Corn nitrate transporter gene zmnrt1.5 gene editing target and application thereof

By designing gene editing targets to perform targeted editing of maize ZmNRT1·5, the technical challenges of maize grain development and yield improvement have been solved, enabling in-depth analysis of gene function and construction of genetic regulatory networks.

CN115786364BActive Publication Date: 2025-11-28CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211263383.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-10-15
Publication Date
2025-11-28
Estimated Expiration
2042-10-15

AI Technical Summary

Technical Problem

In the current technology, the function and molecular mechanism of the maize ZmNRT1.5 gene have not been fully revealed, making it difficult to efficiently generate mutants through gene editing technology, which affects maize kernel development and yield improvement.

Method used

Three gene editing targets (Target 1, Target 2, and Target 3) were designed and constructed. Maize ZmNRT1·5 was edited at specific sites using gene editing vectors to produce single or multiple base insertions, deletions, and other editing types, thereby obtaining genetic material for in-depth analysis of gene function.

Benefits of technology

This study achieved diversified editing of the maize ZmNRT1.5 gene, obtained mutants, gained a deeper understanding of the grain development mechanism, provided a new approach to improve maize yield, and constructed a genetic regulatory network.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115786364B_ABST
    Figure CN115786364B_ABST
Patent Text Reader

Abstract

The application provides three editing targets of a corn nitrate transporter gene ZmNRT1.5, and the three editing targets can be used for editing the ZmNRT1.5 gene to obtain single or multiple base insertion, deletion or large fragment deletion and the like editing types, thereby providing genetic materials for in-depth analysis of the function of the gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, specifically involving the gene editing target of the maize nitrate transporter gene ZmNRT1.5 and its application. Background Technology

[0002] Maize is my country's largest crop, used for food, feed, and economic purposes, and plays a crucial role in the country's agricultural production and national economy. Currently, with my country's continuously increasing population and limited arable land resources, increasing grain yield per unit area is the core objective of maize breeding. Grain size is a significant factor affecting maize yield and quality. Therefore, cloning and functional analysis of key genes related to grain size, as well as the construction of their genetic regulatory networks, can provide theoretical support for implementing high-yield and efficient molecular design breeding, and is of great significance for ensuring national food security. Plant nitrate transporters (… nitrate transporter, NRT Not only participate NO3- Nitrate is involved in the absorption and translocation of nitrates and participates in numerous plant physiological processes, playing a crucial role in plant growth and development. However, reports on its regulation of grain development in maize are lacking. The maize ZmNRT gene family is mainly divided into two groups: ZmNRT1 (62 genes) and ZmNRT2 (100 genes). Guan et al. (2020) used map-based cloning to obtain the key gene ZmNRT1.5, which encodes the nitrate transporter 1.5, controlling grain development and size in maize. The function and molecular mechanism of this gene remain to be elucidated. Mutating target genes using gene editing technology can efficiently generate mutants, and designing gene editing targets is a crucial step. Summary of the Invention

[0003] This invention provides gene editing targets for the maize ZmNRT1.5 gene and their applications. Specifically, it offers three editing targets for the maize nitrate transporter gene ZmNRT1.5. These targets allow for editing of the ZmNRT1.5 gene, resulting in single or multiple base insertions, deletions, or large fragment deletions, providing genetic material for in-depth analysis of the gene's function.

[0004] The application provides three gene editing target points of corn ZmNRT1·5 which can effectively edit the corn ZmNRT1·5, the gene editing target points of the corn ZmNRT1·5 include Target 1, Target 2 and Target 3, the Target 1 is located at the position of 39-61 bp of the ZmNRT1·5 cDNA sequence, the sequence is shown as SEQ ID NO. 2; the Target 2 is located at the position of 69-91 bp of the ZmNRT1·5 cDNA sequence, the sequence is shown as SEQ ID NO. 3; the Target 3 is located at the position of 350-372 bp of the ZmNRT1·5 cDNA sequence, the sequence is shown as SEQ ID NO. 5; the ZmNRT1·5 cDNA sequence is shown as SEQ ID NO. 1.

[0005] Further, the application of the corn ZmNRT1·5 gene editing target point in editing the ZmNRT1·5 gene obtains the following mutations.

[0006] WT mutation:

[0007] 1) the reverse complement of the Target 2 shown as the sequence of SEQ ID NO. 3 is obtained, and the sequence shown as SEQ ID NO. 4 is obtained;

[0008] 2) the reverse complement of the Target 3 shown as the sequence of SEQ ID NO. 5 is obtained, and the sequence shown as SEQ ID NO. 6 is obtained.

[0009] ko-9 mutation:

[0010] A1) the Target 1 shown as the sequence of SEQ ID NO. 2 is inserted into G to obtain a mutant sequence, shown as SEQ ID NO. 7;

[0011] A2) the reverse complement of the Target 2 shown as the sequence of SEQ ID NO. 3 is obtained, shown as SEQ ID NO. 4, and is inserted into A to obtain a mutant sequence, shown as SEQ ID NO. 10;

[0012] A3) the reverse complement of the Target 3 shown as the sequence of SEQ ID NO. 5 is obtained, shown as SEQ ID NO. 6, and 5 bp of the sequence is deleted to obtain a mutant sequence, shown as SEQ ID NO. 12.

[0013] ko-11 mutation:

[0014] B1) the Target 1 shown as the sequence of SEQ ID NO. 2 is deleted to obtain a mutant sequence, shown as SEQ ID NO. 8;

[0015] B2) Target 2 as shown in sequence SEQ ID NO. 3 is reverse complemented to obtain a sequence as shown in SEQ ID NO. 4, and GCAGG is deleted to obtain a mutant sequence as shown in SEQ ID NO. 11;

[0016] B3) Target 3 as shown in sequence SEQ ID NO. 5 is reverse complemented to obtain a sequence as shown in SEQ ID NO. 6, and 9bp is deleted to obtain a mutant sequence as shown in SEQ ID NO. 13.

[0017] ko-17 mutation:

[0018] C1) Target 1 as shown in sequence SEQ ID NO. 2 is inserted into T to obtain a mutant sequence as shown in SEQ ID NO. 9;

[0019] C2) Target 2 as shown in sequence SEQ ID NO. 3 is reverse complemented to obtain a sequence as shown in SEQ ID NO. 4, and A is inserted to obtain a mutant sequence as shown in SEQ ID NO. 10;

[0020] C3) Target 3 as shown in sequence SEQ ID NO. 5 is reverse complemented to obtain a sequence as shown in SEQ ID NO. 6, and 36bp is deleted to obtain a mutant sequence as shown in SEQ ID NO. 14.

[0021] Further, the method for editing the target gene ZmNRT1·5 by using the corn ZmNRT1·5 gene editing target point, specifically comprises the following steps:

[0022] (1) Construct a gene editing vector containing three editing target points;

[0023] (2) The obtained gene editing vector is used for corn genetic transformation to realize the site-specific of corn ZmNRT1·5 gene;

[0024] (3) Extract DNA from transgenic corn leaf tissue and perform PCR amplification.

[0025] The construction method of the gene editing vector in step (1) specifically comprises the following steps:

[0026] S1 retrieves the sequence of corn ZmNRT1·5 gene in the gene bank, and selects a target site sequence for gene editing;

[0027] S2 designs and synthesizes corresponding primer sequences according to the sequence of the target site;

[0028] S3 denatures and anneals the primer sequences in step S2 in a PCR system to obtain a gRNA fragment;

[0029] S4 enzyme digestion and ligation;

[0030] S5 recombination plasmid transformed E. coli, extracted plasmid, and sequencing verification;

[0031] S6 final vector ligation: using the same tail enzyme ligation method, multiple intermediate vector fragments containing target sites are connected into the final vector at one time.

[0032] The primer sequence in step S2 includes T1-F, T1-R, T2-F, T2-R, T3-F, and T3-R

[0033] The sequence of T1-F is shown in SEQ ID NO. 15, the sequence of T1-R is shown in SEQ ID NO. 16, the sequence of T2-F is shown in SEQ ID NO. 17, the sequence of T2-R is shown in SEQ ID NO. 18, the sequence of T3-F is shown in SEQ ID NO. 19, and the sequence of T3-R is shown in SEQ ID NO. 20.

[0034] The PCR system in step S3 is 50 ul, including the following components: ddH2O: 40 ul; forward primer: 5 ul; reverse primer: 5 ul.

[0035] The PCR program in step S3 is: 95℃ pre-denaturation for 10 min; 55℃ denaturation for 10 min, 14℃ annealing for 5 min.

[0036] Respectively configure the enzyme digestion and ligation system of Target 1, Target 2, and Target 3 corresponding to 10 ul, take 2 ul of the gRNA fragment in step S3; each corresponding empty load 1.52 ul; ECO31I: 0.5 ul; T4-ligase: 0.5 ul; T4-buffer: 1 ul; H2O: 4.5 ul; Put the prepared system in a 37℃ incubator for about 2h.

[0037] The final vector ligation system in step S6 is: Cas9 / AscⅠ + EcoRⅠ is 50 ng; intermediate vector-T1 / AscⅠ + XbaⅠ is 8 ng; intermediate vector-T2 / NheⅠ + XhoⅠ is 8 ng; intermediate vector-T3 / Sal Ⅰ + EcoRⅠ is 8 ng; T4 ligase buffer is 1 ul; T4 ligase is 0.5 ul; ddH2O is added to 10 ul; and it is carried out at 22℃ for 1h.

[0038] Beneficial effects:

[0039] (1) The editing target can be used for editing the corn ZmNRT1·5 gene, and a variety of editing types can be generated, and mutants can be efficiently generated.

[0040] (2) The corn ZmNRT1·5 gene edited by the editing target in the present application can obtain a corn gene editing event, which is beneficial to in-depth analysis of the function of the key gene controlling the development and size of corn kernels, and understanding of the mechanism.

[0041] (3) A new way is provided for using the corn ZmNRT1·5 gene, and a new way is provided for further improving the yield of corn and creating germplasm resources. A new way is provided for constructing endogenous knockout or site-specific knock-in of the corn ZmNRT1·5 gene. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 The figure shows the experimental results of the present application. DETAILED DESCRIPTION

[0043] The technical solutions in the embodiments of the present application will be described clearly and completely in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0044] The method for editing the ZmNRT1·5 gene using three gene editing targets is as follows:

[0045] (1) Construct a gene editing vector containing three editing targets;

[0046] (2) The obtained gene editing vector is used for corn genetic transformation to realize site-specific editing of the corn ZmNRT1·5 gene;

[0047] (3) DNA is extracted from transgenic corn leaf tissue, PCR amplification (detection primers detect three targets at the same time, upstream primer: CGTTCATCCATCCTATACGTGC; downstream primer: GAAGTGGCAGGACTTGTCGAG), and the amplification product is sequenced to analyze the editing of the three targets;

[0048] (4) The PCR system is as follows: ddH2O, 5 ul; KOD one TMPCR Master Mix, 12.5 ul; Foward primer, 0.75 ul; Reverse primer, 0.75 ul; DNA, 1 ul, Total: 20 ul. The amplification procedure is as follows: 94℃, 2 minutes; 98℃, 10 seconds; 68℃, 30 seconds; 68℃, 90 seconds; 68℃, 10 minutes; 16℃, Forever, 28 weeks.

[0049] Example 1 Target site screening and vector construction.

[0050] The construction method of the editing vector is as follows:

[0051] (1) The ZmNRT1·5 gene cDNA sequence is input into the website http: / / crispr.hzau.edu.cn / CRISPR2 / ; the target site sequence that can be used for gene editing is analyzed and selected;

[0052] (2) According to the sequence of the target site, the corresponding primer sequence is designed and synthesized;

[0053] (3) The primer is denatured and annealed to obtain the gRNA fragment;

[0054] Among them, the target primer synthesis is as follows:

[0055] Target1 primer: ZmNRT1·5-T1+: cagtggtctcaggcaTCTGCGACAGGACCCGGCGG;

[0056] ZmNRT1·5-T1-: cagtggtctcaaaacCCGCCGGGTCCTGTCGCAGA

[0057] Target2 primer: ZmNRT1·5-T2+: cagtggtctcagccgCCTGGACCACCACCTGCGGC

[0058] ZmNRT1·5-T2-: cagtggtctcaaaacGCCGCAGGTGGTGGTCCAGG

[0059] Target3 primer: ZmNRT1·5-T3+: cagtggtctcaatgtGGAGAAGACGTAGGTGGTGC

[0060] ZmNRT1·5-T3-: cagtggtctcaaaacGCACCACCTACGTCTTCTCC.

[0061] PCR system is 50ul: including the following components: ddH2O: 40ul; forward primer: 5ul; reverse primer: 5ul.

[0062] PCR reaction parameter setting: pre-denaturation 95℃ 10 minutes, denaturation 55℃ 10 minutes, annealing 14℃ 5 minutes.

[0063] Example 2 Enzymatic digestion and ligation

[0064] Target1 enzymatic digestion and ligation system 10ul: gRNA fragment: 2ul; empty load 1: 1.5ul; ECO31I: 0.5ul; T4-ligase: 0.5ul; T4-buffer: 1ul; H2O: 4.5ul; Put the prepared system in a 37℃ incubator for 2h;

[0065] Target2 enzymatic digestion and ligation system 10ul: gRNA fragment: 2ul; empty load 2: 1.5ul; ECO31I: 0.5ul; T4-ligase: 0.5ul; T4-buffer: 1ul; H2O: 4.5ul; Put the prepared system in a 37℃ incubator for 2h;

[0066] Target3 enzymatic digestion and ligation system 10ul: gRNA fragment: 2ul; empty load 3: 1.5ul; ECO31I: 0.5ul; T4-ligase: 0.5ul; T4-buffer: 1ul; H2O: 4.5ul; Put the prepared system in a 37℃ incubator for 2h.

[0067] Recombinant plasmid transformed E. coli, extracted plasmid, and verified by sequencing.

[0068] Example 3 Final vector ligation system

[0069] Final vector ligation system: Cas9 / AscⅠ + EcoRⅠ 50ng; intermediate vector-T1 / AscⅠ + XbaⅠ 8ng; intermediate vector-T2 / NheⅠ + XhoⅠ 8ng; intermediate vector-T3 / Sal Ⅰ + EcoRⅠ 8ng; T4 ligase

[0070] Buffer 1 ul; T4 ligase 0.5 ul; ddH2O added to 10 ul; 22℃ for 1h.

[0071] Genetic transformation: the above final vector containing three target sites was genetically transformed into corn embryo, and positive transformation events were obtained after screening, differentiation, rooting and seedling.

[0072] Example 4 Mutations generated by gene editing

[0073] Gene editing experiments were performed on target genes Targetl, Target2 and Target3, respectively, as shown in Table 1 below:

[0074] Type of mutation Target1 Type of edit Target2 Type of edit Target3 Type of edit WT TCTGCGACAGGACCCGGCGG TGG CCTGCCGCAGGTGGTGGTCCAGG reverse complement CCGGCACCACCTACGTCTTCTCC reverse complement ko-9 <![CDATA[TCTGCGACAGGACCCGG G CGG TGG]]> insert G CCTGCC A GCAGGTGGTGGTCCAGG]]> insert A CCGGCA-----TACGTCTTCTCC delete 5bp ko-11 TCTGCGACAGGACCCGG--G TGG delete CG CCTGCC-----TGGTGGTCCAGG delete GCAGG CCGG---------CGTCTTCTCC delete 9bp ko-17 <![CDATA[TCTGCGACAGGACCCGG T CGG TGG]]> insert T CCTGCCAGCAGGTGGTGGTCCAGG insert A CCGG------------------------------------ delete 36bp

[0075] Referring to the accompanying Figure 1 As can be clearly seen from the accompanying drawings, the mutant ears generated by gene editing have defective kernel development, shrunken seed coat and small kernels.

Claims

1. A maize nitrate transporter gene ZmNRT1.5 gene editing target point, characterized in that, The gene editing target points include Target 1, Target 2 and Target 3, the Target 1 is located at the position of 39-61 bp of ZmNRT1·5 cDNA sequence, the sequence is shown as SEQ ID NO. 2; the Target 2 is located at the position of 69-91 bp of ZmNRT1·5 cDNA sequence, the sequence is shown as SEQ ID NO. 3; the Target 3 is located at the position of 350-372 bp of ZmNRT1·5 cDNA sequence, the sequence is shown as SEQ ID NO. 5; the above ZmNRT1·5 cDNA sequence is shown as SEQ ID NO. 1; The method for editing ZmNRT1·5 gene by using three gene editing target points is as follows: (1) constructing a gene editing vector containing three editing target points; (2) performing corn genetic transformation on the obtained gene editing vector to realize site-specific editing of the ZmNRT1·5 gene of corn; (3) extracting DNA from transgenic corn leaf tissue, PCR amplification; detecting primers to detect three target points at the same time, upstream primer: CGTTCATCCATCCTATACGTGC; downstream primer: GAAGTGGCAGGACTTGTCGAG, amplification product sequencing, analyzing the editing of three target points; (4) PCR system as follows: ddH2O, 5 ul; KOD one TM PCR Master Mix, 12.5 ul; Foward primer, 0.75 ul; Reverse primer, 0.75 ul; DNA, 1 ul, Total: 20 ul; amplification procedure as follows: 94 ℃, 2 minutes; 98 ℃, 10 seconds; 68℃, 30 seconds; 68℃, 90 seconds; 68℃, 10 minutes; 16℃, Forever, 28 weeks; The application in editing ZmNRT1·5 gene includes: WT mutation: 1) reverse complementing the Target 2 shown as SEQ ID NO. 3 to obtain the sequence shown as SEQ ID NO. 4; 2) reverse complementing the Target 3 shown as SEQ ID NO. 5 to obtain the sequence shown as SEQ ID NO. 6; ko-9 mutation: A1) inserting the Target 1 shown as SEQ ID NO. 2 into G to obtain a mutant sequence, shown as SEQ ID NO. 7; A2) reverse complementing the Target 2 shown as SEQ ID NO. 3 to obtain the sequence shown as SEQ ID NO. 4, inserting A to obtain a mutant sequence, shown as SEQ ID NO. 10; A3) reverse complementing the Target 3 shown as SEQ ID NO. 5 to obtain the sequence shown as SEQ ID NO. 6, deleting 5 bp to obtain a mutant sequence, shown as SEQ ID NO. 12; ko-11 mutation: B1) deleting CG from the Target 1 shown as SEQ ID NO. 2 to obtain a mutant sequence, shown as SEQ ID NO. 8; B2) reverse complementing the Target 2 shown as SEQ ID NO. 3 to obtain the sequence shown as SEQ ID NO. 4, deleting GCAGG to obtain a mutant sequence, shown as SEQ ID NO. 11; B3) Target 3 as shown in sequence SEQ ID NO. 5 is reverse complemented to obtain a sequence as shown in SEQ ID NO. 6, 9 bp are deleted to obtain a mutant sequence as shown in SEQ ID NO. 13; ko-17 mutation: C1) Target 1 as shown in sequence SEQ ID NO. 2 is inserted into T to obtain a mutant sequence as shown in SEQ ID NO. 9; C2) Target 2 as shown in sequence SEQ ID NO. 3 is reverse complemented to obtain a sequence as shown in SEQ ID NO. 4, A is inserted to obtain a mutant sequence as shown in SEQ ID NO. 10; C3) Target 3 as shown in sequence SEQ ID NO. 5 is reverse complemented to obtain a sequence as shown in SEQ ID NO. 6, 36 bp are deleted to obtain a mutant sequence as shown in SEQ ID NO.

14.

2. A method for editing the target site of the ZmNRT1·5 gene of the corn nitrate transporter gene ZmNRT1·5 according to claim 1, characterized in that, The construction method of the editing vector is as follows: (1) The ZmNRT1·5 gene cDNA sequence is input into the website http: / / crispr.hzau.edu.cn / CRISPR2 / ; target site sequences that can be used for gene editing are analyzed and selected; (2) According to the sequence of the target site, the corresponding primer sequence is designed and synthesized; (3) The primer is denatured and annealed to obtain a gRNA fragment; The target site primer synthesis is as follows: Target1 primer: ZmNRT1·5-T1+: cagtggtctcaggcaTCTGCGACAGGACCCGGCGG; ZmNRT1·5-T1-: cagtggtctcaaaacCCGCCGGGTCCTGTCGCAGA Target2 primer: ZmNRT1·5-T2+: cagtggtctcagccgCCTGGACCACCACCTGCGGC ZmNRT1·5-T2-: cagtggtctcaaaacGCCGCAGGTGGTGGTCCAGG Target3 primer: ZmNRT1·5-T3+: cagtggtctcaatgtGGAGAAGACGTAGGTGGTGC ZmNRT1·5-T3-: cagtggtctcaaaacGCACCACCTACGTCTTCTCC.

3. The method of claim 2, wherein, The Target1 enzyme cutting and ligation system 10ul: gRNA fragment: 2ul; empty load 1: 1.5ul; ECO31I: 0.5ul; T4-ligase: 0.5ul; T4-buffer: 1ul; H2O: 4.5ul; the prepared system is placed in a 37℃ incubator for 2h; The Target2 enzyme cutting and ligation system 10ul: gRNA fragment: 2ul; empty load 2: 1.5ul; ECO31I: 0.5ul; T4-ligase: 0.5ul; T4-buffer: 1ul; H2O: 4.5ul; the prepared system is placed in a 37℃ incubator for 2h; Target3 enzyme digestion and ligation system 10ul: gRNA fragment: 2ul; empty load 3: 1.5ul; ECO31I: 0.5ul; T4-ligase: 0.5ul; T4-buffer: 1ul; H2O: 4.5ul; The prepared system is placed in a 37℃ incubator for 2h.

4. The method of claim 3, wherein, Final vector ligation system: Cas9 / AscⅠ + EcoRⅠ is 50ng; Intermediate vector-T1 / AscⅠ + XbaⅠ is 8ng; Intermediate vector-T2 / NheⅠ + XhoⅠ is 8ng; Intermediate vector-T3 / Sal Ⅰ + EcoRⅠ is 8ng; T4 ligase Buffer is 1ul; T4 ligase is 0.5ul; ddH2O is added to 10ul; Buffer is 1ul; T4 ligase is 0.5ul; ddH2O is added to 10ul; It is carried out at 22℃ for 1h.

5. The method of claim 4, wherein, Genetic transformation: the final vector containing the three target sites is genetically transformed into corn young embryos, and positive transformation events are obtained through screening, differentiation, rooting and seedling fixation.

Citation Information

Patent Citations

  • Corn ZmRLK7 gene editing target and application thereof

    CN111549037A

  • Genetically enhanced maize plants

    US20220186248A1