A SNP marker associated with hearing loss caused by radiotherapy and chemotherapy and its application

Abstract

The present invention discloses a SNP marker associated with hearing loss caused by radiotherapy and chemotherapy and its application, wherein the application is the use of a detection reagent in the preparation of a kit for detecting and / or predicting the risk of hearing loss caused by radiotherapy and chemotherapy for tumors; the detection reagent is a detection reagent for SNP markers. The group of SNP markers provided by the present invention has the characteristics of high sensitivity and high specificity, and provides a more accurate and efficient assessment of the risk of hearing loss caused by radiotherapy and chemotherapy. The present invention provides a systematic and efficient diagnostic kit that can quickly and accurately assess the risk of hearing loss in tumor patients receiving radiotherapy combined with cisplatin chemotherapy, which helps to take preventive and protective measures in a timely manner to minimize the occurrence of hearing loss after tumor treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and oncology, and in particular to a SNP marker associated with hearing loss caused by radiotherapy and chemotherapy and an application thereof. Background Art

[0002] Cisplatin is one of the most widely used chemotherapy drugs in the world, but it is also a known strong ototoxic drug. In addition, for cancer patients who need to receive head and neck radiotherapy, since the irradiated area is adjacent to the auditory organ, the radiation will inevitably damage the adjacent auditory organ and cause hearing loss. Both cisplatin chemotherapy and radiotherapy can cause irreversible sensorineural hearing loss, and cancer patients who receive radiotherapy combined with cisplatin chemotherapy will experience more severe hearing loss, which seriously affects the daily life of cancer patients. The incidence rate is high, and it usually presents progressive aggravation and irreversibility, and some patients may even develop permanent hearing loss. However, there is no specific drug in clinical practice to treat hearing loss caused by radiotherapy and chemotherapy. Patients with severe hearing loss can only rely on hearing aids or cochlear implants to compensate for the lost hearing. Permanent hearing impairment will seriously affect the patient's long-term quality of life, and will also cause huge disease burden and socioeconomic losses.

[0003] The risk of hearing loss caused by chemoradiotherapy is related to multiple factors such as age, tumor T stage, cochlear irradiation dose, cisplatin dose, etc. However, after taking into account clinical, treatment and demographic factors, the incidence and severity of hearing loss caused by chemoradiotherapy still show relatively large inter-individual differences, which suggests that individual genetic factors also play a role.

[0004] Single nucleotide polymorphism (SNP) is an important genetic susceptibility factor for treatment-related toxicity and side effects. The prior art has disclosed a variety of genetic molecular markers related to toxicity and side effects of tumor treatment, such as SNP markers related to radiation brain damage (rs162171, rs9304497, rs10501719, etc.), SNP markers related to radiation oral mucositis (rs4433399, rs1562524, rs7673990, etc.), and has established a risk prediction model that can be promoted and used in clinical practice for the identification of high-risk groups and individualized prevention and treatment. Therefore, for tumor patients undergoing radiotherapy combined with cisplatin chemotherapy, if the molecular markers related to hearing loss caused by radiotherapy or chemotherapy can be identified early and the risk of disease can be predicted, and then targeted preventive and protective measures can be taken in advance, it is expected to reduce the incidence of this adverse reaction.

[0005] However, there are currently no molecular markers and their combinations that can be used to clinically predict hearing loss caused by radiotherapy and chemotherapy in cancer patients, and there is also a lack of effective risk assessment programs for this adverse reaction. Therefore, if the genetic molecular markers associated with hearing loss caused by radiotherapy and chemotherapy can be successfully screened and the corresponding diagnostic kits can be developed, it will help identify high-risk individuals, take preventive and protective measures in advance, implement individualized treatment, and improve the quality of life of patients. Summary of the invention

[0006] In order to solve the problem that there is no molecular marker in the prior art that can be used to clinically predict hearing loss caused by radiotherapy and chemotherapy in tumor patients, the present invention provides a SNP marker related to hearing loss caused by radiotherapy and chemotherapy and its application.

[0007] The first object of the present invention is to provide a detection reagent for SNP markers associated with hearing loss caused by radiotherapy and chemotherapy.

[0008] The second object of the present invention is to provide the use of the above detection reagent in the preparation of a kit for detecting and / or predicting the risk of hearing loss caused by tumor radiotherapy and chemotherapy.

[0009] The third object of the present invention is to provide a risk scoring system for hearing loss caused by radiotherapy and chemotherapy.

[0010] The fourth object of the present invention is to provide the use of the above risk scoring system in the preparation of a kit for detecting and / or predicting the risk of hearing loss caused by tumor radiotherapy and chemotherapy.

[0011] A fifth object of the present invention is to provide a kit for detecting and / or predicting the risk of hearing loss caused by tumor radiotherapy and chemotherapy.

[0012] In order to achieve the above object, the present invention is implemented by the following scheme:

[0013] The present invention analyzes the association between the risk of hearing loss caused by radiotherapy and cisplatin chemotherapy and single nucleotide polymorphisms, searches for SNP markers that are highly correlated with hearing loss caused by radiotherapy and cisplatin chemotherapy, and develops a detection kit that is easy to use in clinical practice and can predict the risk of hearing loss caused by tumor treatment. It provides support for identifying high-risk individuals for hearing loss related to radiotherapy and cisplatin chemotherapy, helps to take targeted preventive and protective measures and individualized treatment, reduces the occurrence of hearing loss or reduces the severity of hearing loss, and improves the long-term quality of life of patients.

[0014] A detection reagent for SNP markers associated with hearing loss caused by radiotherapy and chemotherapy, wherein the detection reagent detects SNP markers 1 to 8, wherein SNP marker 1 is rs1050851; SNP marker 2 is rs117098517; SNP marker 3 is any one of rs1485149, rs11713855, rs73028787, rs9872473, rs6784713, rs36011752, rs34056014, rs66888336, rs869935, rs35486575, rs13072384 or rs3864080; SNP marker 4 is any one of rs17010289, rs17010288, rs117227749 or rs75222194; The SNP marker 5 is any one of rs79938362 or rs116989317; the SNP marker 6 is rs73335760; the SNP marker 7 is rs201061882, rs11700622, rs75423607, rs76415665, rs112894701, rs79765594, rs73354686, rs76372 004, rs11702842, rs73193458 or rs138904949; the SNP marker 8 is any one of rs2275994, rs6996060, rs10104930, rs16868196, rs192243723, rs150249158, rs375127474 and rs141273852.

[0015] rs11713855, rs73028787, rs9872473, rs6784713, rs36011752, rs34056014, rs66888336, rs869935, rs35486575, rs13072384, and rs3864080 are linked SNP markers to rs1485149; rs17010288, rs117227749, and rs75222194 are linked SNP markers to rs17010289; rs116989317 is a linked SNP marker to rs79938362; rs117 00622, rs75423607, rs76415665, rs112894701, rs79765594, rs73354686, rs76372004, rs11702842, rs73193458 and rs138904949 are linked SNP markers of rs201061882; rs6996060, rs10104930, rs16868196, rs192243723, rs150249158, rs375127474 and rs141273852 are linked SNP markers of rs2275994.

[0016] Using human genome hg19 as reference genome:

[0017] rs1050851 is located at base 35872926 on chromosome 14, with the reference allele being G and the effect allele being A;

[0018] rs117098517 is located at base 56986855 on chromosome 18, the reference allele is C, and the effect allele is T;

[0019] rs1485149 is located at base 8013452 on chromosome 3, with the reference allele being A and the effect allele being C;

[0020] rs11713855 is located at base 7992395 on chromosome 3. In East Asians, it is in linkage disequilibrium (LD) with rs1485149. 2 is 0.94, the reference allele is T, and the effect allele is C;

[0021] rs73028787 is located at base 7994403 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.91, the reference allele is C, and the effect allele is A;

[0022] rs9872473 is located at base 7994673 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.94, the reference allele is G, and the effect allele is A;

[0023] rs6784713 is located at base 7997490 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.97, the reference allele is T, and the effect allele is G;

[0024] rs36011752 is located at base 8000608 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.94, the reference allele is A, and the effect allele is G;

[0025] rs34056014 is located at base 8000863 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.94, the reference allele is C, and the effect allele is T;

[0026] rs66888336 is located at base 8003453 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.94, the reference allele is C, and the effect allele is T;

[0027] rs869935 is located at base 8005225 of chromosome 3 and has a LD relationship with rs1485149. 2 is 0.97, the reference allele is A, and the effect allele is G;

[0028] rs35486575 is located at base 8006648 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.94, the reference allele is G, and the effect allele is A;

[0029] rs13072384 is located at base 8007601 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.94, the reference allele is A, and the effect allele is G;

[0030] rs3864080 is located at base 8010700 on chromosome 3 and has a LD relationship with rs1485149. 2 is 0.97, the reference allele is T, and the effect allele is A;

[0031] rs17010289 is located at base 124346351 on chromosome 2, with the reference allele being A and the effect allele being G;

[0032] rs17010288 is located at base 124345218 on chromosome 2 and has a LD relationship with rs17010289. 2 is 0.97, the reference allele is G, and the effect allele is A;

[0033] rs117227749 is located at base 124378950 on chromosome 2 and has a LD relationship with rs17010289. 2 is 0.97, the reference allele is A, and the effect allele is T;

[0034] rs75222194 is located at base 124432237 on chromosome 2 and has a LD relationship with rs17010289. 2 is 0.87, the reference allele is T, and the effect allele is C;

[0035] rs79938362 is located at base 110743126 on chromosome 13, with the reference allele being C and the effect allele being T;

[0036] rs116989317 is located at base 110757745 on chromosome 13 and has a LD relationship with rs79938362. 2 is 0.86, the reference allele is G, and the effect allele is A;

[0037] rs73335760 is located at base 174470036 on chromosome 5, with the reference allele being A and the effect allele being G;

[0038] rs201061882 is located at base 33360958 on chromosome 21, the reference allele is TTC, and the effect allele is T;

[0039] rs11700622 is located at base 33356500 on chromosome 21 and has a LD relationship with rs201061882. 2 is 0.87, the reference allele is G, and the effect allele is A;

[0040] rs75423607 is located at base 33360400 on chromosome 21 and has a LD relationship with rs201061882. 2 is 0.95, the reference allele is C, and the effect allele is T;

[0041] rs76415665 is located at base 33361616 on chromosome 21 and has a LD relationship with rs201061882. 2 is 0.95, the reference allele is G, and the effect allele is C;

[0042] rs112894701 is located at base 33365503 on chromosome 21 and has a LD relationship with rs201061882. 2 is 0.95, the reference allele is C, and the effect allele is T;

[0043] rs79765594 is located at base 33367264 on chromosome 21 and has a LD relationship with rs201061882. 2 is 0.95, the reference allele is A, and the effect allele is G;

[0044] rs73354686 is located at base 33367365 of chromosome 21 and has a LD relationship with rs201061882. 2 is 0.95, the reference allele is A, and the effect allele is G;

[0045] rs76372004 is located at base 33367519 on chromosome 21 and has a LD relationship with rs201061882. 2 is 0.95, the reference allele is C, and the effect allele is T;

[0046] rs11702842 is located at base 33368355 of chromosome 21 and has a LD relationship with rs201061882. 2 is 1.00, the reference allele is G, and the effect allele is A;

[0047] rs73193458 is located at base 33375476 on chromosome 21 and has a LD relationship with rs201061882. 2 is 0.91, the reference allele is G, and the effect allele is A;

[0048] rs138904949 is located at base 33375702 on chromosome 21 and has a LD relationship with rs201061882. 2 is 0.95, the reference allele is AT, and the effect allele is A;

[0049] rs2275994 is located at base 102700230 on chromosome 8, with the reference allele being C and the effect allele being T;

[0050] rs6996060 is located at base 102675564 on chromosome 8 and has a LD relationship with rs2275994. 2 is 0.89, the reference allele is G, and the effect allele is A;

[0051] rs10104930 is located at base 102681820 on chromosome 8 and has a LD relationship with rs2275994. 2 is 0.92, the reference allele is A, and the effect allele is T;

[0052] rs16868196 is located at base 102682242 on chromosome 8 and has a LD relationship with rs2275994. 2 is 0.92, the reference allele is C, and the effect allele is T;

[0053] rs192243723 is located at base 102684646 on chromosome 8 and has a LD relationship with rs2275994. 2 is 0.92, the reference allele is A, and the effect allele is C;

[0054] rs150249158 is located at base 102686533 on chromosome 8 and has a LD relationship with rs2275994. 2 is 0.92, the reference allele is C, and the effect allele is T;

[0055] rs375127474 is located at base 102688459 on chromosome 8 and has a LD relationship with rs2275994. 2 is 0.92, the reference allele is G, and the effect allele is A;

[0056] rs141273852 is located at base 102690577 on chromosome 8 and has a LD relationship with rs2275994. 2 is 0.92, the reference allele is C, and the effect allele is T.

[0057] The genotyping of the SNP markers 1 to 8 is specifically as follows:

[0058] For the SNP marker 1:

[0059] The homozygous protective type of rs1050851 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0060] For the SNP marker 2:

[0061] The homozygous protective type of rs117098517 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0062] For the SNP marker 3:

[0063] The homozygous protective type of rs1485149 is AA, the heterozygous type is CA or AC, and the homozygous risk type is CC;

[0064] The homozygous protective type of rs11713855 is TT, the heterozygous type is CT or TC, and the homozygous risk type is CC;

[0065] The homozygous protective type of rs73028787 is CC, the heterozygous type is AC or CA, and the homozygous risk type is AA;

[0066] The homozygous protective type of rs9872473 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0067] The homozygous protective type of rs6784713 is TT, the heterozygous type is GT or TG, and the homozygous risk type is GG;

[0068] The homozygous protective type of rs36011752 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0069] The homozygous protective type of rs34056014 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0070] The homozygous protective type of rs66888336 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0071] The homozygous protective type of rs869935 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0072] The homozygous protective type of rs35486575 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0073] The homozygous protective type of rs13072384 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0074] The homozygous protective type of rs3864080 is TT, the heterozygous type is AT or TA, and the homozygous risk type is AA;

[0075] For the SNP marker 4:

[0076] The homozygous protective type of rs17010289 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0077] The homozygous protective type of rs17010288 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0078] The homozygous protective type of rs117227749 is AA, the heterozygous type is TA or AT, and the homozygous risk type is TT;

[0079] The homozygous protective type of rs75222194 is TT, the heterozygous type is CT or TC, and the homozygous risk type is CC;

[0080] For the SNP marker 5:

[0081] The homozygous protective type of rs79938362 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0082] The homozygous protective type of rs116989317 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0083] For the SNP marker 6:

[0084] The homozygous protective type of rs73335760 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0085] For the SNP marker 7:

[0086] The homozygous protective type of rs201061882 is TTCTTC, the heterozygous type is TTTC or TTCT, and the homozygous risk type is TT;

[0087] The homozygous protective type of rs11700622 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0088] The homozygous protective type of rs75423607 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0089] The homozygous protective type of rs76415665 is GG, the heterozygous type is CG or GC, and the homozygous risk type is CC;

[0090] The homozygous protective type of rs112894701 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0091] The homozygous protective type of rs79765594 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0092] The homozygous protective type of rs73354686 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0093] The homozygous protective type of rs76372004 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0094] The homozygous protective type of rs11702842 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0095] The homozygous protective type of rs73193458 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0096] The homozygous protective type of rs138904949 is ATAT, the heterozygous type is AAT or ATA, and the homozygous risk type is AA;

[0097] For the SNP marker 8:

[0098] The homozygous protective type of rs2275994 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0099] The homozygous protective type of rs6996060 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0100] The homozygous protective type of rs10104930 is AA, the heterozygous type is TA or AT, and the homozygous risk type is TT;

[0101] The homozygous protective type of rs16868196 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0102] The homozygous protective type of rs192243723 is AA, the heterozygous type is CA or AC, and the homozygous risk type is CC;

[0103] The homozygous protective type of rs150249158 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0104] The homozygous protective type of rs375127474 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0105] The homozygous protective type of rs141273852 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0106] In the genotyping of SNP markers 1 to 8, the homozygous protective type carries two alleles with a low risk of hearing loss caused by radiochemotherapy, that is, it carries two reference alleles; the heterozygous type carries one allele with a low risk of hearing loss and one allele with a high risk of hearing loss at the same time, that is, it carries one reference allele and one effect allele; the homozygous risk type carries two alleles with a high risk of hearing loss, that is, it carries two effect alleles.

[0107] Preferably, the detection reagent detects any one or more of rs1050851, rs117098517, rs1485149, rs17010289, rs79938362, rs73335760, rs201061882 or rs2275994.

[0108] Preferably, the detection reagent comprises primers and / or probes.

[0109] More preferably, the primer is one or more of the following:

[0110] The primers for detecting rs1050851, the nucleotide sequences are shown in SEQ ID Nos: 1 to 2;

[0111] The primers for detecting rs117098517, the nucleotide sequences are shown in SEQ ID Nos: 5-6;

[0112] The primers for detecting rs1485149, the nucleotide sequences are shown in SEQ ID Nos: 9 to 10;

[0113] The primers for detecting rs11713855, the nucleotide sequences of which are shown in SEQ ID Nos: 13-14;

[0114] The primers for detecting rs73028787, the nucleotide sequences of which are shown in SEQ ID Nos: 17 to 18;

[0115] The primers for detecting rs9872473, the nucleotide sequences are shown in SEQ ID Nos: 21-22;

[0116] The primers for detecting rs6784713, the nucleotide sequences of which are shown in SEQ ID Nos: 25-26;

[0117] The primers for detecting rs36011752, the nucleotide sequences of which are shown in SEQ ID Nos: 29 to 30;

[0118] The primers for detecting rs34056014, the nucleotide sequences of which are shown in SEQ ID Nos: 33-34;

[0119] Primers for detecting rs66888336, the nucleotide sequences of which are shown in SEQ ID Nos: 37-38;

[0120] The primers for detecting rs869935, the nucleotide sequences of which are shown in SEQ ID Nos: 41-42;

[0121] The primers for detecting rs35486575, the nucleotide sequences of which are shown in SEQ ID Nos: 45-46;

[0122] The primers for detecting rs13072384, the nucleotide sequences of which are shown in SEQ ID Nos: 49 to 50;

[0123] The primers for detecting rs3864080, the nucleotide sequences of which are shown in SEQ ID Nos: 53-54;

[0124] The primers for detecting rs17010289, the nucleotide sequences are shown in SEQ ID Nos: 57-58;

[0125] The primers for detecting rs17010288, the nucleotide sequences are shown in SEQ ID Nos: 61-62;

[0126] Primers for detecting rs117227749, the nucleotide sequences of which are shown in SEQ ID Nos: 65-66;

[0127] Primers for detecting rs75222194, the nucleotide sequences of which are shown in SEQ ID Nos: 69-70;

[0128] The primers for detecting rs79938362, the nucleotide sequences of which are shown in SEQ ID Nos: 73-74;

[0129] Primers for detecting rs116989317, the nucleotide sequences of which are shown in SEQ ID Nos: 77-78;

[0130] The primers for detecting rs73335760, the nucleotide sequences of which are shown in SEQ ID Nos: 81 to 82;

[0131] Primers for detecting rs201061882, the nucleotide sequences of which are shown in SEQ ID Nos: 85-86;

[0132] Primers for detecting rs11700622, the nucleotide sequences of which are shown in SEQ ID Nos: 89 to 90;

[0133] The primers for detecting rs75423607, the nucleotide sequences of which are shown in SEQ ID Nos: 93-94;

[0134] The primers for detecting rs76415665, the nucleotide sequences of which are shown in SEQ ID Nos: 97-98;

[0135] The primers for detecting rs112894701, the nucleotide sequences are shown in SEQ ID Nos: 101 to 102;

[0136] Primers for detecting rs79765594, the nucleotide sequences of which are shown in SEQ ID Nos: 105-106;

[0137] Primers for detecting rs73354686, the nucleotide sequences of which are shown in SEQ ID Nos: 109 to 110;

[0138] The primers for detecting rs76372004, the nucleotide sequences of which are shown in SEQ ID Nos: 113-114;

[0139] The primers for detecting rs11702842, the nucleotide sequences of which are shown in SEQ ID Nos: 117-118;

[0140] The primers for detecting rs73193458, the nucleotide sequences of which are shown in SEQ ID Nos: 121 to 122;

[0141] Primers for detecting rs138904949, the nucleotide sequences of which are shown in SEQ ID Nos: 125-126;

[0142] Primers for detecting rs2275994, the nucleotide sequences of which are shown in SEQ ID Nos: 129 to 130;

[0143] Primers for detecting rs6996060, the nucleotide sequences of which are shown in SEQ ID Nos: 133-134;

[0144] Primers for detecting rs10104930, the nucleotide sequences of which are shown in SEQ ID Nos: 137-138;

[0145] Primers for detecting rs16868196, the nucleotide sequences of which are shown in SEQ ID Nos: 141-142;

[0146] Primers for detecting rs192243723, the nucleotide sequences of which are shown in SEQ ID Nos: 145-146;

[0147] Primers for detecting rs150249158, the nucleotide sequences of which are shown in SEQ ID Nos: 149-150;

[0148] Primers for detecting rs375127474, the nucleotide sequences of which are shown in SEQ ID Nos: 153-154;

[0149] The primers for detecting rs141273852 have nucleotide sequences as shown in SEQ ID Nos: 157-158.

[0150] More preferably, the probe is one or more of the following:

[0151] The probe for detecting rs1050851, the nucleotide sequence of which is shown in SEQ ID No: 3-4;

[0152] The probe for detecting rs117098517, the nucleotide sequence of which is shown in SEQ ID Nos: 7 to 8;

[0153] The probe for detecting rs1485149 has a nucleotide sequence as shown in SEQ ID Nos: 11 to 12;

[0154] The probe for detecting rs11713855 has a nucleotide sequence as shown in SEQ ID Nos: 15 to 16;

[0155] The probe for detecting rs73028787, the nucleotide sequence of which is shown in SEQ ID Nos: 19 to 20;

[0156] The probe for detecting rs9872473, the nucleotide sequence of which is shown in SEQ ID Nos: 23-24;

[0157] The probe for detecting rs6784713, the nucleotide sequence of which is shown in SEQ ID Nos: 27-28;

[0158] The probe for detecting rs36011752, the nucleotide sequence of which is shown in SEQ ID Nos: 31-32;

[0159] The probe for detecting rs34056014, the nucleotide sequence of which is shown in SEQ ID Nos: 35-36;

[0160] The probe for detecting rs66888336 has a nucleotide sequence as shown in SEQ ID Nos: 39 to 40;

[0161] The probe for detecting rs869935 has a nucleotide sequence as shown in SEQ ID Nos: 43-44;

[0162] The probe for detecting rs35486575 has a nucleotide sequence as shown in SEQ ID Nos: 47-48;

[0163] The probe for detecting rs13072384 has a nucleotide sequence as shown in SEQ ID Nos: 51 to 52;

[0164] The probe for detecting rs3864080 has a nucleotide sequence as shown in SEQ ID Nos: 55-56;

[0165] The probe for detecting rs17010289 has a nucleotide sequence as shown in SEQ ID Nos: 59 to 60;

[0166] The probe for detecting rs17010288 has a nucleotide sequence as shown in SEQ ID Nos: 63-64;

[0167] The probe for detecting rs117227749 has a nucleotide sequence as shown in SEQ ID Nos: 67-68;

[0168] The probe for detecting rs75222194 has a nucleotide sequence as shown in SEQ ID Nos: 71-72;

[0169] The probe for detecting rs79938362 has a nucleotide sequence as shown in SEQ ID Nos: 75-76;

[0170] The probe for detecting rs116989317, the nucleotide sequence of which is shown in SEQ ID Nos: 79 to 80;

[0171] The probe for detecting rs73335760 has a nucleotide sequence as shown in SEQ ID Nos: 83-84;

[0172] The probe for detecting rs201061882, the nucleotide sequence of which is shown in SEQ ID Nos: 87-88;

[0173] The probe for detecting rs11700622, the nucleotide sequence of which is shown in SEQ ID Nos: 91-92;

[0174] The probe for detecting rs75423607, the nucleotide sequence of which is shown in SEQ ID Nos: 95-96;

[0175] The probe for detecting rs76415665 has a nucleotide sequence as shown in SEQ ID Nos: 99 to 100;

[0176] The probe for detecting rs112894701, the nucleotide sequence of which is shown in SEQ ID Nos: 103-104;

[0177] The probe for detecting rs79765594 has a nucleotide sequence as shown in SEQ ID Nos: 107 to 108;

[0178] The probe for detecting rs73354686 has a nucleotide sequence as shown in SEQ ID Nos: 111 to 112;

[0179] The probe for detecting rs76372004 has a nucleotide sequence as shown in SEQ ID Nos: 115 to 116;

[0180] The probe for detecting rs11702842 has a nucleotide sequence as shown in SEQ ID Nos: 119 to 120;

[0181] The probe for detecting rs73193458 has a nucleotide sequence as shown in SEQ ID Nos: 123-124;

[0182] The probe for detecting rs138904949 has a nucleotide sequence as shown in SEQ ID Nos: 127 to 128;

[0183] The probe for detecting rs2275994 has a nucleotide sequence as shown in SEQ ID Nos: 131 to 132;

[0184] The probe for detecting rs6996060 has a nucleotide sequence as shown in SEQ ID Nos: 135-136;

[0185] The probe for detecting rs10104930 has a nucleotide sequence as shown in SEQ ID Nos: 139 to 140;

[0186] The probe for detecting rs16868196 has a nucleotide sequence as shown in SEQ ID Nos: 143-144;

[0187] The probe for detecting rs192243723 has a nucleotide sequence as shown in SEQ ID Nos: 147-148;

[0188] The probe for detecting rs150249158 has a nucleotide sequence as shown in SEQ ID Nos: 151 to 152;

[0189] The probe for detecting rs375127474 has a nucleotide sequence as shown in SEQ ID Nos: 155-156;

[0190] The nucleotide sequence of the probe for detecting rs141273852 is shown in SEQ ID Nos: 159-160.

[0191] The use of any of the above detection reagents in the preparation of a kit for detecting and / or predicting the risk of hearing loss caused by tumor radiotherapy and chemotherapy should also be within the scope of protection of the present invention.

[0192] The Cox proportional hazards regression model was used to construct a risk scoring system for hearing loss caused by chemoradiotherapy. Whether or not hearing loss caused by chemoradiotherapy occurred and the time of hearing loss were used as outcome variables, and SNP markers 1 to 8 and three clinical factors (diagnosis age, tumor T stage, and concurrent chemotherapy cisplatin dose) were used as predictor variables to fit the risk scoring model to obtain the regression coefficients of each predictor variable. For patients with hearing loss caused by chemoradiotherapy, the time of hearing loss was defined as the time from the start of tumor radiotherapy or chemotherapy to the first appearance of hearing loss symptoms; for patients without hearing loss caused by chemoradiotherapy, the time of hearing loss was defined as the time from the start of tumor radiotherapy or chemotherapy to the end of the study.

[0193] The samples were randomly divided into a training set and a validation set, and a risk scoring system for hearing loss caused by radiotherapy and chemotherapy was constructed using the training set. Then, the risk scoring system was used to predict the risk of hearing loss for each sample in the training set within 5 years after radiotherapy and chemotherapy, and the hearing loss risk score for each sample in the training set was obtained. The median of the hearing loss risk score in the training set was used as the threshold of the risk score.

[0194] A risk scoring system for hearing loss caused by radiotherapy and chemotherapy, comprising an information collection module, a storage module, an information analysis module, a judgment module and an output module;

[0195] The information acquisition module is used to obtain characteristic parameters of the sample to be tested, and the characteristic parameters include the genotype typing of the above-mentioned SNP markers 1 to 8 in the genomic DNA of the sample to be tested, the diagnosis age and tumor T stage of the sample to be tested, and the cisplatin dose of concurrent chemotherapy;

[0196] The storage module is used to store the characteristic parameters obtained in the information collection module and the threshold value of the risk score in the judgment module;

[0197] The information analysis module is used to establish a Cox proportional hazard regression model based on the obtained characteristic parameters to obtain a risk score;

[0198] The judgment module is used to judge the risk of hearing loss caused by radiotherapy and chemotherapy of the sample to be tested according to the risk score and its threshold; the judgment standard is: if the risk score is greater than the threshold of the risk score, the sample to be tested is a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; if the risk score is less than the threshold of the risk score, the sample to be tested is a low-risk individual for hearing loss caused by radiotherapy and chemotherapy;

[0199] The output module is used to output the risk of hearing loss caused by chemotherapy and radiotherapy of the sample to be tested.

[0200] Preferably, the risk scoring system comprises an information collection module, a storage module, an information analysis module, a judgment module and an output module;

[0201] The information acquisition module is used to obtain characteristic parameters of the sample to be tested, and the characteristic parameters include the genotype typing of the above-mentioned SNP markers 1 to 8 in the genomic DNA of the sample to be tested and the diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose of the sample to be tested;

[0202] The storage module is used to store the characteristic parameters obtained in the information collection module and the threshold value of the risk score in the judgment module;

[0203] The information analysis module calculates the risk score through a formula based on the obtained characteristic parameters;

[0204] The judgment module judges the risk of hearing loss caused by radiotherapy and chemotherapy for the sample to be tested based on the risk score and its threshold; the judgment standard is: if the risk score is greater than the threshold of the risk score, the sample to be tested is a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; if the risk score is less than or equal to the threshold of the risk score, the sample to be tested is a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0205] The formula is: risk score = (0.5616 × score of diagnosis age) + (0.5433 × score of tumor T stage) + (0.5211 × score of concurrent chemotherapy cisplatin dose) + (a × score of genotyping of SNP marker 1) + (b × score of genotyping of SNP marker 2) + (c × score of genotyping of SNP marker 3) + (d × score of genotyping of SNP marker 4) + (e × score of genotyping of SNP marker 5) + (f × score of genotyping of SNP marker 6) + (g × score of genotyping of SNP marker 7) + (h × score of genotyping of SNP marker 8);

[0206] The score of the diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0207] The tumor T stage score is: T1-T2 stage = "0"; T3-T4 stage = "1";

[0208] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0209] The genotyping scores of the SNP markers 1 to 8 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0210] The a, b, c, d, e, f, g and h are regression coefficients of SNP markers 1 to 8, respectively;

[0211] The genotyping of the SNP markers 1 to 8 is specifically as follows:

[0212] For the SNP marker 1:

[0213] The homozygous protective type of rs1050851 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0214] For the SNP marker 2:

[0215] The homozygous protective type of rs117098517 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0216] For the SNP marker 3:

[0217] The homozygous protective type of rs1485149 is AA, the heterozygous type is CA or AC, and the homozygous risk type is CC;

[0218] The homozygous protective type of rs11713855 is TT, the heterozygous type is CT or TC, and the homozygous risk type is CC;

[0219] The homozygous protective type of rs73028787 is CC, the heterozygous type is AC or CA, and the homozygous risk type is AA;

[0220] The homozygous protective type of rs9872473 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0221] The homozygous protective type of rs6784713 is TT, the heterozygous type is GT or TG, and the homozygous risk type is GG;

[0222] The homozygous protective type of rs36011752 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0223] The homozygous protective type of rs34056014 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0224] The homozygous protective type of rs66888336 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0225] The homozygous protective type of rs869935 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0226] The homozygous protective type of rs35486575 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0227] The homozygous protective type of rs13072384 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0228] The homozygous protective type of rs3864080 is TT, the heterozygous type is AT or TA, and the homozygous risk type is AA;

[0229] For the SNP marker 4:

[0230] The homozygous protective type of rs17010289 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0231] The homozygous protective type of rs17010288 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0232] The homozygous protective type of rs117227749 is AA, the heterozygous type is TA or AT, and the homozygous risk type is TT;

[0233] The homozygous protective type of rs75222194 is TT, the heterozygous type is CT or TC, and the homozygous risk type is CC;

[0234] For the SNP marker 5:

[0235] The homozygous protective type of rs79938362 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0236] The homozygous protective type of rs116989317 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0237] For the SNP marker 6:

[0238] The homozygous protective type of rs73335760 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0239] For the SNP marker 7:

[0240] The homozygous protective type of rs201061882 is TTCTTC, the heterozygous type is TTTC or TTCT, and the homozygous risk type is TT;

[0241] The homozygous protective type of rs11700622 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0242] The homozygous protective type of rs75423607 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0243] The homozygous protective type of rs76415665 is GG, the heterozygous type is CG or GC, and the homozygous risk type is CC;

[0244] The homozygous protective type of rs112894701 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0245] The homozygous protective type of rs79765594 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0246] The homozygous protective type of rs73354686 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0247] The homozygous protective type of rs76372004 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0248] The homozygous protective type of rs11702842 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0249] The homozygous protective type of rs73193458 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0250] The homozygous protective type of rs138904949 is ATAT, the heterozygous type is AAT or ATA, and the homozygous risk type is AA;

[0251] For the SNP marker 8:

[0252] The homozygous protective type of rs2275994 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0253] The homozygous protective type of rs6996060 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0254] The homozygous protective type of rs10104930 is AA, the heterozygous type is TA or AT, and the homozygous risk type is TT;

[0255] The homozygous protective type of rs16868196 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0256] The homozygous protective type of rs192243723 is AA, the heterozygous type is CA or AC, and the homozygous risk type is CC;

[0257] The homozygous protective type of rs150249158 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0258] The homozygous protective type of rs375127474 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0259] The homozygous protective type of rs141273852 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0260] The judgment module judges the risk of hearing loss caused by radiotherapy and chemotherapy of the sample to be tested according to the risk score, and the judgment standard is: if the risk score is greater than the threshold of the risk score, the sample to be tested is a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; if the risk score is less than the threshold of the risk score, the sample to be tested is a low-risk individual for hearing loss caused by radiotherapy and chemotherapy;

[0261] The output module is used to output the risk of hearing loss caused by chemotherapy and radiotherapy of the sample to be tested.

[0262] More preferably, the SNP marker 1 is rs1050851; SNP marker 2 is rs117098517; SNP marker 3 is rs1485149; SNP marker 4 is rs17010289; SNP marker 5 is rs79938362; SNP marker 6 is rs73335760; SNP marker 7 is rs201061882; SNP marker 8 is rs2275994;

[0263] The regression coefficients of the SNP markers 1 to 8 are: a is 0.8548, b is 1.7102, c is 1.2895, d is 1.1940, e is 1.8931, f is 1.2720, g is 1.5115, and h is 1.4220.

[0264] The threshold value of the risk score is 0.9598; if the risk score is greater than 0.9598, the sample to be tested is judged to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; if the risk score is less than or equal to 0.9598, the sample to be tested is judged to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0265] The use of the above risk scoring system in the preparation of a kit for detecting and / or predicting the risk of hearing loss caused by tumor radiotherapy and chemotherapy should also be within the scope of protection of the present invention.

[0266] A kit for detecting and / or predicting the risk of hearing loss caused by tumor radiotherapy and chemotherapy, comprising the above-mentioned detection reagent.

[0267] Preferably, the detection reagent is the primer and / or probe for detecting the SNP marker mentioned above.

[0268] More preferably, the detection reagents are primers and probes for detecting rs1050851, rs117098517, rs1485149, rs17010289, rs79938362, rs73335760, rs201061882 and rs2275994.

[0269] Further preferably, the detection reagents are primers and probes having nucleotide sequences such as SEQ ID Nos: 1 to 12, SEQ ID Nos: 57 to 60, SEQ ID Nos: 73 to 76, SEQ ID Nos: 81 to 88 and SEQ ID Nos: 129 to 132.

[0270] Preferably, the kit further comprises a carrier carrying the above-mentioned risk scoring system.

[0271] Preferably, the kit further comprises a positive control, ie, a standard for determining the genotype of the SNP marker, the nucleotide sequence of which is shown in SEQ ID No: 161-240.

[0272] More preferably, the nucleotide sequence of the positive control is shown as SEQ ID Nos: 161-166, SEQ ID Nos: 189-190, SEQ ID Nos: 197-198, SEQ ID Nos: 201-204 and SEQ ID Nos: 225-226.

[0273] More preferably, the kit further comprises a blank control, namely double distilled water.

[0274] More preferably, the kit further comprises 10 mM dNTP mixed solution, 25 mM MgCl2 solution, PCR reaction buffer, and PCR reaction enzyme.

[0275] Preferably, the kit further comprises an instruction manual, which records a calculation formula for the risk score and a method for determining the risk of hearing loss caused by tumor radiotherapy and chemotherapy: the calculation formula is: risk score = (0.5616 × score of diagnosis age) + (0.5433 × score of tumor T stage) + (0.5211 × score of concurrent chemotherapy cisplatin dose) + (0.8548 × score of genotyping of SNP marker 1) + (1.7102 × score of genotyping of SNP marker 2) (1.2895 × score of genotyping of SNP marker 3) + (1.1940 × score of genotyping of SNP marker 4) + (1.8931 × score of genotyping of SNP marker 5) + (1.2720 × score of genotyping of SNP marker 6) + (1.5115 × score of genotyping of SNP marker 7) + (1.4220 × score of genotyping of SNP marker 8);

[0276] The scoring of the age at diagnosis is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1"; the scoring of the tumor T stage is: T1-T2 stage = "0"; T3-T4 stage = "1"; the scoring of the concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155 mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1"; the genotyping scores of the SNP markers 1 to 8 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0277] The genotyping of the SNP markers 1 to 8 is specifically as follows:

[0278] For the SNP marker 1:

[0279] The homozygous protective type of rs1050851 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0280] For the SNP marker 2:

[0281] The homozygous protective type of rs117098517 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0282] For the SNP marker 3:

[0283] The homozygous protective type of rs1485149 is AA, the heterozygous type is CA or AC, and the homozygous risk type is CC;

[0284] For the SNP marker 4:

[0285] The homozygous protective type of rs17010289 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0286] For the SNP marker 5:

[0287] The homozygous protective type of rs79938362 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0288] For the SNP marker 6:

[0289] The homozygous protective type of rs73335760 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0290] For the SNP marker 7:

[0291] The homozygous protective type of rs201061882 is TTCTTC, the heterozygous type is TTTC or TTCT, and the homozygous risk type is TT;

[0292] For the SNP marker 8:

[0293] The homozygous protective type of rs2275994 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0294] The method for judging the risk of hearing loss caused by tumor radiotherapy and chemotherapy is: if the risk score is greater than 0.9598, the sample to be tested is judged to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; if the risk score is less than or equal to 0.9598, the sample to be tested is judged to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0295] The method of using the kit is as follows:

[0296] S1. Extract genomic DNA of the sample to be tested;

[0297] S2. Using the genomic DNA obtained in step S1 as a template, PCR amplification is performed using primers and probes with nucleotide sequences such as SEQ ID Nos: 1 to 12, SEQ ID Nos: 57 to 60, SEQ ID Nos: 73 to 76, SEQ ID Nos: 81 to 88, and SEQ ID Nos: 129 to 132, and the amplification results are analyzed to obtain the genotype of the above SNP markers:

[0298] Specifically, for SNP marker 1: rs1050851,

[0299] Upstream amplification primer: TCAGAAAGGATCTGGGGTGA (SEQ ID No: 1),

[0300] Downstream amplification primer: CTCTCTTCCCCACAGGTTCC (SEQ ID No: 2),

[0301] Probe 1: TTGAGGAAGGCCAGGTCTCCC (SEQ ID No: 3), detects the reference allele G,

[0302] Probe 2: TTGAGGAAAGCCAGGTCTCCC (SEQ ID No: 4), detecting effect allele A;

[0303] For SNP marker 2: rs117098517,

[0304] Upstream amplification primer: GTGGGGTGGGAAGGAAG (SEQ ID No: 5),

[0305] Downstream amplification primer: GAGACCATTTAAGCAGCATTT (SEQ ID No: 6),

[0306] Probe 1: CTTTATATATTTTATCGTCTGCTTTCCCTT (SEQ ID No: 7) detects reference allele C,

[0307] Probe 2: CTTTATATATTTTATTGTCTGCTTTCCCTT (SEQ ID No: 8) detects the effect allele T;

[0308] For SNP marker 3: rs1485149,

[0309] Upstream amplification primer: TAGGAGAAGATTACAGGTCCATT (SEQ ID No: 9),

[0310] Downstream amplification primer: TAGTTGTGGCTGGGAAGATA (SEQ ID No: 10),

[0311] Probe 1: TTCAACTTTTGGAATATCACAATAATTTGG (SEQ ID No: 11) detects reference allele A,

[0312] Probe 2: TTCAACTTTTGGCATATCACAATAATTTGG (SEQ ID No: 12) detects effect allele C;

[0313] For SNP marker 4: rs17010289,

[0314] Upstream amplification primer: GTTCTTTCTACTGTGTATTCTCCA (SEQ ID No: 57),

[0315] Downstream amplification primer: ATGACATGGAATGGAATAGCT (SEQ ID No: 58),

[0316] Probe 1: TCCAAAGAAACCACATCACTATTTCTTATTG (SEQ ID No: 59) detects reference allele A,

[0317] Probe 2: TCCAAAGAAACCACATCACTGTTTCTTATTG (SEQ ID No: 60) detects the effect allele G;

[0318] For SNP marker 5: rs79938362,

[0319] Upstream amplification primer: AAGGGGAGTTTCAACCAAGA (SEQ ID No: 73),

[0320] Downstream amplification primer: AAAGTGGGAGGGGAGGC (SEQ ID No: 74),

[0321] Probe 1: CTGAGACTCCACAGTTCTCAGACGGG (SEQ ID No: 75) detects reference allele C,

[0322] Probe 2: CTGAGACTCCACAGTTCTCAGATGGG (SEQ ID No: 76) detects the effect allele T;

[0323] For SNP marker 6: rs73335760,

[0324] Upstream amplification primer: TTCTTCCACATCCTTCCTT (SEQ ID No: 81),

[0325] Downstream amplification primer: ATGGCTTTGCCCATTCTG (SEQ ID No: 82),

[0326] Probe 1: CCCTGTTATCCCTCACTCCAGCTTT (SEQ ID No: 83) detects reference allele A,

[0327] Probe 2: CCCTGTTATCCCTCGCTCCAGCTTT (SEQ ID No: 84) detects the effect allele G;

[0328] For SNP marker 7: rs201061882,

[0329] Upstream amplification primer: CCTGTGTGTGTATCTGTGTCCC (SEQ ID No: 85),

[0330] Downstream amplification primer: GGGAGGGAGGGAAGGAAA (SEQ ID No: 86),

[0331] Probe 1: TCCTCCCCTCATTTTTCTCTCTTTTCTC (SEQ ID No: 87) detects the reference allele TTC,

[0332] Probe 2: TCCTCCCCTCATTTTTCTCTTTTCTC (SEQ ID No: 88) detects the effect allele T;

[0333] For SNP marker 8: rs2275994,

[0334] Upstream amplification primer: GCACGGCAATGGAAAATAC (SEQ ID No: 129),

[0335] Downstream amplification primer: GGGAGCCAGGTCTGGAATA (SEQ ID No: 130),

[0336] Probe 1: TTGATGACTGCCCAACCTCTGATTCT (SEQ ID No: 131) detects reference allele C,

[0337] Probe 2: TTGATGACTGCCCAATCTCTGATTCT (SEQ ID No: 132) detects the effect allele T;

[0338] S3. Use the risk score calculation formula to obtain the risk score, and use the method for determining the risk of hearing loss caused by tumor radiotherapy and chemotherapy to determine the risk of hearing loss caused by radiotherapy and chemotherapy in the sample to be tested.

[0339] The kit of the present invention has no special limitation on the source of the sample, and biological specimens containing human DNA, such as whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal endoscopy samples, urine, and feces, can be used as samples to be tested.

[0340] Preferably, in step S2, PCR amplification is performed using primers and probes having nucleotide sequences such as SEQ ID Nos: 1 to 12, SEQ ID Nos: 57 to 60, SEQ ID Nos: 73 to 76, SEQ ID Nos: 81 to 88, and SEQ ID Nos: 129 to 132.

[0341] Preferably, in step S2, the reaction system of the PCR amplification is: 10 μM upstream amplification primer of the SNP marker to be detected, 0.1 μL; 10 μM downstream amplification primer of the SNP marker to be detected, 0.1 μL; 10 μM probe 1 of the SNP marker to be detected, 0.1 μL; 10 μM probe 2 of the SNP marker to be detected, 0.1 μL; 10 mM dNTP mixed solution, 0.2 μL; 25 mM MgCl2 solution, 0.4 μL; PCR reaction buffer, 1 μL; PCR reaction enzyme, 0.1 μL; double distilled water, 1.9 μL; template, 1 μL.

[0342] Preferably, in step S2, the reaction conditions for PCR amplification are: 60°C for 30 seconds; 95°C for 10 minutes; 95°C for 15 seconds, 60°C for 1 minute, 45 cycles; 60°C for 30 seconds.

[0343] Preferably, the chemoradiotherapy drug is cisplatin.

[0344] Preferably, the tumor is a tumor suitable for radiotherapy combined with cisplatin chemotherapy.

[0345] Compared with the prior art, the present invention has the following beneficial effects:

[0346] SNP, as a new type of genetic biomarker, is different from traditional biomarkers in that it has the advantages of being stable, minimally invasive, and easy to detect. The group of SNP markers provided by the present invention has the characteristics of high sensitivity and high specificity, providing a more accurate and efficient assessment of the risk of hearing loss caused by radiotherapy and chemotherapy.

[0347] The present invention provides a systematic and efficient diagnostic kit that can quickly and accurately assess the risk of hearing loss in cancer patients receiving radiotherapy combined with cisplatin chemotherapy, which helps to take preventive and protective measures in a timely manner and minimize the occurrence of hearing loss after cancer treatment.

[0348] The present invention adopts a rigorous verification and evaluation system and a large-sample whole-genome association study to construct a high-sensitivity and high-specificity risk scoring system for hearing loss caused by radiotherapy and chemotherapy, and clarifies its evaluation effect to ensure its effective application in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0349] Figure 1 Figure 1 is the bioinformatics analysis result of rs1050851; A is the association between rs1050851 genotype and hearing loss caused by radiotherapy and chemotherapy; B is the correlation between rs1050851 genotype and NFKBIA gene expression in cerebellar cortex tissue; C is the chromatin state of the region where rs1050851 is located; D is the association between NFKBIA baseline expression level and cisplatin sensitivity in central nervous system tumor cell lines; E is the association between NFKBIA gene expression level and cisplatin sensitivity in 12 tumor cell lines.

[0350] Figure 2 Figure 2 is the bioinformatics analysis result of rs2275994; A is the association between rs2275994 genotype and hearing loss caused by radiotherapy and chemotherapy; B is the correlation between rs2275994 genotype and GRHL2 gene expression in temporal cortex tissue; C is the chromatin state of the region where rs2275994 is located; D is the association between GRHL2 baseline expression level and radiosensitivity in central nervous system tumor cell lines; E is the association between GRHL2 gene expression level and radiosensitivity in 12 tumor cell lines.

[0351] Figure 3Figure 2 is the ROC curve of the combined single SNP marker and three clinical factors (diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose) to predict the risk of hearing loss caused by chemoradiotherapy in the validation set; A is the ROC curve of the risk scoring system combining SNP marker 1: rs1050851 and clinical factors; B is the ROC curve of the risk scoring system combining SNP marker 2: rs117098517 and clinical factors; C is the ROC curve of the risk scoring system combining SNP marker 3: rs1485149 and clinical factors; D is the ROC curve of the risk scoring system combining SNP marker 1: rs1050851 and clinical factors. Figure 1 is the ROC curve of the risk scoring system for marker 4: rs17010289 and clinical factors; E is the ROC curve of the risk scoring system for the combined SNP marker 5: rs79938362 and clinical factors; F is the ROC curve of the risk scoring system for the combined SNP marker 6: rs73335760 and clinical factors; G is the ROC curve of the risk scoring system for the combined SNP marker 7: rs201061882 and clinical factors; H is the ROC curve of the risk scoring system for the combined SNP marker 8: rs2275994 and clinical factors.

[0352] Figure 4 The results show that the single SNP marker and three clinical factors (diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose) are combined to predict the risk of hearing loss caused by chemoradiotherapy in the validation set population; A is the association between the risk score of the combined SNP marker 1: rs1050851 and clinical factors and hearing loss caused by chemoradiotherapy; B is the association between the risk score of the combined SNP marker 2: rs117098517 and clinical factors and hearing loss caused by chemoradiotherapy; C is the association between the risk score of the combined SNP marker 3: rs1485149 and clinical factors and hearing loss caused by chemoradiotherapy; D is the association between the risk score of the combined SNP marker 4: rs1050851 and clinical factors and hearing loss caused by chemoradiotherapy. =The association between SNP marker 17010289 and the risk score of clinical factors and hearing loss caused by chemoradiotherapy; E is the association between the combined SNP marker 5: rs79938362 and the risk score of clinical factors and hearing loss caused by chemoradiotherapy; F is the association between the combined SNP marker 6: rs73335760 and the risk score of clinical factors and hearing loss caused by chemoradiotherapy; G is the association between the combined SNP marker 7: rs201061882 and the risk score of clinical factors and hearing loss caused by chemoradiotherapy; H is the association between the combined SNP marker 8: rs2275994 and the risk score of clinical factors and hearing loss caused by chemoradiotherapy.

[0353] Figure 5The effect of combining SNP markers 1 to 8 (SNP marker 1: rs1050851, SNP marker 2: rs117098517, SNP marker 3: rs1485149, SNP marker 4: rs17010289, SNP marker 5: rs79938362, SNP marker 6: rs73335760, SNP marker 7: rs201061882 and SNP marker 8: rs2275994) and three clinical factors (diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose) to predict the risk of chemoradiotherapy-induced hearing loss in the validation set population; A is the ROC curve of the risk scoring system; B is the association between the risk score and chemoradiotherapy-induced hearing loss. DETAILED DESCRIPTION

[0354] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0355] Example 1 Discovery of genetic susceptibility loci based on genome-wide association analysis

[0356] 1. Experimental Methods

[0357] 1. Sample collection

[0358] Blood specimens were collected from the biological specimen bank of Sun Yat-sen University Cancer Center from 2009 to 2015, and the corresponding information was systematically collected. The samples for subsequent research were selected according to the following criteria:

[0359] (1) Patients with NPC with clear pathological diagnosis and clinical stage;

[0360] (2) age at diagnosis ≥18 years;

[0361] (3) no distant metastasis of the tumor at the time of initial diagnosis;

[0362] (4) no hearing loss before receiving radiotherapy or chemotherapy;

[0363] (5) The treatment mode was concurrent chemoradiotherapy;

[0364] (6) Completed the entire course of radiotherapy, and the radiotherapy technique was intensity-modulated radiotherapy (IMRT)

[0365] (7) Voluntarily participate and sign the informed consent form;

[0366] At the same time, patients with any of the following conditions were excluded:

[0367] (1) received a second course of radiotherapy or chemotherapy due to tumor recurrence or distant metastasis before hearing loss occurred;

[0368] (2) Hearing recovery occurred during follow-up.

[0369] A total of 777 samples that met the criteria were screened.

[0370] 2. DNA extraction and genotyping

[0371] Through regular outpatient follow-up (follow-up time until July 31, 2021), among the 777 samples mentioned above, a total of 132 cases developed hearing loss caused by radiotherapy and chemotherapy, and 645 cases did not develop hearing loss caused by radiotherapy and chemotherapy.

[0372] Whole genome DNA was extracted from blood samples of 777 research subjects and genotyping was performed using the Illumina Infinium Global Screening Array-24V1 chip. The specific steps are as follows:

[0373] (1) Collect 3 mL of peripheral blood using an EDTA anticoagulant tube, centrifuge at 3500 rpm for 10 min, and aspirate the plasma;

[0374] (2) Removal of red blood cells: add an equal volume of red blood cell lysis buffer to the remaining blood components, mix thoroughly, centrifuge at 4000 rpm for 10 minutes, and discard the supernatant; then add 5 mL of red blood cell lysis buffer, mix thoroughly, centrifuge at 4000 rpm for 10 minutes, and discard the supernatant;

[0375] (3) Removal of nucleated cells: Add 1 mL of leukocyte lysis buffer, 10 g of RNase, and 10 g of proteinase K, mix thoroughly, and place in a 65°C water bath for 30 minutes, mixing every 5 minutes.

[0376] (4) Protein removal: Add 1 mL of saturated phenol solution, mix thoroughly, centrifuge at 12,000 rpm for 10 minutes, and transfer the upper aqueous phase to a new EP tube; add an equal volume of chloroform-isoamyl alcohol mixture, mix thoroughly, centrifuge at 12,000 rpm for 10 minutes, and transfer the upper aqueous phase to a new EP tube;

[0377] (5) DNA precipitation: Add 1 / 10 volume of sodium acetate and an equal volume of pre-cooled isopropanol, mix gently until white flocs are visible, centrifuge at 12,000 rpm for 5 minutes, and discard the supernatant;

[0378] (6) DNA washing: add 1 mL of 75% ethanol, invert, centrifuge at 12,000 rpm for 5 minutes, and discard the supernatant; repeat this step twice;

[0379] (7) Dry DNA: After leaving the lid open for 5 minutes, add 50 μL TE buffer to dissolve the DNA. Use NanoDrop2000 to measure the DNA concentration and purity; adjust the concentration of DNA that has passed the quality inspection to 50 ng / μL.

[0380] (8) Genotyping: The Illumina Infinium Global Screening Array-24V1 chip was used for whole genome scanning, and the mature Illumina iScan chip scanning system was used to analyze the genotype of each site in each sample.

[0381] 3. Genotype data quality control

[0382] The genotyping data were quality controlled to eliminate unqualified research subjects and SNP markers. The specific process is as follows:

[0383] Quality control at the individual level: (1) Eliminate samples with typing success rates less than 95%; (2) Eliminate individuals whose predicted gender is inconsistent with clinical information; (3) Eliminate samples whose heterozygosity rate deviates from the mean ±6 times the standard deviation; (4) Calculate the kinship between individuals, and for pairs with identity by descent (IBD) greater than 0.25, eliminate samples with low genotyping success rates; (5) For the first 10 genetic principal components, eliminate individuals in each principal component that deviate from the mean ±6 times the standard deviation;

[0384] Quality control of SNP markers: (1) retain variant sites on autosomes; (2) eliminate sites with typing success rates less than 95%; (3) eliminate sites with minor allele frequency (MAF) less than 0.01; (4) eliminate sites with Hardy-Weinberg equilibrium test P values ​​less than 1.0×10 -12 The location of

[0385] The genotype data of all samples in the 1000Genome Phase III integrated variant set were used as a reference, and the genotypes of undetected sites were filled in using SHAPEIT2 and IMPUTE2 software. The filled sites were further quality controlled to eliminate SNP markers with INFO values ​​less than 0.8, typing success rates less than 95%, or MAF less than 0.01.

[0386] 4. Statistical analysis

[0387] Univariate and multivariate Cox proportional hazards regression analyses were performed to examine the associations of demographic variables (age at diagnosis, sex, smoking, alcohol drinking, hypertension, and diabetes) and clinical factors (tumor T / N / overall stage, pre-treatment EBV DNA load, treatment modality, primary lesion irradiation dose, induction chemotherapy cisplatin dose, and concurrent chemotherapy cisplatin dose) with chemoradiotherapy-induced hearing loss.

[0388] Under the assumption of additive effect, Cox proportional hazards regression model was used to evaluate the effect of each SNP marker on the incidence of hearing loss caused by chemoradiotherapy, while adjusting for age at diagnosis (<50 years or ≥50 years), tumor T stage (T1-T2 or T3-T4), concurrent chemotherapy cisplatin dose (<155 mg / m 2 or ≥ 155 mg / m 2 ) and the first two genetic principal components (PC1 and PC2).

[0389] 2. Experimental Results

[0390] Both univariate and multivariate Cox regression analyses showed that age at diagnosis, tumor T stage, and concurrent chemotherapy cisplatin dose were significantly associated with the risk of hearing loss induced by chemoradiotherapy.

[0391] Multivariate Cox regression analysis showed that patients aged ≥50 years had a higher risk of hearing loss caused by chemoradiotherapy compared with those aged <50 years (HR=1.72, 95%CI: 1.19-2.49, P=0.004); patients with high tumor T stage (T3-T4) had a higher risk of hearing loss compared with those with low tumor T stage (T1-T2) (HR=1.66, 95%CI: 1.12-2.46, P=0.012); patients with lower dose (<155 mg / m 2 Compared with concurrent cisplatin chemotherapy, patients receiving higher doses (≥155 mg / m 2 ) who received concurrent cisplatin chemotherapy had a higher risk of hearing loss (HR=1.46, 95%CI: 1.01-2.12, P=0.046).

[0392] After adjusting for age at diagnosis, tumor T stage, concurrent chemotherapy cisplatin dose, and the first two genetic principal components (PC1 and PC2), 15 P < 1.0 × 10 -06 SNP markers.

[0393] These 15 SNP markers were screened independently, and the linkage disequilibrium LD r between them was retained. 2<0.1, and finally 7 SNP markers were obtained. The linkage disequilibrium relationship between SNP markers was calculated using PLINK software based on the 1000 Genomes Phase III EAS population. These 7 SNP markers and their highly linked (LD r 2 The results of association analysis of other SNP markers with a P value of >0.8 are shown in Table 1. rs1050851 has the smallest P value and is the most significant genetic susceptibility locus.

[0394] Table 1 Results of association analysis of 7 SNP markers and their linked SNP markers

[0395]

[0396]

[0397] Example 2 Genetic enrichment analysis of hereditary deafness to identify genetic susceptibility sites

[0398] 1. Experimental Methods

[0399] 149 autosomal inherited hereditary deafness genes were obtained from the Hereditary Hearing Loss Homepage website (https: / / hereditaryhearingloss.org / ), and the range of 50 kb upstream and downstream of the gene was used as the key region for extracting SNP markers, and a total of 56,040 SNP markers were obtained.

[0400] The correspondence between each individual and SNP genotype was fixed unchanged, and the correspondence between SNP genotype and phenotype (outcome and time of chemoradiotherapy-related hearing loss, diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose) was randomly shuffled and reorganized, and association analysis was performed on the reorganized data; this step was repeated 1000 times.

[0401] Different GWAS significance thresholds (P < 5.0 × 10 -02 , 1.0×10 -02 , 5.0×10 -03 , 1.0×10 -03 , 5.0×10 -04 , 1.0×10 -04 , 5.0×10 -05 , 1.0×10 -05 , 5.0×10 -06 ), calculate the number of SNPs exceeding the threshold in each association analysis (called the test value), and obtain the empirical distribution of 1000 test values.

[0402] The number of SNPs exceeding the threshold (called the observed value) is calculated, and the number of times in the 1000 test values ​​that are greater than or equal to the observed value is calculated and compared with the number of tests to obtain the empirical P-value.

[0403] 2. Experimental Results

[0404] Among the 149 hereditary deafness genes, 118 genes contained at least one SNP marker with a GWAS P value less than 0.05 in the 50kb region upstream and downstream.

[0405] When the GWAS significance threshold is P GWAS <1.0×10 -04 , empirical P value = 0.034; when the GWAS significance threshold is P GWAS <5.0×10 -05 , empirical P value = 0.016; when the GWAS significance threshold is P GWAS <1.0×10 -05 , empirical P value = 0.033; when the GWAS significance threshold is set to P GWAS <5.0×10 -06 When , the empirical P value = 0.027. This indicates that the SNP markers located in the key regions of the above 149 hereditary deafness genes are significantly enriched in the GWAS significant signals.

[0406] Among them, the SNP marker rs2275994, located 50 kb upstream and downstream of the hereditary deafness gene, is most significantly associated with hearing loss caused by radiotherapy and chemotherapy. 2 The results of association analysis of other SNP markers (>0.8) are shown in Table 2.

[0407] Table 2 Results of association analysis of rs2275994 and its linked SNP markers

[0408]

[0409] Example 3 Bioinformatics Analysis of SNP Markers

[0410] 1. Experimental Methods

[0411] 1. SNP marker function prediction score annotation

[0412] CADD score annotations were performed for the most significant genetic susceptibility loci rs1050851 in Example 1 and rs2275994 in Example 2. CADD score is an index that integrates 63 functional annotations, which is related to mutation pathogenicity, disease severity, experimental regulation effect and complex trait association, and can predict the harmfulness of the variant site.

[0413] 2. Analysis of quantitative trait loci expressed by SNP markers

[0414] The UK Brain Expression Consortium (UKBEC) database collected gene expression chip data from 12 brain regions of 134 participants without neurodegenerative diseases. Its corresponding online website BRAINEAC (http: / / www.braineac.org / ) provides SNP-gene relationship analysis results for expression quantitative trait loci (eQTL) in 10 different brain regions (cerebellar cortex, frontal cortex, hippocampus, inferior olivary nucleus medulla, occipital cortex, dura mater, substantia nigra, temporal cortex, thalamus and lobular white matter). Using the information provided by the BRAINEAC public database, the association between the genotypes of rs1050851 and rs2275994 and the expression levels of target genes was determined.

[0415] 3. Chromatin state annotation

[0416] The information of histone modification marks (H3K27ac, H3K4me1 and H3K4me3) and DNase I hypersensitive sites (DHS) of 15 tissues or cell lines (ganglionic eminence-derived neurosphere tissue, cerebral cortex-derived neurosphere tissue, hippocampus tissue, substantia nigra tissue, anterior lobe tissue, cingulate gyrus tissue, temporal lobe tissue, angular gyrus tissue, dorsolateral prefrontal cortex tissue, brain germinal matrix tissue, fetal brain tissue, H1-derived neuronal progenitor cell line, H9-derived neuronal progenitor cell line, H9-derived neuronal cell line and human lymphoblastoid cell line) were obtained from the Roadmap database and ENCODE public database, and the chromatin status of rs1050851 and rs2275994 was annotated.

[0417] 4. Expression of genes containing rs1050851 and rs2275994 and cell sensitivity analysis

[0418] Tumor cell lines from 12 cancer tissue types were selected, including bladder or urethral cancer tissue, bone tumor tissue, colorectal cancer tissue, breast cancer tissue, central nervous system (CNS) tumor tissue, kidney tumor tissue, lung cancer tissue, ovarian cancer tissue, pancreatic cancer tissue, peripheral nervous system tumor tissue, skin cancer tissue and soft tissue tumor tissue.

[0419] Gene expression data and cisplatin sensitivity of the above tumor cell lines (using IC 50 The information of gene expression level and cell cisplatin sensitivity was analyzed.

[0420] The survival rate of tumor cells under 2Gy γ-ray irradiation (i.e., SF2 value) was used to evaluate the cell radiosensitivity. The gene expression data and cell radiosensitivity information of the above tumor cell lines were extracted from the "RadioGx" R software package, and the correlation analysis between gene expression level and cell radiosensitivity was performed.

[0421] 2. Experimental Results

[0422] Rs1050851 was the most significant genetic susceptibility locus found by GWAS (HR = 5.46, 95% CI: 2.93-10.18, P = 9.51 × 10 -08 ), close to the GWAS significance level (P<5.0×10 -08 ).like Figure 1 As shown in A, patients carrying the rs1050851 effect allele A have a higher risk of hearing loss caused by radiotherapy and chemotherapy. Moreover, the CADD functional prediction score annotation shows that the CADD score of rs1050851 is 17.10, which is much higher than the reference value of 12.37, so rs1050851 is a harmful mutation site.

[0423] like Figure 1 As shown in Figure B, in the cerebellar cortex tissue, the effect allele A of rs1050851 is associated with high expression of the NFKBIA gene. Figure 1 As shown in Figure C, in ganglionic eminence-derived neurosphere tissue, brain cingulate gyrus tissue, and human lymphoblastoid cell line, rs1050851 is located in the enhancer and promoter histone modification (H3K27ac, H3K4me1, and H3K4me3) regions; in human lymphoblastoid cell line, rs1050851 is located in the DHS mark region. These results suggest that rs1050851 may regulate the expression level of the NFKBIA gene by affecting the promoter or enhancer activity or chromatin accessibility of the gene, thereby affecting the risk of hearing loss caused by radiotherapy and chemotherapy.

[0424] like Figure 1 As shown in Figure D, the results of the cell cisplatin sensitivity analysis showed that the baseline expression level of the NFKBIA gene in CNS tumor cell lines was significantly negatively correlated with the cell's tolerance to cisplatin. Figure 1 As shown in Figure E, no significant correlation was observed between NFKBIA expression and cellular cisplatin resistance in tumor cell lines of other tissue types, but this significant correlation existed specifically in CNS tumor cell lines.

[0425] In summary, individuals carrying the rs1050851 effect allele A have high expression of the NFKBIA gene, low tolerance to cisplatin, and are more susceptible to cisplatin damage, and therefore have a higher risk of hearing loss caused by chemoradiotherapy.

[0426] rs2275994 is the most significant genetic susceptibility locus associated with hearing loss caused by radiotherapy and chemotherapy in the hereditary deafness gene region (HR = 3.85, 95% CI: 2.24-6.61, P = 1.10 × 10 -06 ).like Figure 2 As shown in A, patients carrying the rs2275994 effect allele T have a higher risk of hearing loss caused by radiotherapy and chemotherapy. The CADD functional prediction score annotation shows that the CADD score of rs2275994 is 7.12.

[0427] like Figure 2 As shown in Figure B, the effect allele T of rs2275994 was associated with low expression of the GRHL2 gene in the temporal cortex tissue. Figure 2 As shown in Figure C, in the human lymphoblastoid cell line, rs2275994 is located in the DHS marker region. These results suggest that rs2275994 may regulate the expression level of the GRHL2 gene by affecting the chromatin accessibility of the gene, thereby affecting the risk of hearing loss caused by radiochemotherapy.

[0428] like Figure 2 As shown in D and E in the figure, the results of cell radiosensitivity analysis showed that in CNS tumor cell lines, the baseline expression level of the GRHL2 gene was significantly positively correlated with the cell's tolerance to radiation, and this significant correlation also existed specifically in CNS tumor cell lines.

[0429] In summary, individuals carrying the rs2275994 effect allele T have low GRHL2 gene expression, low tolerance to radiotherapy, and are more susceptible to radiation damage, thus increasing the risk of hearing loss caused by radiotherapy and chemotherapy.

[0430] Example 4 Establishment of a risk scoring system for hearing loss caused by radiotherapy and chemotherapy

[0431] 1. Experimental Methods

[0432] 1. Construction of a risk scoring system for hearing loss caused by radiotherapy and chemotherapy

[0433] (1) SNP marker grouping

[0434] The 40 SNP markers in Examples 1 and 2 were divided into 8 groups, which were respectively referred to as SNP markers 1 to 8.

[0435] Among them, SNP marker 1: rs1050851;

[0436] SNP marker 2: rs117098517;

[0437] SNP marker 3: rs1485149 or any one of its linked SNP sites (rs11713855, rs73028787, rs9872473, rs6784713, rs36011752, rs34056014, rs66888336, rs869935, rs35486575, rs13072384 and rs3864080);

[0438] SNP marker 4: rs17010289 or any one of its linked SNP sites (rs17010288, rs117227749 and rs75222194);

[0439] SNP marker 5: rs79938362 or any one of its linked SNP sites (rs116989317);

[0440] SNP marker 6: rs73335760;

[0441] SNP marker 7: rs201061882 or any one of its linked SNP sites (rs11700622, rs75423607, rs76415665, rs112894701, rs79765594, rs73354686, rs76372004, rs11702842, rs73193458 and rs138904949);

[0442] SNP marker 8: rs2275994 or any one of its linked SNP sites (rs6996060, rs10104930, rs16868196, rs192243723, rs150249158, rs375127474 and rs141273852).

[0443] (2) Determination of regression coefficient and threshold

[0444] The Cox proportional hazards regression model was used to construct a risk scoring system for hearing loss caused by chemoradiotherapy. Whether or not hearing loss caused by chemoradiotherapy occurred and the time of hearing loss were used as outcome variables, and SNP markers 1 to 8 and three clinical factors (diagnosis age, tumor T stage, and concurrent chemotherapy cisplatin dose) were used as predictor variables to fit the risk scoring model to obtain the regression coefficients of each predictor variable. For patients with hearing loss caused by chemoradiotherapy, the time of hearing loss was defined as the time from the start of tumor radiotherapy or chemotherapy to the first appearance of hearing loss symptoms; for patients without hearing loss caused by chemoradiotherapy, the time of hearing loss was defined as the time from the start of tumor radiotherapy or chemotherapy to the end of the study.

[0445] The 777 samples in Example 1 were randomly divided into a training set (n=389) and a validation set (n=388), and a risk scoring system for hearing loss caused by radiotherapy and chemotherapy was constructed using the training set (n=389). Then, the risk scoring system was used to predict the risk of hearing loss for each sample in the training set within 5 years after radiotherapy and chemotherapy, and the hearing loss risk score of each sample in the training set was obtained. The median of the hearing loss risk score in the training set was used as the threshold of the hearing loss risk score.

[0446] (3) Risk scoring system for hearing loss caused by chemoradiotherapy combining a single SNP marker and three clinical factors

[0447] The 777 samples in Example 1 were randomly divided into a training set (n=389) and a validation set (n=388). Combining SNP markers 1 to 8 and three clinical factors (diagnosis age, tumor T stage, and concurrent chemotherapy cisplatin dose), the training set (n=389) was used to construct a risk scoring system for hearing loss caused by chemoradiotherapy combining a single SNP marker and three clinical factors.

[0448] Among them, SNP markers 1 to 8 were used to construct a risk scoring system for hearing loss caused by radiotherapy and chemotherapy, taking rs1050851, rs117098517, rs1485149, rs17010289, rs79938362, rs73335760, rs201061882 and rs2275994 as examples.

[0449] For the risk scoring system for hearing loss caused by radiotherapy and chemotherapy constructed by combining single SNP markers (SNP markers 1 to 8) and three clinical factors, the genotyping of SNP markers 1 to 8 and the corresponding regression coefficients are shown in Table 3. Table 3 Genotyping and regression coefficients of SNP markers 1 to 8 used to construct the risk scoring system combining single SNP markers and three clinical factors

[0450]

[0451] In the genotyping of SNP markers, the homozygous protective type is the carrier of two alleles with a low risk of hearing loss caused by radiochemotherapy (that is, carrying two reference alleles); the heterozygous type is the carrier of one allele with a low risk of hearing loss and one allele with a high risk of hearing loss (that is, carrying one reference allele and one effect allele); the homozygous risk type is the carrier of two alleles with a high risk of hearing loss (that is, carrying two effect alleles).

[0452] The specific calculation formula of the risk scoring system combining a single SNP marker and three clinical factors is as follows:

[0453] ① The specific calculation formula of the risk scoring system combining SNP marker 1 (rs1050851) and three clinical factors is as follows:

[0454] Risk score = (0.5785 × score of diagnosis age) + (0.2721 × score of tumor T stage) + (0.4092 × score of concurrent chemotherapy cisplatin dose) + (2.1895 × score of genotyping of SNP marker 1);

[0455] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0456] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0457] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0458] The genotyping scores of SNP marker 1 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0459] According to the risk score calculated by the formula, when the risk score is greater than 0.5785, the test subject is determined to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; when the risk score is ≤0.5785, the test subject is determined to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0460] ②The specific calculation formula of the risk scoring system combining SNP marker 2 (rs117098517) and three clinical factors is as follows:

[0461] Risk score = (0.6828 × score of diagnosis age) + (0.3467 × score of tumor T stage) + (0.4150 × score of concurrent chemotherapy cisplatin dose) + (2.3685 × score of genotyping of SNP marker 2);

[0462] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0463] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0464] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0465] The genotyping scores of SNP marker 2 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0466] According to the risk score calculated by the formula, when the risk score is greater than 0.6828, the test subject is determined to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; when the risk score is ≤0.6828, the test subject is determined to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0467] ③The specific calculation formula of the risk scoring system combining SNP marker 3 (rs1485149) and three clinical factors is as follows:

[0468] Risk score = (0.5666 × score of diagnosis age) + (0.3074 × score of tumor T stage) + (0.3446 × score of concurrent chemotherapy cisplatin dose) + (1.1087 × score of genotyping of SNP marker 3);

[0469] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0470] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0471] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0472] The genotyping scores of SNP marker 3 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0473] According to the risk score calculated by the formula, when the risk score is greater than 0.5666, the test subject is determined to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; when the risk score is less than or equal to 0.5666, the test subject is determined to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0474] ④ The specific calculation formula of the risk scoring system combining SNP marker 4 (rs17010289) and three clinical factors is as follows:

[0475] Risk score = (0.7010 × score of diagnosis age) + (0.2712 × score of tumor T stage) + (0.3631 × score of concurrent chemotherapy cisplatin dose) + (1.3741 × score of genotyping of SNP marker 4);

[0476] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0477] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0478] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0479] The genotyping scores of SNP marker 4 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0480] According to the risk score calculated by the formula, when the risk score is greater than 0.6343, the test subject is determined to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; when the risk score is less than or equal to 0.6343, the test subject is determined to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0481] ⑤The specific calculation formula of the risk scoring system combining SNP marker 5 (rs79938362) and three clinical factors is as follows:

[0482] Risk score = (0.5798 × score of diagnosis age) + (0.3667 × score of tumor T stage) + (0.3349 × score of concurrent chemotherapy cisplatin dose) + (1.8981 × score of genotyping of SNP marker 5);

[0483] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0484] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0485] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0486] The genotyping scores of SNP marker 5 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0487] According to the risk score calculated by the formula, when the risk score is greater than 0.5798, the test subject is determined to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; when the risk score is ≤0.5798, the test subject is determined to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0488] ⑥ The specific calculation formula of the risk scoring system combining SNP marker 6 (rs73335760) and three clinical factors is as follows:

[0489] Risk score = (0.7039 × score of diagnosis age) + (0.2124 × score of tumor T stage) + (0.4126 × score of concurrent chemotherapy cisplatin dose) + (1.4411 × score of genotyping of SNP marker 6);

[0490] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0491] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0492] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0493] The genotyping scores of SNP marker 6 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0494] According to the risk score calculated by the formula, when the risk score is greater than 0.5064, the test subject is determined to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; when the risk score is less than or equal to 0.5064, the test subject is determined to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0495] ⑦ The specific calculation formula of the risk scoring system combining SNP marker 7 (rs201061882) and three clinical factors is as follows:

[0496] Risk score = (0.6711 × score of diagnosis age) + (0.3257 × score of tumor T stage) + (0.4106 × score of concurrent chemotherapy cisplatin dose) + (1.1470 × score of genotyping of SNP marker 7);

[0497] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0498] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0499] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0500] The genotyping scores of SNP marker 7 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0501] According to the risk score calculated by the formula, when the risk score is greater than 0.6711, the test subject is determined to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; when the risk score is less than or equal to 0.6711, the test subject is determined to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0502] ⑧The specific calculation formula of the risk scoring system combining SNP marker 8 (rs2275994) and three clinical factors is as follows:

[0503] Risk score = (0.6548 × score of diagnosis age) + (0.3675 × score of tumor T stage) + (0.4401 × score of concurrent chemotherapy cisplatin dose) + (1.5321 × score of genotyping of SNP marker 8);

[0504] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0505] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0506] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0507] The genotyping scores of SNP marker 8 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0508] According to the risk score calculated by the formula, when the risk score is greater than 1.5321, the test subject is determined to be an individual at high risk of hearing loss caused by radiotherapy and chemotherapy; when the risk score is ≤1.5321, the test subject is determined to be an individual at low risk of hearing loss caused by radiotherapy and chemotherapy.

[0509] (4) Risk scoring system combining SNP markers 1 to 8 and three clinical factors

[0510] The 777 samples in Example 1 were randomly divided into a training set (n=389) and a validation set (n=388). A risk scoring system combining SNP markers 1 to 8 and three clinical factors (diagnosis age, tumor T stage, and concurrent chemotherapy cisplatin dose) was constructed using the training set (n=389).

[0511] For the risk scoring system combining SNP markers 1 to 8 and three clinical factors, the genotypes of SNP markers 1 to 8 and the corresponding regression coefficients are set as shown in Table 4.

[0512] Table 4 Genotyping and regression coefficients of SNP markers 1 to 8 used to construct the risk scoring system combining SNP markers 1 to 8 and three clinical factors

[0513]

[0514] In the genotyping of SNP markers, the homozygous protective type is the carrier of two alleles with a low risk of hearing loss caused by radiochemotherapy (that is, carrying two reference alleles); the heterozygous type is the carrier of one allele with a low risk of hearing loss and one allele with a high risk of hearing loss (that is, carrying one reference allele and one effect allele); the homozygous risk type is the carrier of two alleles with a high risk of hearing loss (that is, carrying two effect alleles).

[0515] Under the multifactor model, each predictor was comprehensively considered, and the regression coefficient of each predictor was used as the weight to construct a risk scoring system combining SNP markers 1 to 8 and three clinical factors. The specific calculation formula is as follows:

[0516] Risk score = (0.5616 × score of diagnosis age) + (0.5433 × score of tumor T stage) + (0.5211 × score of concurrent chemotherapy cisplatin dose) + (0.8548 × score of genotyping of SNP marker 1) + (1.7102 × score of genotyping of SNP marker 2) + (1.2895 × score of genotyping of SNP marker 3) + (1.1940 × score of genotyping of SNP marker 4) + (1.8931 × score of genotyping of SNP marker 5) + (1.2720 × score of genotyping of SNP marker 6) + (1.5115 × score of genotyping of SNP marker 7) + (1.4220 × score of genotyping of SNP marker 8);

[0517] Among them, the score of diagnosis age is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1";

[0518] The tumor T stage was scored as follows: T1-T2 stage = "0"; T3-T4 stage = "1";

[0519] The score of concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1";

[0520] The genotyping scores of SNP markers 1 to 8 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0521] According to the risk score calculated by the formula, when the risk score is greater than 0.9598, the test subject is determined to be a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; when the risk score is less than or equal to 0.9598, the test subject is determined to be a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0522] 2. Application of risk scoring system for hearing loss caused by radiotherapy and chemotherapy

[0523] The 777 samples in Example 1 were randomly divided into a training set (n=389) and a validation set (n=388). In the training set, a Cox regression model was used to construct a risk scoring model to predict the incidence of hearing loss within 5 years after chemoradiotherapy; in the validation set, the risk scoring system for hearing loss caused by chemoradiotherapy was used to predict the risk of hearing loss caused by chemoradiotherapy. The ROC curve was drawn and the sensitivity and specificity of the risk prediction were evaluated to determine the predictive effect of the risk scoring system for hearing loss caused by chemoradiotherapy.

[0524] 2. Experimental Results

[0525] like Figure 3As shown in A in FIG, in the validation set, the area under the curve (AUC) of the risk scoring system combining SNP marker 1 (rs1050851) and three clinical factors was 0.633; when the sensitivity was 72.1%, the specificity was 47.9%.

[0526] like Figure 3 As shown in B, in the validation set, the AUC of the risk scoring system combining SNP marker 2 (rs117098517) and three clinical factors was 0.620; when the sensitivity was 73.7%, the specificity was 48.5%.

[0527] like Figure 3 As shown in C, in the validation set, the AUC of the risk scoring system combining SNP marker 3 (rs1485149) and three clinical factors was 0.634; when the sensitivity was 73.6%, the specificity was 47.8%.

[0528] like Figure 3 As shown in D in the figure, in the validation set, the AUC of the risk scoring system combining SNP marker 4 (rs17010289) and 3 clinical factors was 0.630; when the sensitivity was 79.9%, the specificity was 43.8%.

[0529] like Figure 3 As shown in FIG. E, in the validation set, the AUC of the risk scoring system combining SNP marker 5 (rs79938362) and three clinical factors was 0.655; when the sensitivity was 77.2%, the specificity was 48.9%.

[0530] like Figure 3 As shown in F in the figure, in the validation set, the AUC of the risk scoring system combining SNP marker 6 (rs73335760) and three clinical factors was 0.571; when the sensitivity was 73.7%, the specificity was 41.1%.

[0531] like Figure 3 As shown in G in FIG, in the validation set, the AUC of the risk scoring system combining SNP marker 7 (rs201061882) and three clinical factors was 0.652; when the sensitivity was 76.5%, the specificity was 48.7%.

[0532] like Figure 3 As shown in H in Figure 5, in the validation set, the AUC of the risk scoring system combining SNP marker 8 (rs2275994) and three clinical factors was 0.619; when the sensitivity was 72.4%, the specificity was 47.3%. The specific results are summarized in Table 5.

[0533] Table 5 Predictive effect of the risk scoring system for hearing loss caused by chemoradiotherapy

[0534]

[0535] like Figure 4 As shown in Figure A, with 0.5785 as the cutoff value of the risk score, the risk scoring system combined with SNP marker 1 (rs1050851) and three clinical factors can distinguish between the high-risk group who are prone to hearing loss caused by radiotherapy and chemotherapy and the low-risk group who are less likely to suffer hearing loss (HR = 2.33, 95% CI: 1.36-4.01, P = 2.23×10 -03 ).

[0536] like Figure 4 As shown in Figure B, with 0.6828 as the cutoff value of the risk score, the risk scoring system combined with SNP marker 2 (rs117098517) and three clinical factors can distinguish between the high-risk group who are prone to hearing loss caused by radiotherapy and chemotherapy and the low-risk group who are less likely to suffer hearing loss (HR = 2.58, 95% CI: 1.48-4.48, P = 7.90 × 10 -04 ).

[0537] like Figure 4 As shown in Figure C, with 0.5666 as the cutoff value of the risk score, the risk scoring system combined with SNP marker 3 (rs1485149) and three clinical factors can distinguish between the high-risk group who are prone to hearing loss caused by radiotherapy and chemotherapy and the low-risk group who are less likely to suffer hearing loss (HR = 2.52, 95% CI: 1.45-4.37, P = 1.06×10 -03 ).

[0538] like Figure 4 As shown in D, with 0.6343 as the cutoff value of the risk score, the risk scoring system combining SNP marker 4 (rs17010289) and three clinical factors could not distinguish between the high-risk group prone to hearing loss caused by radiotherapy and chemotherapy and the low-risk group not prone to hearing loss (HR = 1.64, 95% CI: 1.00-2.69, P = 5.03 × 10 -02 ).

[0539] like Figure 4 As shown in Figure E, with 0.5798 as the cutoff value of the risk score, the risk scoring system combined with SNP marker 5 (rs79938362) and three clinical factors can distinguish between the high-risk group who are prone to hearing loss caused by radiotherapy and chemotherapy and the low-risk group who are less likely to suffer hearing loss (HR = 3.05, 95% CI: 1.71-5.43, P = 1.52×10 -04 ).

[0540] like Figure 4 As shown in F, with 0.5064 as the cutoff value of the risk score, the risk scoring system combining SNP marker 6 (rs73335760) and three clinical factors cannot distinguish between the high-risk group who are prone to hearing loss caused by radiochemotherapy and the low-risk group who are less likely to suffer hearing loss (HR=1.33, 95%CI: 0.80-2.20, P=0.27).

[0541] like Figure 4 As shown in G, with 0.6711 as the cutoff value of the risk score, the risk scoring system combined with SNP marker 7 (rs201061882) and three clinical factors can distinguish the high-risk group who are prone to hearing loss caused by radiotherapy and chemotherapy from the low-risk group who are less likely to suffer hearing loss (HR = 3.04, 95% CI: 1.71-5.41, P = 1.60 × 10 -04 ).

[0542] like Figure 4 As shown in the figure, with 1.5321 as the cutoff value of the risk score, the risk scoring system combined with SNP marker 8 (rs2275994) and three clinical factors can distinguish between the high-risk group who are prone to hearing loss caused by radiotherapy and chemotherapy and the low-risk group who are less likely to suffer hearing loss (HR = 2.51, 95% CI: 1.45-4.37, P = 1.08 × 10 -03 ).

[0543] like Figure 5 As shown in A in the figure, in the validation set, the AUC of the risk scoring system for hearing loss caused by chemoradiotherapy combining 8 SNP markers and 3 clinical factors was 0.782; when the sensitivity was 70.7%, the specificity was 69.8%.

[0544] like Figure 5 As shown in Figure B, with 0.9598 as the cutoff value of the risk score, the risk scoring system for hearing loss caused by radiotherapy and chemotherapy can clearly distinguish the high-risk population that is prone to hearing loss caused by radiotherapy and chemotherapy from the low-risk population that is not prone to hearing loss (HR = 4.54, 95% CI: 2.55-8.08, P = 2.84×10 -07 ).

[0545] The above results indicate that the risk scoring system for hearing loss caused by chemoradiotherapy established by combining 8 SNP markers with 3 clinical factors can effectively predict the risk of hearing loss caused by chemoradiotherapy in patients with nasopharyngeal carcinoma.

[0546] Example 5 Risk Scoring System for Hearing Loss Caused by Chemoradiotherapy

[0547] The present invention provides a risk scoring system for hearing loss caused by radiotherapy and chemotherapy, the system comprising: an information acquisition module, a storage module, an information analysis module, a judgment module and an output module.

[0548] The information acquisition module obtains characteristic parameters of the sample to be tested, which include genotyping of SNP markers 1 to 8 in the genomic DNA of the sample to be tested, as well as the diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose of the sample to be tested.

[0549] Among them, SNP marker 1: rs1050851;

[0550] SNP marker 2: rs117098517;

[0551] SNP marker 3: any one of rs1485149 or its linked SNP markers (rs11713855, rs73028787, rs9872473, rs6784713, rs36011752, rs34056014, rs66888336, rs869935, rs35486575, rs13072384, and rs3864080);

[0552] SNP marker 4: any one of rs17010289 or its linked SNP markers (rs17010288, rs117227749, and rs75222194);

[0553] SNP marker 5: any one of rs79938362 or its linked SNP marker (rs116989317);

[0554] SNP marker 6: rs73335760;

[0555] SNP marker 7: any one of rs201061882 or its linked SNP markers (rs11700622, rs75423607, rs76415665, rs112894701, rs79765594, rs73354686, rs76372004, rs11702842, rs73193458, and rs138904949);

[0556] SNP marker 8: any one of rs2275994 or its linked SNP markers (rs6996060, rs10104930, rs16868196, rs192243723, rs150249158, rs375127474 and rs141273852).

[0557] The storage module is used to store the characteristic parameters obtained in the information collection module and the threshold value of the risk score in the judgment module.

[0558] The information analysis module calculates the risk score by a formula according to the obtained characteristic parameters; the formula is: risk score = (0.5616 × score of diagnosis age) + (0.5433 × score of tumor T stage) + (0.5211 × score of concurrent chemotherapy cisplatin dose) + (a × score of genotyping of SNP marker 1) + (b × score of genotyping of SNP marker 2) + (c × score of genotyping of SNP marker 3) + (d × score of genotyping of SNP marker 4) + (e × score of genotyping of SNP marker 5) + (f × score of genotyping of SNP marker 6) + (g × score of genotyping of SNP marker 7) + (h × score of genotyping of SNP marker 8);

[0559] The scoring of the age at diagnosis is: diagnosis age <50 years = "0"; diagnosis age ≥50 years = "1"; the scoring of the tumor T stage is: T1-T2 stage = "0"; T3-T4 stage = "1"; the scoring of the concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155 mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1"; the genotyping scores of SNP markers 1 to 8 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2";

[0560] a, b, c, d, e, f, g and h are the regression coefficients of SNP markers 1 to 8, respectively. The values ​​of the regression coefficients are obtained by the method of step 2 of Example 4.

[0561] The genotyping of the SNP markers 1 to 8 is specifically as follows:

[0562] For the SNP marker 1:

[0563] The homozygous protective type of rs1050851 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0564] For the SNP marker 2:

[0565] The homozygous protective type of rs117098517 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0566] For the SNP marker 3:

[0567] The homozygous protective type of rs1485149 is AA, the heterozygous type is CA or AC, and the homozygous risk type is CC;

[0568] The homozygous protective type of rs11713855 is TT, the heterozygous type is CT or TC, and the homozygous risk type is CC;

[0569] The homozygous protective type of rs73028787 is CC, the heterozygous type is AC or CA, and the homozygous risk type is AA;

[0570] The homozygous protective type of rs9872473 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0571] The homozygous protective type of rs6784713 is TT, the heterozygous type is GT or TG, and the homozygous risk type is GG;

[0572] The homozygous protective type of rs36011752 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0573] The homozygous protective type of rs34056014 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0574] The homozygous protective type of rs66888336 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0575] The homozygous protective type of rs869935 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0576] The homozygous protective type of rs35486575 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0577] The homozygous protective type of rs13072384 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0578] The homozygous protective type of rs3864080 is TT, the heterozygous type is AT or TA, and the homozygous risk type is AA;

[0579] For the SNP marker 4:

[0580] The homozygous protective type of rs17010289 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0581] The homozygous protective type of rs17010288 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0582] The homozygous protective type of rs117227749 is AA, the heterozygous type is TA or AT, and the homozygous risk type is TT;

[0583] The homozygous protective type of rs75222194 is TT, the heterozygous type is CT or TC, and the homozygous risk type is CC;

[0584] For the SNP marker 5:

[0585] The homozygous protective type of rs79938362 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0586] The homozygous protective type of rs116989317 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0587] For the SNP marker 6:

[0588] The homozygous protective type of rs73335760 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0589] For the SNP marker 7:

[0590] The homozygous protective type of rs201061882 is TTCTTC, the heterozygous type is TTTC or TTCT, and the homozygous risk type is TT;

[0591] The homozygous protective type of rs11700622 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0592] The homozygous protective type of rs75423607 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0593] The homozygous protective type of rs76415665 is GG, the heterozygous type is CG or GC, and the homozygous risk type is CC;

[0594] The homozygous protective type of rs112894701 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0595] The homozygous protective type of rs79765594 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0596] The homozygous protective type of rs73354686 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0597] The homozygous protective type of rs76372004 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0598] The homozygous protective type of rs11702842 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0599] The homozygous protective type of rs73193458 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0600] The homozygous protective type of rs138904949 is ATAT, the heterozygous type is AAT or ATA, and the homozygous risk type is AA;

[0601] For the SNP marker 8:

[0602] The homozygous protective type of rs2275994 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0603] The homozygous protective type of rs6996060 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0604] The homozygous protective type of rs10104930 is AA, the heterozygous type is TA or AT, and the homozygous risk type is TT;

[0605] The homozygous protective type of rs16868196 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0606] The homozygous protective type of rs192243723 is AA, the heterozygous type is CA or AC, and the homozygous risk type is CC;

[0607] The homozygous protective type of rs150249158 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0608] The homozygous protective type of rs375127474 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0609] The homozygous protective type of rs141273852 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT.

[0610] The judgment module judges the risk of hearing loss caused by radiotherapy and chemotherapy of the sample to be tested according to the risk score, and the judgment standard is: if the risk score is greater than the threshold of the risk score, the sample to be tested is a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; if the risk score is less than the threshold of the risk score, the sample to be tested is a low-risk individual for hearing loss caused by radiotherapy and chemotherapy. The threshold of the risk score is obtained by the method of step 2 of Example 4.

[0611] The output module is used to output the risk of hearing loss caused by chemotherapy and radiotherapy of the sample to be tested.

[0612] In the above embodiments, the modules included are divided only according to functional logic, but are not limited to the above divisions, as long as the corresponding functions can be realized; in addition, the specific names of the functional modules are only for the convenience of distinguishing each other, and are not used to limit the scope of protection of the present invention.

[0613] Example 6 Risk Scoring System for Hearing Loss Caused by Chemoradiotherapy

[0614] The present invention provides a risk scoring system for hearing loss caused by radiotherapy and chemotherapy, the system comprising: an information acquisition module, a storage module, an information analysis module, a judgment module and an output module.

[0615] The information acquisition module obtains characteristic parameters of the sample to be tested, which include genotyping of SNP markers 1 to 8 in the genomic DNA of the sample to be tested, as well as the diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose of the sample to be tested.

[0616] Among them, SNP marker 1: rs1050851;

[0617] SNP marker 2: rs117098517;

[0618] SNP marker 3: rs1485149;

[0619] SNP marker 4: rs17010289;

[0620] SNP marker 5: rs79938362

[0621] SNP marker 6: rs73335760;

[0622] SNP marker 7: rs201061882;

[0623] SNP marker 8:rs2275994.

[0624] The storage module is used to store the characteristic parameters obtained in the information collection module and the threshold value (0.9598) of the risk score in the judgment module.

[0625] The information analysis module calculates the risk score through a formula based on the obtained characteristic parameters; the formula is: risk score = (0.5616×score of diagnosis age) + (0.5433×score of tumor T stage) + (0.5211×score of concurrent chemotherapy cisplatin dose) + (0.8548×score of genotyping of SNP marker 1) + (1.7102×score of genotyping of SNP marker 2) + (1.2895×score of genotyping of SNP marker 3) + (1.1940×score of genotyping of SNP marker 4) + ( 1.8931×the score of genotyping of SNP marker 5)+(1.2720×the score of genotyping of SNP marker 6)+(1.5115×the score of genotyping of SNP marker 7)+(1.4220×the score of genotyping of SNP marker 8); the score of the diagnosis age is: diagnosis age <50 years old = "0"; diagnosis age ≥50 years old = "1"; the score of the tumor T stage is: T1-T2 stage = "0"; T3-T4 stage = "1"; the score of the concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155 mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1"; the genotyping scores of SNP markers 1 to 8 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2".

[0626] The genotyping of the SNP markers 1 to 8 is shown in Table 4 of Example 4, specifically:

[0627] The homozygous protective type of rs1050851 is GG, the heterozygous type is AG or GA, and the homozygous risk type is AA;

[0628] The homozygous protective type of rs117098517 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0629] The homozygous protective type of rs1485149 is AA, the heterozygous type is CA or AC, and the homozygous risk type is CC;

[0630] The homozygous protective type of rs17010289 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0631] The homozygous protective type of rs79938362 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT;

[0632] The homozygous protective type of rs73335760 is AA, the heterozygous type is GA or AG, and the homozygous risk type is GG;

[0633] The homozygous protective type of rs201061882 is TTCTTC, the heterozygous type is TTTC or TTCT, and the homozygous risk type is TT;

[0634] The homozygous protective type of rs2275994 is CC, the heterozygous type is TC or CT, and the homozygous risk type is TT.

[0635] The judgment module judges the risk of hearing loss caused by radiotherapy and chemotherapy of the sample to be tested based on the risk score, and the judgment standard is: if the risk score is greater than 0.9598, the sample to be tested is a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; if the risk score is less than or equal to 0.9598, the sample to be tested is a low-risk individual for hearing loss caused by radiotherapy and chemotherapy.

[0636] The output module is used to output the risk of hearing loss caused by chemotherapy and radiotherapy of the sample to be tested.

[0637] In the above embodiments, the modules included are divided only according to functional logic, but are not limited to the above divisions, as long as the corresponding functions can be realized; in addition, the specific names of the functional modules are only for the convenience of distinguishing each other, and are not used to limit the scope of protection of the present invention.

[0638] Example 7 A kit for detecting the risk of hearing loss caused by tumor radiotherapy and chemotherapy

[0639] 1. Composition

[0640] The main components of the kit include the PCR amplification primers and probes shown in Table 6, and also include the common reagents required for the corresponding PCR technology: such as dNTP mixed solution, MgCl2 solution, PCR reaction buffer, PCR reaction enzyme, double distilled water, blank control and positive control. The blank control is double distilled water; the positive control is the standard for determining the genotype of the 8 SNP markers and their linked SNP markers shown in Table 7, with a concentration of 50ng / μL.

[0641] Table 6 PCR amplification primers and probes for 8 SNP markers and their linked SNP markers

[0642]

[0643]

[0644]

[0645] Table 7 Standards for determining genotypes of 8 SNP markers and their linked SNP markers

[0646]

[0647]

[0648]

[0649]

[0650]

[0651]

[0652]

[0653]

[0654] The bases marked with boxes in the table are the reference allele and effect allele of each SNP marker.

[0655] 2. Usage

[0656] 1. Extraction of genomic DNA from samples to be tested

[0657] This kit has no special restrictions on the source of samples. Whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal endoscopy samples, urine, feces and other biological specimens containing human DNA can be used as samples to be tested.

[0658] This kit does not specify the extraction method for the genomic DNA of the sample to be tested. Generally, it can be extracted using conventional laboratory methods (phenol-chloroform extraction method) or the kit.

[0659] The concentration and purity of DNA were determined, and the concentration of DNA that passed the routine quality inspection was adjusted to 50 ng / μL for subsequent testing.

[0660] 2. PCR reaction

[0661] Set up three tubes of blank control, positive control and test sample. The amplification template of the blank control is double distilled water, the amplification template of the positive control is the sequence shown in Table 7 (SEQ ID No: 161-240), and the amplification template of the test sample is the genomic DNA of the test sample extracted in the previous step. According to the SNP markers to be detected, select the corresponding amplification primers and probes in Table 6, and prepare the PCR reaction system shown in Table 8.

[0662] Table 8 PCR reaction system

[0663]

[0664] The PCR reaction amplification conditions were as follows: 60°C for 30 seconds; 95°C for 10 minutes; 95°C for 15 seconds, 60°C for 1 minute, 45 cycles; 60°C for 30 seconds.

[0665] The above PCR reaction system and amplification conditions were used to carry out fluorescence quantitative PCR reaction, and the fluorescence change information during the PCR reaction was collected.

[0666] 3. Interpretation of results

[0667] According to the genotyping shown in Table 4 in Example 4, the genotyping of SNP markers 1 to 8 of each sample was analyzed and determined, and the risk scoring system for hearing loss caused by chemoradiotherapy in Example 5 was used for calculation and determination in combination with the diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose of the corresponding sample.

[0668] Example 8 A kit for detecting the risk of hearing loss caused by tumor radiotherapy and chemotherapy

[0669] 1. Composition

[0670] The main components of the kit include the PCR amplification primers and probes shown in Table 9, and also include the common reagents required for the corresponding PCR technology: such as dNTP mixed solution, MgCl2 solution, PCR reaction buffer, PCR reaction enzyme, double distilled water, blank control and positive control. The blank control is double distilled water; the positive control is the standard for determining the genotype of the 8 SNP markers shown in Table 10, with a concentration of 50ng / μL.

[0671] Table 9 PCR amplification primers and probes for 8 SNP markers

[0672]

[0673] Table 10 Standards for determining genotypes of 8 SNP markers

[0674]

[0675]

[0676]

[0677] The bases marked with boxes in the table are the reference allele and effect allele of each SNP marker.

[0678] 2. Usage

[0679] 1. Extraction of genomic DNA from samples to be tested

[0680] This kit has no special restrictions on the source of samples. Whole blood, blood clots, serum, plasma, saliva, oropharyngeal swabs, nasopharyngeal swabs, nasopharyngeal endoscopy samples, urine, feces and other biological specimens containing human DNA can be used as samples to be tested.

[0681] This kit does not specify the extraction method for the genomic DNA of the sample to be tested. Generally, it can be extracted using conventional laboratory methods (phenol-chloroform extraction method) or the kit.

[0682] The concentration and purity of DNA were determined, and the concentration of DNA that passed the routine quality inspection was adjusted to 50 ng / μL for subsequent testing.

[0683] 2. PCR reaction

[0684] Set up three tubes of blank control, positive control and test sample. The amplification template of the blank control is double distilled water, the amplification template of the positive control is the sequence shown in Table 10, and the amplification template of the test sample is the genomic DNA of the test sample extracted in the previous step. According to the SNP markers to be detected, select the corresponding amplification primers and probes in Table 9, and prepare the PCR reaction system shown in Table 11.

[0685] Table 11 PCR reaction system

[0686]

[0687] The PCR reaction amplification conditions were as follows: 60°C for 30 seconds; 95°C for 10 minutes; 95°C for 15 seconds, 60°C for 1 minute, 45 cycles; 60°C for 30 seconds.

[0688] The above PCR reaction system and amplification conditions were used to carry out fluorescence quantitative PCR reaction, and the fluorescence change information during the PCR reaction was collected.

[0689] 3. Interpretation of results

[0690] According to the genotyping shown in Table 4 in Example 4, the genotyping of SNP markers 1 to 8 of each sample was analyzed and determined, and the risk scoring system for hearing loss caused by chemoradiotherapy in Example 6 was used for calculation and determination in combination with the diagnosis age, tumor T stage and concurrent chemotherapy cisplatin dose of the corresponding sample.

[0691] Example 9 Application of a kit for detecting the risk of hearing loss caused by tumor radiotherapy and chemotherapy

[0692] 1. Experimental Methods

[0693] The risk of hearing loss caused by radiotherapy and chemotherapy in 5 nasopharyngeal carcinoma patients was predicted using the kit of Example 8. The clinical information of the 5 nasopharyngeal carcinoma patients is shown in Table 12.

[0694] Table 12 Clinical information of 5 patients with nasopharyngeal carcinoma

[0695]

[0696] 2. Experimental Results

[0697] The genotyping results of SNP markers 1 to 8 (SNP marker 1: rs1050851, SNP marker 2: rs117098517, SNP marker 3: rs1485149, SNP marker 4: rs17010289, SNP marker 5: rs79938362, SNP marker 6: rs73335760, SNP marker 7: rs201061882 and SNP marker 8: rs2275994) of 5 NPC patients are shown in Table 13.

[0698] Table 13 Genotyping results of SNP markers detected by the kit for 5 nasopharyngeal carcinoma patients

[0699]

[0700] Based on the clinical information and the genotyping results of SNP markers 1 to 8, the risk scores of the five NPC patients were calculated as shown in Table 14.

[0701] Table 14 Risk scores of 5 patients with nasopharyngeal carcinoma

[0702]

[0703]

[0704] The results showed that the risk scores of these five nasopharyngeal carcinoma patients were all greater than 0.9598, so these five patients were at high risk of hearing loss caused by radiotherapy and chemotherapy.

[0705] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Use of a reagent for detecting SNP markers associated with hearing loss caused by radiotherapy and chemotherapy in the preparation of a kit for predicting the risk of hearing loss caused by radiotherapy and chemotherapy in patients with nasopharyngeal carcinoma by combining the SNP markers with three clinical factors, characterized in that: The SNP markers are composed of rs1050851, rs117098517, rs1485149, rs17010289, rs79938362, rs73335760, rs201061882 and rs2275994; the chemoradiotherapy is radiotherapy combined with cisplatin chemotherapy for patients with nasopharyngeal carcinoma; the three clinical factors are the age of nasopharyngeal carcinoma diagnosis, nasopharyngeal carcinoma T stage and nasopharyngeal carcinoma concurrent chemotherapy cisplatin dose of the nasopharyngeal carcinoma patients.

2. The use according to claim 1, characterized in that: The reagents are primers and probes for detecting rs1050851, rs117098517, rs1485149, rs17010289, rs79938362, rs73335760, rs201061882 and rs2275994.

3. The use according to claim 2, characterized in that: The primers and probes are as follows: The primers for detecting rs1050851, the nucleotide sequences are shown in SEQ ID Nos: 1 to 2; The primers for detecting rs117098517, the nucleotide sequences are shown in SEQ ID Nos: 5-6; The primers for detecting rs1485149, the nucleotide sequences are shown in SEQ ID Nos: 9 to 10; The primers for detecting rs17010289, the nucleotide sequences are shown in SEQ ID Nos: 57-58; The primers for detecting rs79938362, the nucleotide sequences of which are shown in SEQ ID Nos: 73-74; The primers for detecting rs73335760, the nucleotide sequences of which are shown in SEQ ID Nos: 81 to 82; Primers for detecting rs201061882, the nucleotide sequences of which are shown in SEQ ID Nos: 85-86; Primers for detecting rs2275994, the nucleotide sequences of which are shown in SEQ ID Nos: 129 to 130; The probe for detecting rs1050851, the nucleotide sequence of which is shown in SEQ ID No: 3-4; The probe for detecting rs117098517, the nucleotide sequence of which is shown in SEQ ID Nos: 7 to 8; The probe for detecting rs1485149 has a nucleotide sequence as shown in SEQ ID Nos: 11 to 12; The probe for detecting rs17010289 has a nucleotide sequence as shown in SEQ ID Nos: 59 to 60; The probe for detecting rs79938362 has a nucleotide sequence as shown in SEQ ID Nos: 75 to 76; The probe for detecting rs73335760 has a nucleotide sequence as shown in SEQ ID Nos: 83-84; The probe for detecting rs201061882 has a nucleotide sequence as shown in SEQ ID Nos: 87 to 88; The nucleotide sequence of the probe for detecting rs2275994 is shown in SEQ ID Nos: 131-132.

4. A risk scoring system for hearing loss in patients with nasopharyngeal carcinoma caused by radiotherapy and chemotherapy, wherein the radiotherapy and chemotherapy are radiotherapy combined with cisplatin chemotherapy for patients with nasopharyngeal carcinoma, characterized in that: It includes information collection module, storage module, information analysis module, judgment module and output module; The information acquisition module is used to obtain characteristic parameters of the sample to be tested, and the characteristic parameters include the genotype typing of the SNP marker in the genomic DNA of the sample of the nasopharyngeal carcinoma patient to be tested in claim 1, and the nasopharyngeal carcinoma diagnosis age, nasopharyngeal carcinoma T stage and nasopharyngeal carcinoma concurrent chemotherapy cisplatin dose of the nasopharyngeal carcinoma patient to be tested; The storage module is used to store the characteristic parameters obtained in the information collection module and the threshold of the risk score in the judgment module, and the threshold of the risk score is 0.9598; The information analysis module calculates the risk score by a formula according to the obtained characteristic parameters; the formula is: risk score=(0.5616×score of diagnosis age)+(0.5433×score of tumor T stage)+(0.5211×score of concurrent chemotherapy cisplatin dose)+(a×score of genotyping of rs1050851)+(b×score of genotyping of rs117098517)+(c×score of genotyping of rs1485149)+(d×score of genotyping of rs17010289)+(e×score of genotyping of rs79938362)+(f×score of genotyping of rs73335760)+(g×score of genotyping of rs201061882)+(h×score of genotyping of rs2275994); The scoring of the age of diagnosis is: nasopharyngeal carcinoma diagnosis age <50 years = "0"; nasopharyngeal carcinoma diagnosis age ≥50 years = "1"; the scoring of the tumor T stage is: T1-T2 stage = "0"; T3-T4 stage = "1"; the scoring of the concurrent chemotherapy cisplatin dose is: concurrent chemotherapy cisplatin dose <155 mg / m 2 = "0", concurrent chemotherapy cisplatin dose ≥ 155 mg / m 2 = "1"; the genotyping scores of rs1050851, rs117098517, rs1485149, rs17010289, rs79938362, rs73335760, rs201061882 and rs2275994 are: homozygous protective type = "0"; heterozygous type = "1"; homozygous risk type = "2", and the tumor is nasopharyngeal carcinoma; The judgment module is used to judge the risk of hearing loss caused by radiotherapy and chemotherapy of the sample to be tested according to the risk score and the threshold of the risk score; the risk judgment standard is: if the risk score is greater than the threshold of the risk score, the nasopharyngeal carcinoma patient to be tested is a high-risk individual for hearing loss caused by radiotherapy and chemotherapy; if the risk score is less than or equal to the threshold of the risk score, the nasopharyngeal carcinoma patient to be tested is a low-risk individual for hearing loss caused by radiotherapy and chemotherapy; the output module is used to output the risk of hearing loss caused by radiotherapy and chemotherapy of the sample to be tested.

Images