly connected to obtain the fusion gene expression vector.

[0009] Furthermore, the method further comprises the following steps:

[0010] The specific yield of glucan from the strain was verified by alkaline extraction method:

[0011] The high-yield β-glucan yeast strain has its final content determined by alkaline extraction method and compared with the glucan content of the original strain. The strain with a yield increased by 15% compared with the original strain is the high-yield β-glucan yeast strain.

[0012] Furthermore, the method introduces the red fluorescent mRFP gene into the yeast strain. Under the red laser emitted by the fluorescence microscope, the red fluorescent protein mRFP can generate red fluorescence. As an indicator protein, the fluorescence intensity has a good positive correlation with the yield of glucan. 2 =0.8930, p<0.1, the yield of glucan in yeast cell wall can be judged by the fluorescence intensity.

[0013] Furthermore, the method uses an expression vector, which can be expressed in both bacteria and fungi, and is a vector for constructing an expression of a fusion protein;

[0014] Alternatively, the yeast is Saccharomyces cerevisiae.

[0015] Furthermore, the expression vector is a universal expression vector, and its construction method comprises the following steps:

[0016] The PRS413 vector was linearized by double restriction digestion with ApaI and SacI, and the promoter pTEF1 and terminator ADHt were PCR amplified from the wild yeast Saccharomyces cerevisiae genome, and the single restriction site XhoI was inserted between the promoter and terminator gene sequences. The promoter and terminator gene fragments were recombined with the linearized vector by seamless cloning technology, and transformed into DH5α large intestine competent cells, and spread on LB solid plates containing ampicillin resistance, cultured at 37°C for 12-16h, and single clone colonies were picked for PCR. The corresponding bands were verified by gel electrophoresis, which were consistent with the target bands, and a universal expression vector was constructed;

[0017] Among them, the amplification primers of pTEF1 are SEQ ID NO.3 and SEQ ID NO.4, and the amplification primers of ADHt are SEQ ID NO.5 and SEQ ID NO.6.

[0018] Further, the following steps are included:

[0019] (1) Designing primers to amplify the key regulatory gene regulating yeast β-glucan synthesis and the red fluorescent gene fragment by PCR;

[0020] (2) seamlessly cloning the fragment in step (1) with a universal expression vector to obtain a recombinant plasmid;

[0021] (3) The recombinant plasmid was transformed into the competent cell of E. coli, and spread on the LB solid plate containing ampicillin resistance, and inverted and cultured at 37°C for 12 h. The monoclonal transformants of E. coli were picked and verified by colony PCR. The positive transformants with the correct target gene band were obtained. After the correctness was verified by sequencing, the bacterial preservation operation was performed and the plasmid was extracted for subsequent experiments;

[0022] (4) The plasmid verified to be correct in step (3) is transformed into a competent yeast by chemical transformation, coated on a solid plate of resistance or SC-His auxotrophic type, inverted and cultured at 30° C. for 48 h, and a single clone transformant is picked and verified by colony PCR to obtain a positive transformant with a correct target gene band;

[0023] (5) Pick a single colony grown on a solid plate of the SC-His nutritional deficiency type, transfer it to a 24-well deep-well plate containing YPD medium, and culture it at 30°C until it reaches a stable period. Then, aspirate the bacterial solution to measure the fluorescence intensity. Strains with different fluorescence intensities are screened from the same batch, and their fluorescence intensities are ranked. The fluorescence intensity is used to determine the yeast β-glucan production, so as to achieve the purpose of quickly screening high-yield β-glucan strains. Strains with a relative fluorescence intensity RFU higher than 25 are selected, which are high-yield β-glucan yeast strains, and are maintained.

[0024] Furthermore, the key regulatory genes are genes encoding FKS1, GAS1, RHO1, KRE6, and KRE9 in the yeast gene library, respectively. The FKS1 is a gene with Gene ID: 851055 in NCBI, the GAS1 is a gene with Gene ID: 855355 in NCBI, the RHO1 is a gene with Gene ID: 856294 in NCBI, the KRE6 is a gene with Gene ID: 856287 in NCBI, and the KRE9 is a gene with Gene ID: 853265 in NCBI.

[0025] Furthermore, the bacterial solution is aspirated and the fluorescence intensity is measured by a multifunctional microplate reader, a fluorescence microscope, a laser confocal microscope or a flow cytometer.

[0026] The method described above is used for rapidly screening high-yielding β-glucan yeast strains.

[0027] A high-yield β-glucan yeast strain, wherein the construction method of the strain comprises the following steps:

[0028] (1) Construction of universal expression vector:

[0029] The PRS413 vector was linearized by double restriction digestion with ApaI and SacI, and the promoter pTEF1 and the terminator ADHt were PCR amplified from the wild yeast Saccharomyces cerevisiae genome, wherein the amplification primers of pTEF1 were SEQ ID NO.3 and SEQ ID NO.4, and the amplification primers of ADHt were SEQ ID NO.5 and SEQ ID NO.6; after the promoter and terminator fragments were amplified by PCR, the PCR products were aspirated for gel electrophoresis verification; the single restriction site XhoI was inserted into the middle of the promoter and terminator gene sequences, and the promoter and terminator gene fragments were recombined with the linearized vector by seamless cloning technology, and transformed into DH5α large intestine competent cells, and applied to LB solid plates containing ampicillin resistance, and cultured at 37°C for 12-16h; Escherichia coli monoclonal colonies were picked for PCR amplification, and the corresponding bands were verified by gel electrophoresis. If they were consistent with the target bands, a universal fusion expression vector was constructed and named PRS413-K-empty plasmid;

[0030] (2) Construction of recombinant strain of fusion gene expression vector:

[0031] The GAS1 gene and the fluorescent gene mRFP of the sequence such as Gene ID: 855355 were PCR amplified respectively. The stop codon was removed during the PCR amplification of the GAS1 gene. The universal expression vector was linearized by single restriction enzyme XhoI. The GAS1 and RFP gene fragments were recombined with the universal expression vector of the linearized PRS413-K-empty plasmid by seamless cloning technology to construct a recombinant vector named PRS413-GAS1-mRFP. Then, the recombinant vector was transferred to DH5α by chemical transformation, coated on a plate containing ampicillin resistance, and cultured at 37°C for 12-16h. The single clone transformant was selected for colony PCR verification, and the recombinant Escherichia coli engineering strain with the correct transfer of the target fragment was named: PRS413-GAS1-mRFP.

[0032] The plasmid in the recombinant E. coli engineering strain PRS413-GAS1-mRFP was extracted, and the extracted plasmid was transformed into yeast competent cells by lithium acetate transformation method, and then coated on SC-His auxotrophic solid plates, inverted and cultured at 30°C for 48 hours, and yeast monoclonal transformants were picked for PCR; the corresponding bands were verified by gel electrophoresis, which were consistent with the target bands, and the correctly constructed recombinant strain was named: SynX-GAS1-RFP;

[0033] (3) Screening:

[0034] The fluorescence intensity was measured, and the gene expression and glucan production were determined by the fluorescence intensity. Strains with different fluorescence intensities were screened from the same batch, and their fluorescence intensities were ranked. Strains with a relative fluorescence intensity RFU higher than 25 were selected, that is, strains whose β-glucan production was more than 15% higher than that of the original strain, namely, high-yield β-glucan yeast strains.

[0035] Advantages and beneficial effects achieved by the present invention:

[0036] 1. The method of the present invention determines the content of β-glucan in yeast cell walls by the intensity of red fluorescence, so as to achieve the purpose of rapid screening; this method is not only applicable to brewer's yeast, but also to other different types of yeast.

[0037] The present invention is a method constructed by analyzing the relationship between fluorescence intensity and glucan yield, which can quickly screen strains with high glucan yield, and provides a very simple and rapid method for screening glucans without obvious phenotypic characteristics in the cell wall, which can greatly save time and reduce the consumption of manpower and material resources. The method of the present invention can verify whether the strain expresses fluorescence, indirectly verify whether the strain is successfully constructed, and can omit the step of intermediate yeast colony PCR, which can effectively improve the efficiency of screening bacteria.

[0038] 2. The present invention analyzes the effects of some genes related to the regulation of β-glucan synthesis pathway on glucan synthesis, including FKS1, GAS1, RHO1, KRE6, and KRE9. Overexpression of the above genes can improve the production of β-glucan to a certain extent, among which the expression of GAS1 gene has a greater effect on β-glucan synthesis.

[0039] 3. The present invention introduces red fluorescent protein as an indicator gene, and the fluorescence intensity has a good positive correlation with the yield of glucan. 2 =0.8930, p<0.1) The yield of glucan in yeast cell wall can be judged by the fluorescence intensity. The present invention verifies the influence of the expression level of genes related to the partial regulation of β-glucan synthesis on its yield, constructs fusion expression genes to make them co-expressed, uses fluorescent protein genes as indicator genes, and establishes a relationship between the fluorescence intensity of the co-expressed fusion genes and the glucan yield, with the purpose of judging the yield of β-glucan by different fluorescence intensities.

[0040] 4. The determination method of the present invention is not limited to the microplate reader, but can also be used with fluorescence microscope, laser confocal microscope, flow cytometer and other related instruments capable of measuring fluorescence intensity.

[0041] 5. Yeast is a widely used chassis cell, and it is easy to genetically modify it. Common methods include genome rearrangement, UV mutagenesis, ARTP mutagenesis, gene-directed mutagenesis, etc. to obtain the target strain. Yeast β-glucan exists in the yeast cell wall and can enhance the immune function of host cells. The extraction and determination method of β-glucan is relatively cumbersome. This method is not suitable for a large number of screened yeast strains, which is time-consuming and laborious. The present invention aims to establish a method for quickly screening high-yield β-glucan yeast strains.

[0042] 6. The present invention introduces red fluorescent protein, which is widely used in molecular tags, protein interactions, and promoter strength judgment. The present invention introduces the red fluorescent protein (mRFP) gene into yeast. Under the red laser emitted by a fluorescent microscope, the red fluorescent protein (mRFP) can generate red fluorescence as an indicator protein.

[0043] 7. In existing research, there are many methods for measuring glucan, but there is no method for efficiently screening high-yield β-glucan yeast strains. The present invention provides a construction strategy for a fusion protein encoding gene, verifies the influence of partially regulating the expression of glucan synthesis genes on glucan synthesis, and verifies that there is a good linear relationship between the fluorescence intensity of fusion gene co-expression (GAS1-RFP gene sequence) and the β-glucan yield. The GAS1 gene expression increases, the fluorescence intensity increases, and the glucan yield increases, thus building a bridge between the fluorescence intensity and the β-glucan yield. The present invention is simple to operate, can be quickly and massively screened, reduces the consumption of manpower and material resources, and saves time.

[0044] 8. The method of the present invention analyzes the influence of the corresponding expression levels of some genes regulating glucan synthesis on the synthesis yield of β-glucan, constructs a linear correlation curve between the red fluorescence intensity of the fusion gene expression and the β-glucan yield, establishes a correlation curve between the fusion gene expression and the β-glucan yield, establishes a linear relationship between the fluorescence intensity and the β-glucan yield, and determines that there is a certain positive correlation between its fluorescence intensity and β-glucan.

[0045] 9. The expression vectors in the method of the present invention include but are not limited to shuttle plasmids that can be expressed in both bacteria and fungi. The preferred expression vector is the PRS413 plasmid with a histidine (His) auxotrophic selection marker.

[0046] 10. The present invention verifies that the increase in GAS1 gene expression can increase the yield of β-glucan, and there is a good positive correlation between the fluorescence intensity of fusion gene co-expression and the yield of β-glucan. 2 =0.8930, p<0.1, building a bridge between fluorescence intensity and β-glucan yield, and quickly screening strains with high β-glucan production through fluorescence intensity.

[0047] 11. The present invention provides a construction strategy for a fusion protein encoding gene, verifies the effect of the expression of some regulating glucan synthesis genes on glucan synthesis, verifies that there is a good linear relationship between the fluorescence intensity of fusion gene co-expression (GAS1-RFP gene sequence) and the yield of β-glucan, the increase in GAS1 gene expression, the enhanced fluorescence intensity, the increase in glucan yield, and the construction of a bridge between fluorescence intensity and β-glucan yield. The strain obtained by screening by this method has a 10%-20% increase in yield compared to the original strain. The method of the present invention is simple to operate, can be quickly and massively screened, reduces the consumption of manpower and material resources, and saves time. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1Schematic diagram of the construction of the universal expression vector and the fusion gene expression vector in the present invention; wherein the dark color represents the gene regulating the synthesis of glucan, and the light color represents the mRFP red fluorescent protein gene;

[0049] Figure 2 The figure is a diagram showing the amplification results of the terminator (ADHt) and promoter (pTEF) fragments in the present invention; wherein, M is DL2000DNA Maker; lanes 1-4 are the amplification results of the terminator (ADHt) fragment; lanes 5-8 are the amplification results of the promoter (pTEF) fragment;

[0050] Figure 3 This is the result of PCR of E. coli colony of the universal expression vector in the present invention; wherein, M is DL2000DNAMaker; lanes 1-16 are the results of PCR amplification of E. coli colony;

[0051] Figure 4 This is a graph showing the PCR results of the Escherichia coli colony of the fusion expression vector of the present invention; wherein, M is DL2000 DNAMaker; lanes 1-11 are the PCR amplification results of the Escherichia coli colony of the fusion expression vector;

[0052] Figure 5 This is a diagram of the PCR results of the yeast colony of the fusion expression vector of the present invention; wherein, M is DL2000DNAMaker; lanes 1-10 are the PCR amplification results of the yeast colony of the fusion expression vector;

[0053] Figure 6 The fluorescence microscope results of the fusion expression vector constructed in the present invention are shown in the figure; the upper figure is the bright field field in the fluorescence microscope, and the lower figure is the red fluorescence displayed by the yeast strain under the red fluorescence excitation wave of the fluorescence microscope;

[0054] Figure 7 Result diagram of the glucan content of yeast transformants with different fusion genes in the present invention; Figure 6 It can be seen that the expression of GAS1 gene greatly improves the synthesis of glucan, and the recombinant strain of GAS1-RFP has a higher glucan yield; among them, synX represents the original strain, X-GAS1 represents the strain expressing the fusion GAS1-RFP vector, X-RHO1 represents the strain expressing the fusion RHO1-RFP vector, X-FKS1 represents the strain expressing the fusion FKS1-RFP vector, X-KRE6 represents the strain expressing the fusion KRE6-RFP vector, and X-KRE9 represents the strain expressing the fusion KRE9-RFP vector;

[0055] Figure 8 This is a graph showing the fluorescence intensity and glucan content of the SynX-GAS1-RFP strain in the present invention;

[0056] Fig. 9 The linear relationship between the fluorescence intensity and the glucan content of the SynX-GAS1-RFP strain in the present invention is shown in the figure;

[0057] Fig.10 The present invention provides a technical roadmap for implementing the method of the present invention. DETAILED DESCRIPTION

[0058] For a better understanding of the present invention, the present invention is further described in detail below in conjunction with embodiments, but the scope of protection claimed by the present invention is not limited to the scope represented by the embodiments.

[0059] The raw materials used in the present invention, unless otherwise specified, are all conventional commercially available products. The methods used in the present invention, unless otherwise specified, are all conventional methods in the art. The quality of each substance used in the present invention is the quality for conventional use.

[0060] A method for rapidly screening high-yield β-glucan yeast strains, wherein the method constructs a fusion gene expression vector and introduces a red fluorescent protein as an indicator protein, verifies the influence of some regulatory genes on glucan synthesis, constructs the relationship between the fusion gene and the glucan yield, judges the gene expression amount and the glucan yield by its fluorescence intensity, obtains strains with different fluorescence intensities from the same batch, sorts the fluorescence intensities, and selects strains with a relative fluorescence intensity RFU higher than 25, which are high-yield β-glucan yeast strains;

[0061] The fusion gene expression vector is a universal expression vector constructed by linearization through single enzyme digestion, and then the regulatory gene and the RFP gene are recombinantly connected to obtain the fusion gene expression vector.

[0062] Preferably, the method further comprises the following steps:

[0063] The specific yield of glucan from the strain was verified by alkaline extraction method:

[0064] The high-yield β-glucan yeast strain has its final content determined by alkaline extraction method and compared with the glucan content of the original strain. The strain with a yield increased by 15% compared with the original strain is the high-yield β-glucan yeast strain.

[0065] Preferably, the method introduces the red fluorescent protein mRFP gene into the yeast strain. Under the red laser emitted by the fluorescence microscope, the red fluorescent protein mRFP can generate red fluorescence. As an indicator protein, the fluorescence intensity has a good positive correlation with the yield of glucan. 2 =0.8930, p<0.1, the yield of glucan in yeast cell wall can be judged by the fluorescence intensity.

[0066] Preferably, the method uses an expression vector that can be expressed in both bacteria and fungi and is a vector for constructing a fusion protein.

[0067] Alternatively, the yeast is Saccharomyces cerevisiae.

[0068] Preferably, the expression vector is a universal expression vector, and its construction method comprises the following steps:

[0069] The PRS413 vector was linearized by double restriction digestion with ApaI and SacI, and the promoter pTEF1 and terminator ADHt were PCR amplified from the wild yeast Saccharomyces cerevisiae genome, and the single restriction site XhoI was inserted between the promoter and terminator gene sequences. The promoter and terminator gene fragments were recombined with the linearized vector by seamless cloning technology, and transformed into DH5α large intestine competent cells, and spread on LB solid plates containing ampicillin resistance, cultured at 37°C for 12-16h, and single clone colonies were picked for PCR. The corresponding bands were verified by gel electrophoresis, which were consistent with the target bands, and a universal expression vector was constructed;

[0070] Among them, the amplification primers of pTEF1 are SEQ ID NO.3 and SEQ ID NO.4, and the amplification primers of ADHt are SEQ ID NO.5 and SEQ ID NO.6.

[0071] Preferably, the method comprises the following steps:

[0072] (1) Designing primers to amplify the key regulatory gene regulating yeast β-glucan synthesis and the red fluorescent gene fragment by PCR;

[0073] (2) seamlessly cloning the fragment in step (1) with a universal expression vector to obtain a recombinant plasmid;

[0074] (3) The recombinant plasmid was transformed into the competent cell of E. coli, and spread on the LB solid plate containing ampicillin resistance, and inverted and cultured at 37°C for 12 h. The monoclonal transformants of E. coli were picked and verified by colony PCR. The positive transformants with the correct target gene band were obtained. After the correctness was verified by sequencing, the bacterial preservation operation was performed and the plasmid was extracted for subsequent experiments;

[0075] (4) The plasmid verified to be correct in step (3) is transformed into a competent yeast by chemical transformation, coated on a solid plate of resistance or SC-His auxotrophic type, inverted and cultured at 30° C. for 48 h, and a single clone transformant is picked and verified by colony PCR to obtain a positive transformant with a correct target gene band;

[0076] (5) Pick a single colony grown on a solid plate of the SC-His nutritional deficiency type, transfer it to a 24-well deep-well plate containing YPD medium, and culture it at 30°C until it reaches a stable period. Then, aspirate the bacterial solution to measure the fluorescence intensity. Strains with different fluorescence intensities are screened from the same batch, and their fluorescence intensities are ranked. The fluorescence intensity is used to determine the yeast β-glucan production, so as to achieve the purpose of quickly screening high-yield β-glucan strains. Strains with a relative fluorescence intensity RFU higher than 25 are selected, which are high-yield β-glucan yeast strains, and are maintained.

[0077] Preferably, the key regulatory genes are genes encoding FKS1, GAS1, RHO1, KRE6, and KRE9 in the yeast gene library, respectively, wherein the FKS1 is a gene with Gene ID: 851055 in NCBI, the GAS1 is a gene with Gene ID: 855355 in NCBI, the RHO1 is a gene with Gene ID: 856294 in NCBI, the KRE6 is a gene with Gene ID: 856287 in NCBI, and the KRE9 is a gene with Gene ID: 853265 in NCBI.

[0078] Preferably, the bacterial solution is aspirated and the fluorescence intensity is measured by a multifunctional microplate reader, a fluorescence microscope, a laser confocal microscope or a flow cytometer.

[0079] The method described above is used for rapidly screening high-yielding β-glucan yeast strains.

[0080] A high-yield β-glucan yeast strain, wherein the construction method of the strain comprises the following steps:

[0081] (1) Construction of universal expression vector:

[0082] The PRS413 vector was linearized by double restriction digestion with ApaI and SacI, and the promoter pTEF1 and the terminator ADHt were PCR amplified from the wild yeast Saccharomyces cerevisiae genome, wherein the amplification primers of pTEF1 were SEQ ID NO.3 and SEQ ID NO.4, and the amplification primers of ADHt were SEQ ID NO.5 and SEQ ID NO.6; after the promoter and terminator fragments were amplified by PCR, the PCR products were aspirated for gel electrophoresis verification; the single restriction site XhoI was inserted into the middle of the promoter and terminator gene sequences, and the promoter and terminator gene fragments were recombined with the linearized vector by seamless cloning technology, and transformed into DH5α large intestine competent cells, and applied to LB solid plates containing ampicillin resistance, and cultured at 37°C for 12-16h; Escherichia coli monoclonal colonies were picked for PCR amplification, and the corresponding bands were verified by gel electrophoresis. If they were consistent with the target bands, a universal fusion expression vector was constructed and named PRS413-K-empty plasmid;

[0083] (2) Construction of recombinant strain of fusion gene expression vector:

[0084] The GAS1 gene and the fluorescent gene mRFP of the sequence such as Gene ID: 855355 were PCR amplified respectively. The stop codon was removed during the PCR amplification of the GAS1 gene. The universal expression vector was linearized by single restriction enzyme XhoI. The GAS1 and RFP gene fragments were recombined with the universal expression vector of the linearized PRS413-K-empty plasmid by seamless cloning technology to construct a recombinant vector named PRS413-GAS1-mRFP. Then, the recombinant vector was transferred to DH5α by chemical transformation, coated on a plate containing ampicillin resistance, and cultured at 37°C for 12-16h. The single clone transformant was selected for colony PCR verification, and the recombinant Escherichia coli engineering strain with the correct transfer of the target fragment was named: PRS413-GAS1-mRFP.

[0085] The plasmid in the recombinant E. coli engineering strain PRS413-GAS1-mRFP was extracted, and the extracted plasmid was transformed into yeast competent cells by lithium acetate transformation method, and then coated on SC-His auxotrophic solid plates, inverted and cultured at 30°C for 48 hours, and yeast monoclonal transformants were picked for PCR; the corresponding bands were verified by gel electrophoresis, which were consistent with the target bands, and the correctly constructed recombinant strain was named: SynX-GAS1-RFP;

[0086] (3) Screening:

[0087] The fluorescence intensity was measured, and the gene expression and glucan production were determined by the fluorescence intensity. Strains with different fluorescence intensities were screened from the same batch, and their fluorescence intensities were ranked. Strains with a relative fluorescence intensity RFU higher than 25 were selected, that is, strains whose β-glucan production was more than 15% higher than that of the original strain, namely, high-yield β-glucan yeast strains.

[0088] The fusion gene sequence is composed of some genes related to regulating glucan synthesis: FKS1, GAS1, RHO1, KRE6, KRE9 and mRFP gene. Primers are designed for PCR amplification of the mRFP gene sequence SEQ ID NO.1. The stop codon is removed during amplification, and a linker is connected between the two genes to facilitate the expression of the protein fusion sequence and reduce the conformational influence between the two proteins. The linker sequence SEQ ID NO.2 and the red fluorescent protein gene sequence are amplified, and the above gene fragments related to regulating glucan synthesis are seamlessly connected with the linearized universal vector. Verification primers are designed to perform PCR on monoclonal transformants and then perform gel electrophoresis for verification. The bands are correct and the recombinant vector is successfully constructed.

[0089] The yeast recombinant bacteria is to introduce the successfully constructed fusion protein expression vector into yeast cells. "Introduction" has the meaning generally understood by those skilled in the art, that is, the process of introducing endogenous or exogenous DNA into a host. The introduction method includes any method for introducing nucleic acid into cells, including but not limited to electroporation, transfer, polyethylene glycol (PEG) method, lithium acetate-DMSO method, etc.

[0090] The host cell of the present invention is a eukaryotic cell, preferably Saccharomyces cerevisiae, including but not limited to Saccharomyces cerevisiae BY4741, synX, synV, and mutant strains thereof.

[0091] The implementation technology route can be as follows Fig.10 shown.

[0092] Specifically, the relevant preparation and detection are as follows:

[0093] Example 1: Construction of universal expression vector:

[0094] like Figure 1 As shown, the pRS413 vector was linearized by double digestion with ApaI and SacI, and the promoter pTEF1 and terminator ADHt were PCR amplified from the wild yeast Saccharomyces cerevisiae genome, respectively. The primers are shown in Table 1. After the promoter and terminator fragments were amplified by PCR, 5 μl of the PCR product was aspirated for gel electrophoresis verification, as shown in Figure 2As shown. Insert the single restriction site XhoI in the middle of the promoter and terminator gene sequences, recombinant the promoter and terminator gene fragments with the linearized vector through seamless cloning technology, transform them into DH5α colon competent cells, apply them on LB solid plates containing ampicillin resistance, and culture at 37°C for 12-16h. The method instructions can be found in the Vazyme purchased MμltiS One Step Cloning Kit (C113). E. coli monoclonal colonies were selected for PCR amplification, and the corresponding bands were verified by gel electrophoresis, which were consistent with the target bands. The results are shown in the figure Figure 3 A universal fusion expression vector was constructed and named PRS413-K-empty plasmid. The relevant primers used are shown in Table 1.

[0095] Table 1

[0096]

[0097] Example 2: Construction of fusion gene expression vector recombinant strain:

[0098] The GAS1 gene and the fluorescent gene mRFP of the sequence such as Gene ID: 855355 were PCR amplified respectively. The stop codon was removed during the PCR amplification of the GAS1 gene. The universal expression vector was linearized by single restriction enzyme XhoI. The GAS1 and RFP gene fragments were recombined with the universal expression vector of the linearized PRS413-K-empty plasmid by seamless cloning technology to construct a recombinant vector named PRS413-GAS1-mRFP. The recombinant vector was then transferred to DH5α by chemical transformation, coated on a plate containing ampicillin resistance, and cultured at 37°C for 12-16h. The method instructions can be found in the Vazyme purchased MμltiS One Step Cloning Kit (C113). Pick a single clone transformant for colony PCR verification, such as Figure 4 As shown, the recombinant E. coli engineering strain with the correct target fragment transferred was named: PRS413-GAS1-mRFP.

[0099] Table 2

[0100]

[0101] The plasmid in the recombinant E. coli engineering strain PRS413-GAS1-mRFP was extracted by a plasmid kit. The method can be found in the manual. The extracted plasmid was transformed into yeast competent cells by lithium acetate transformation (the method used is a conventional and public method), spread on SC-His nutritional deficiency solid plates, inverted and cultured at 30°C for 48 hours, and yeast monoclonal transformants were picked for PCR. The corresponding bands were verified by gel electrophoresis, which were consistent with the target bands, such as Figure 5 The correctly constructed recombinant strain was named SynX-GAS1-RFP.

[0102] Recombinant yeast strains expressing other fusion gene vectors FKS1-RFP, KRE9-RFP, KRE6-RFP, and RHO1-RFP were constructed in a similar manner. The amplification primers used are shown in Table 3, and the method used is shown in Example 2. Whether the recombinant strain is successfully constructed can be directly determined by whether it contains red fluorescence. If red fluorescence is expressed, it means that the recombinant strain is successfully constructed.

[0103] The gene IDs of genes regulating yeast β-glucan synthesis are as follows:

[0104] The FKS1 gene has Gene ID: 851055 in NCBI; the GAS1 gene has Gene ID: 855355 in NCBI; the RHO1 gene has Gene ID: 856294 in NCBI; the KRE6 gene has Gene ID: 856287 in NCBI; and the KRE9 gene has Gene ID: 853265 in NCBI.

[0105] Table 3

[0106]

[0107]

[0108] Example 3: Verification of red fluorescence of recombinant yeast strains and determination of fluorescence intensity:

[0109] The formula and preparation of SC-His liquid medium are as follows:

[0110] Glucose 20 g / L, yeast nitrogen source 6.7 g / L, amino acid default mixture 2 g / L (formula as shown in Table 4), wherein the amino acid default mixture does not contain histidine, the volume is made up to 1 L, and the pH is adjusted to 6.5 with NaOH, and sterilized at 115°C for 30 min.

[0111] The formula and preparation of SC-His solid medium are as follows:

[0112] Glucose 20g / L, yeast nitrogen source 6.7g / L, amino acid default mixture 2g / L (formula as shown in Table 4), wherein the amino acid default mixture does not contain histidine, the volume is made up to 1L, and the pH is adjusted to 6.5 with NaOH, and 2% agar is added after packaging, and sterilized at 115°C for 30min.

[0113] Table 4 amino acid default mixture formula

[0114]

[0115]

[0116] Pick a single yeast colony from the SC-His auxotrophic solid plate. The selection principle is: a single colony with large growth potential (larger growth potential means colonies with better growth activity). Pick the yeast monoclonal transformant into an EP tube containing 200 μl PBS buffer, dilute it, and use the original strain as a control to prepare slides, such as Figure 6 As shown, by emitting red excitation waves under a fluorescence microscope, yeast colonies with red fluorescence can be clearly observed, and no red fluorescent colonies can be seen in the original strain. Based on this result, we can prove that the fusion gene is successfully constructed and expressed in yeast cells. In this result, a single colony can be directly picked to measure the fluorescence intensity, eliminating the step of colony PCR, more efficiently screening transformants that successfully express the fusion gene, and saving time.

[0117] The single colony from the plate was transferred to a deep-well shaking plate containing 5 ml YPD liquid medium, cultured at 30 ° C for 20-36 hours to reach a stable period, 600 μL of bacterial solution was taken, centrifuged at 4000 rpm for 2 minutes, resuspended in 600 μL PBS, and 200 μL of sample was taken in a 96-well plate. Three parallels were made for each sample, and the 96-well plate was placed in a microplate reader, and the excitation wavelength was set to 590 nm and the emission wavelength was set to 630 nm. The fluorescence intensity value of the strain expressing the mRFP protein RFP was measured. 1 At the same time, the fluorescence intensity value of RFP in the strain that does not express mRFP protein is measured 0 In addition, the OD of fresh culture medium and bacterial suspension was measured. 600 Value OD 0 and OD 1 .

[0118] The fluorescence intensity of mRFP red fluorescent protein is expressed as:

[0119] RFP / OD 600 =PRFP 1 -ΜRFP 0 / OD 1 -OD 0

[0120] RFP: fluorescence intensity of bacterial solution at the corresponding excitation wavelength; OD 600 : The bacterial concentration of the bacterial solution when the absorbance value is 600.

[0121] Example 4: Determination of recombinant yeast glucan content and its relationship with fluorescence intensity:

[0122] The recombinant yeast strain was picked from the corresponding nutritional deficiency plate and inoculated into a 5 ml 24-well deep-well plate, cultured overnight, inoculated into 100 ml YPD medium at 5%-15%, cultured at 30°C and 180-220rpm for 24-36 hours to reach the stable period, and then the bacteria were collected by centrifugation, washed twice with water, added with 0.5-2M NaOH solution, heated in a water bath at 60-90°C for 1-3 hours, centrifuged, and the precipitate was washed twice with water to obtain β-glucan.

[0123] like Figure 7 As shown, the effect of some genes regulating the β-glucan synthesis pathway on the β-glucan content in the yeast cell wall was verified. The control group (synX group) specifically refers to the original strain that has not been modified. The GAS1 gene has a more obvious effect on the synthesis of yeast glucan, which is 10%-20% higher than the original strain. Figure 8 , Fig. 9 It can be seen that the fluorescence intensity of the GAS1-RFP fusion gene sequence expression and the glucan yield are positively correlated and have a good correlation (R 2 =0.8930, p<0.01).

[0124] Mechanism of action of genes regulating yeast β-glucan synthesis:

[0125] The gene FKS1 encodes a gene for an important component subunit of β-1,3-glucan synthase, which has the function of catalyzing the polymerization of UDP-glucose into β-1,3-glucan; the gene GAS1 is a β-1,3-glucanotransferase gene required for cell wall assembly, which has the function of catalyzing the splitting and connection of β-1,3 glucan molecules and the extension of β-1,3 glucan chains; the gene RHO1 is a gene encoding a regulatory subunit of the β-1,3 / 1,6-glucan synthesis pathway; the gene KRE6 is a key enzyme gene encoding the synthesis of β-1,6-glucan in yeast cell walls; the gene KRE9 is a protein involved in β-1,6 glucan metabolism and cell wall organization.

[0126] At present, there are many methods for extracting yeast glucan, such as acid method, alkali method, acid-base method, enzyme method, high temperature acid hydrolysis HPLC method, water extraction method and a combination of methods to extract yeast glucan. Among them, Zhou Chuanbing used alkali extraction method to extract glucan in the article on purification and chemical composition of yeast polysaccharide, and the glucan yield was 11.26%. Ma Sen used papain-alkali method, and the glucan yield was 11%. Zhang Guifang optimized the extraction process of β-1,3 glucan in beer yeast mud by response surface method, and the glucan yield was 15.76%. The present invention screens strains with high yield of β-glucan by fluorescence intensity, and the glucan yield by alkali extraction method is 22.1%, which is 10-20% higher than the yield of alkali-insoluble glucan of the original strain. Subsequent experiments may obtain yeast strains with higher yields.

[0127] SEQ ID NO:1

[0128] (mRFP) red fluorescent gene sequence

[0129]

[0130]

[0131] SEQ ID NO.2

[0132] Linker

[0133] AGCGCGGGCAGCAGCGCGGCGGGCAGCGGCAGCGGC

[0134] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A method for rapidly screening high-yielding β-glucan yeast strains, characterized in that: The method constructs a fusion gene expression vector, introduces red fluorescent protein as an indicator protein, constructs the relationship between the fusion gene and the glucan yield, judges the gene expression amount and the glucan yield by its fluorescence intensity, screens strains with different fluorescence intensities in the same batch, sorts their fluorescence intensities, and selects strains with a relative fluorescence intensity RFU higher than 25, which are high-yield β-glucan yeast strains; The fusion gene expression vector is a universal expression vector constructed by linearizing with a single enzyme, and then recombining and connecting the regulatory gene with the RFP gene to obtain the fusion gene expression vector; The method introduces the red fluorescent protein mRFP gene into the yeast strain. Under the red laser emitted by the fluorescence microscope, the red fluorescent protein mRFP can generate red fluorescence. As an indicator protein, the fluorescence intensity has a good positive correlation with the yield of glucan. 2 =0.8930, p<0.1, the yield of glucan in yeast cell wall can be judged by the fluorescence intensity; The method uses an expression vector, which can be expressed in both bacteria and fungi and is a vector for constructing a fusion protein. The yeast is Saccharomyces cerevisiae; The expression vector is a universal expression vector, and its construction method comprises the following steps: The pRS413 vector was linearized by double digestion with ApaI and SacI, and the wild yeast Saccharomyces cerevisiae The promoter pTEF1 and the terminator ADHt were PCR amplified in the genome respectively, and the single restriction site XhoI was inserted between the promoter and terminator gene sequences. The promoter and terminator gene fragments were recombined with the linearized vector by seamless cloning technology, and transformed into DH5α large intestine competent cells, and spread on LB solid plates containing ampicillin resistance, and cultured at 37°C for 12-16 hours. The monoclonal colonies were picked for PCR, and the corresponding bands were verified by gel electrophoresis. If they were consistent with the target bands, a universal expression vector was constructed; Among them, the amplification primers of pTEF1 are SEQ ID NO.3 and SEQ ID NO.4, and the amplification primers of ADHt are SEQ ID NO.5 and SEQ ID NO.6; The steps include: (1) Design primers to perform PCR amplification on the key regulatory gene that regulates yeast β-glucan synthesis and the red fluorescent gene fragment; (2) seamlessly cloning the fragment in step (1) with a universal expression vector to obtain a recombinant plasmid; (3) The recombinant plasmid was transformed into the competent cell of E. coli, and spread on the LB solid plate containing ampicillin resistance. The plate was inverted and cultured at 37°C for 12 hours. The monoclonal transformants of E. coli were picked and verified by colony PCR. The positive transformants with the correct target gene band were obtained. After the correctness was verified by sequencing, the bacterial preservation operation was performed and the plasmid was extracted for subsequent experiments. (4) The plasmid verified to be correct in step (3) is transformed into a competent yeast by chemical transformation, spread on a solid plate of resistance or SC-His auxotrophic type, and cultured inverted at 30°C for 48 hours. Single clone transformants are picked and verified by colony PCR to obtain positive transformants with the correct target gene band; (5) Pick a single colony growing on the solid plate of the SC-His nutritional deficiency type, transfer it to a 24-well deep-well plate containing YPD medium, and culture it at 30°C until it reaches a stable period. Then, aspirate the bacterial solution to measure the fluorescence intensity. Strains with different fluorescence intensities are screened from the same batch, and their fluorescence intensities are sorted. The fluorescence intensity is used to judge the yeast β-glucan production, so as to achieve the purpose of quickly screening high-yield β-glucan strains. Strains with a relative fluorescence intensity RFU higher than 25 are selected, which are high-yield β-glucan yeast strains, and the strains are maintained; The key regulatory gene is a gene encoding GAS1 in the yeast gene library, and the GAS1 is a gene with Gene ID: 855355 in NCBI.

2. The method according to claim 1, characterized in that: The method further comprises the steps of: The specific yield of glucan from the strain was verified by alkaline extraction method: The high-yield β-glucan yeast strain has its final content determined by alkaline extraction method and compared with the glucan content of the original strain. The strain with a yield increased by 15% compared with the original strain is the high-yield β-glucan yeast strain.

3. The method according to claim 1, characterized in that: The bacterial solution is aspirated and the fluorescence intensity is measured by a multifunctional microplate reader, a fluorescence microscope, a laser confocal microscope or a flow cytometer.

4. Use of the method according to any one of claims 1 to 3 in the rapid screening of high-yielding β-glucan yeast strains.

5. A high-yield β-glucan yeast strain, characterized in that: The method for constructing the strain comprises the following steps: (1) Construction of universal expression vector: The pRS413 vector was linearized by double digestion with ApaI and SacI, and the wild yeast Saccharomyces cerevisiae The promoter pTEF1 and the terminator ADHt were PCR amplified in the genome, wherein the amplification primers of pTEF1 were SEQ ID NO.3 and SEQ ID NO.4, and the amplification primers of ADHt were SEQ ID NO.5 and SEQ ID NO.6; after the promoter and terminator fragments were amplified by PCR, the PCR products were aspirated for gel electrophoresis verification; a single restriction site XhoI was inserted into the middle of the promoter and terminator gene sequences, and the promoter and terminator gene fragments were recombined with the linearized vector by seamless cloning technology, and transformed into DH5α large intestine competent cells, and applied to LB solid plates containing ampicillin resistance, and cultured at 37°C for 12-16h; Escherichia coli monoclonal colonies were picked for PCR amplification, and the corresponding bands were verified by gel electrophoresis. If they were consistent with the target bands, a universal fusion expression vector was constructed, which was named PRS413-K-empty plasmid; (2) Construction of recombinant strains of fusion gene expression vectors: The GAS1 gene and the fluorescent gene mRFP of the sequence such as Gene ID: 855355 were PCR amplified respectively. The stop codon was removed during the PCR amplification of the GAS1 gene. The universal expression vector was linearized by single restriction enzyme XhoI. The GAS1 and RFP gene fragments were recombined with the universal expression vector of the linearized PRS413-K-empty plasmid by seamless cloning technology to construct a recombinant vector named PRS413-GAS1-mRFP. Then, the recombinant vector was transferred to DH5α by chemical transformation, coated on a plate containing ampicillin resistance, and cultured at 37°C for 12-16h. The single clone transformant was selected for colony PCR verification, and the recombinant Escherichia coli engineering strain with the correct transfer of the target fragment was named: PRS413-GAS1-mRFP. The plasmid in the recombinant E. coli engineering strain PRS413-GAS1-mRFP was extracted, and the extracted plasmid was transformed into yeast competent cells by lithium acetate transformation method, and then coated on SC-His auxotrophic solid plates, inverted and cultured at 30°C for 48 hours, and yeast monoclonal transformants were picked for PCR; the corresponding bands were verified by gel electrophoresis, which were consistent with the target bands, and the correctly constructed recombinant strain was named: SynX-GAS1-RFP; (3) Screening: The fluorescence intensity was measured, and the gene expression and glucan production were judged by the fluorescence intensity. Strains with different fluorescence intensities were screened from the same batch, and their fluorescence intensities were sorted. Strains with relative fluorescence intensity RFU higher than 25 were selected, that is, strains whose β-glucan production was higher than that of the original strain by more than 15%, which were high-yield β-glucan yeast strains. The yeast is Saccharomyces cerevisiae.

Images