A crRNA target point and crisper-cas13a system for detecting pigeon paramyxovirus

Abstract

The application discloses a crRNA target point and a CRISPR-Cas13a system for detecting pigeon paramyxovirus. The CRISPR-Cas13a system comprises a Cas13a protein and a crRNA, or a complex formed by the two; the crRNA comprises an anchor sequence for being combined with the Cas13a protein and a guide sequence for targeting a pigeon paramyxovirus target point sequence; and the pigeon paramyxovirus target point sequence is sequence 1. Experiments prove that the crRNA can realize high-sensitivity and high-specificity detection on the nucleic acid of the pigeon paramyxovirus by activating the Cas13a, and the sensitivity reaches a single copy (1 copy / µL).

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular diagnosis, and relates to a crRNA target point and a CRISPR-Cas13a system for detecting Junin virus. BACKGROUND

[0002] The Junin virus belongs to the arenaviridae family of the arenavirus genus, and is a new world group virus, and is the pathogen of Argentine hemorrhagic fever. The Junin virus is a ribonucleic acid (RNA) virus, with a diameter of 60-280 nanometers, an average of 110-130 nanometers, a spherical shape, a flat spherical shape or a variety of shapes. There are 2-10 long rod-shaped protrusions on the outer membrane, about 6 nanometers in length, and 2-10 spherical granules with a diameter of 20-25 nanometers in the virion. The Junin virus can be chronically infected in hystricomorph animals, and these hystricomorph animals exist widely in their natural habitats. Humans are infected with the disease through mucous membrane exposure, droplets or direct contact of broken skin with infected materials. Human-to-human transmission is very rare, but it can also occur through direct contact with infected tissue fluid of patients, and hospital infections have been reported. Large-scale infection cases mainly occur in the harvest season in Argentina, but a small-scale infection peak also occurs in May. The incidence of the disease in men is four times that in women, and the infection probability of urban population is much lower than that of rural population. The incidence of Argentine hemorrhagic fever is positively correlated with the population density of the habitat of the dryland mouse each year. The epidemiological characteristics of the disease can be alleviated by vaccinating high-risk groups, and the current main detection technology is the fluorescent quantitative PCR method, which is stable, reliable and has a certain sensitivity, but the sample processing is complex, and the instrument requirement is high.

[0003] In April 2017, American researchers established a nucleic acid detection technology with a sensitivity of atomic level (single copy) and a specificity of single base, a nucleic acid detection platform SHERLOCK (Specific High Sensitivity Enzymatic Reporter UnLOCKing) based on CRISPR-Cas13a, which utilizes the non-specific cleavage activity of Leptotrichia wadei Cas13a protein (LwCas13a) and combines with the recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA) to realize rapid, inexpensive and highly sensitive detection of trace nucleic acids. SUMMARY

[0004] The first object of the application is to provide a CRISPR-Cas13a system for detecting Junin virus.

[0005] The CRISPR-Cas13a system for detecting pigeon paramyxovirus provided by the application comprises a Cas13a protein and a crRNA, or a complex formed by the two.

[0006] The crRNA comprises an anchor sequence for binding with the Cas13a protein and a guide sequence for targeting a pigeon paramyxovirus target sequence.

[0007] The pigeon paramyxovirus target sequence is sequence 1.

[0008] In the CRISPR-Cas13a system, the crRNA sequence is sequence 2. The first to 38th of sequence 2 is an anchor sequence for binding with the Cas13a protein; the 39th to 66th of sequence 2 is a guide sequence for targeting a pigeon paramyxovirus target sequence.

[0009] In the CRISPR-Cas13a system, the Cas13a protein is an LwCas13a protein.

[0010] The second object of the application is to provide a kit for detecting pigeon paramyxovirus.

[0011] The kit for detecting pigeon paramyxovirus provided by the application comprises the CRISPR-Cas13a system for detecting pigeon paramyxovirus.

[0012] Further, the kit further comprises a primer pair for specifically amplifying the pigeon paramyxovirus target sequence; the primer pair comprises a single-stranded DNA molecule shown in sequence 4 and a single-stranded DNA molecule shown in sequence 5.

[0013] Still further, the kit further comprises other reagents for specifically amplifying the pigeon paramyxovirus target sequence and other reagents for detecting the amplification product. The other reagents for specifically amplifying the pigeon paramyxovirus target sequence comprise a buffer and / or ddH2O; the other reagents for detecting the amplification product comprise all or part of the following reagents: LwCas13a protein, NTP (such as NTP Mix), T7 RNA polymerase, RNAse inhibitor, reporter RNA (RNAse Alert v2, the reporter RNA is an RNA molecule with signal reporting function), RNase free water.

[0014] The kit can further comprise a carrier with the following determination standard A or determination standard B:

[0015] CRISPR-Cas13a fluorescence detection system determination standard A: if the fluorescence intensity value of the detection system of the sample to be tested is 3 times higher than that of the negative control (ddH2O) (including the case where the fluorescence intensity value of the sample to be tested is 3 times higher than that of the negative control) in the same detection time, or the fluorescence intensity value of the sample to be tested is greater than or equal to 0.1 a.u. at any time, then the sample to be tested contains or is suspected to contain Pteronemia virus, otherwise the sample to be tested does not contain or is suspected not to contain Pteronemia virus.

[0016] CRISPR-Cas13a fluorescence detection system determination standard B: the determination is made 2-5 minutes after the detection reaction system is dropped on the test paper, if the test paper does not show the "T" line and shows the "C" line, then the sample to be tested contains or is suspected to contain Pteronemia virus; if the test paper shows the "T" line and the "C" line, then the sample to be tested does not contain or is suspected not to contain Pteronemia virus; if the test paper does not show the "C" line, then the test paper is invalid and needs to be replaced for retesting.

[0017] A third object of the present application is to provide any of the following substances:

[0018] A1) the above-mentioned crRNA;

[0019] A2) the above-mentioned Cas13a protein and crRNA, or a complex formed by the two;

[0020] A3) the above-mentioned primer pair.

[0021] A fourth object of the present application is to provide any of the following applications:

[0022] B1) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for detecting or assisting in detecting Pteronemia virus or its nucleic acid;

[0023] B2) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for preparing a product for detecting or assisting in detecting Pteronemia virus or its nucleic acid;

[0024] B3) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for detecting or assisting in detecting whether the sample to be tested contains Pteronemia virus or its nucleic acid;

[0025] B4) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for preparing a product for detecting or assisting in detecting whether the sample to be tested contains Pteronemia virus or its nucleic acid;

[0026] B5) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for screening or assisting in screening Pteronemia virus prevention and treatment drugs;

[0027] B6) the above-mentioned system or the above-mentioned kit or the above-mentioned substance for preparing a product for screening or assisting in screening Pteronemia virus prevention and treatment drugs.

[0028] B7) Use of the above-mentioned substances in the manufacture of the above-mentioned kits.

[0029] A last object of the present application is to provide a method for detecting or aiding in the detection of Pteropine virus.

[0030] The method for detecting or aiding in the detection of Pteropine virus provided by the present application comprises the following steps:

[0031] C1) performing RAA amplification with the nucleic acid of the sample to be tested as a template and a primer pair consisting of the single-stranded DNA molecule shown in sequence 4 and the single-stranded DNA molecule shown in sequence 5, to obtain a RAA product;

[0032] C2) preparing a CRISPR-Cas13a detection system containing the following components: the RAA product, Cas13a protein, the above-mentioned crRNA, reporter RNA, NTP, T7 RNA polymerase and RNAase inhibitor; and replacing the RAA product with water (ddH2O) as a negative control;

[0033] C3) reacting the CRISPR-Cas13a detection system, detecting the reaction product, and thereby determining whether the sample to be tested contains Pteropine virus.

[0034] The above-mentioned reaction is a fluorescence system reaction C3)-1 or a test strip system reaction C3)-2:

[0035] C3)-1: the CRISPR-Cas13a detection system, and the RNA in the CRISPR-Cas13a detection system is a fluorescent reporter RNA, the CRISPR-Cas13a detection system is placed in a fluorescent quantitative PCR instrument for reaction, the fluorescence intensity is detected, and whether the sample to be tested contains Pteropine virus is determined according to the size of the fluorescence intensity: if the fluorescence intensity value of the sample to be tested is more than 3 times (including the case that the fluorescence intensity value of the sample to be tested is 3 times the fluorescence intensity value of the negative control) the fluorescence intensity value of the negative control in the same detection time, or the fluorescence intensity value of the sample to be tested is greater than or equal to 0.1 a.u. at any time, then the sample to be tested contains or is suspected to contain Pteropine virus, otherwise the sample to be tested does not contain or is suspected not to contain Pteropine virus.

[0036] C3)-2: the CRISPR-Cas13a detection system is reacted, and the RNA in the CRISPR-Cas13a detection system is the reporter RNA for the test paper detection, the reaction product is detected by the test paper, and whether the sample to be detected contains the Pteronida virus is determined according to whether the "T" line disappears and the "C" line appears: if the "T" line disappears and the "C" line appears in the sample to be detected detection system within the same detection time, the sample to be detected contains or is suspected to contain the Pteronida virus, otherwise the sample to be detected does not contain or is suspected not to contain the Pteronida virus.

[0037] Further, in step C1), the reaction condition of the RAA amplification is: 42℃ for 20-40 minutes;

[0038] In step C3)-1, the reaction condition is: 37℃, read the fluorescence intensity value every 2 min, and read 40 times.

[0039] In step C3)-2 above, the reaction condition is: 37℃, react for 30 min.

[0040] Further, the sample to be detected can be a blood sample, an organ (such as liver, spleen, kidney, etc.) tissue sample, cells, etc.

[0041] The method for detecting or assisting in detecting Pteronida virus provided by the application can be a non-disease diagnosis and treatment method, or a disease diagnosis and treatment method. The non-disease diagnosis and treatment method can be used to detect whether Pteronida virus is contained in cells before and after drug administration when screening Pteronida virus prevention and treatment drugs at the cell level.

[0042] Based on the CRISPR-Cas13a nucleic acid detection technology, a target sequence for detecting Pteronida virus and a specific crRNA capable of targeting the target sequence are finally provided by designing, constructing and screening. The crRNA can activate Cas13a to realize high-sensitivity and high-specificity detection of Pteronida virus nucleic acid, and the sensitivity reaches single copy (1 copy / μL). BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 It is an agarose gel electrophoresis screening result graph of candidate RAA primers.

[0044] Figure 2 It is a fluorescence value column chart of candidate crRNA No. 1 for detecting Pteronida virus.

[0045] Figure 3 It is a fluorescence value column chart of candidate crRNA No. 2 for detecting Pteronida virus.

[0046] Figure 4Time-Fluorescence curve of CRISPR-Cas13a containing crRNA-2 detecting Pigeon paramyxovirus.

[0047] Figure 5 Results of CRISPR-Cas13a containing crRNA-2 detecting Pigeon paramyxovirus (10 min).

[0048] Figure 6 Results of CRISPR-Cas13a containing crRNA-2 detecting Pigeon paramyxovirus (strip chart).

[0049] Figure 7 CRISPR-Cas13a against Pigeon paramyxovirus did not show cross-reaction when detecting other pathogens (fluorescence chart).

[0050] Figure 8 CRISPR-Cas13a against Pigeon paramyxovirus did not show cross-reaction when detecting other pathogens (30 min after the start of detection).

[0051] Figure 9 CRISPR-Cas13a against Pigeon paramyxovirus did not show cross-reaction when detecting other pathogens (strip chart). DETAILED DESCRIPTION

[0052] The application will be further described in conjunction with the specific embodiments, and the examples given are only for the purpose of illustrating the application, but not for limiting the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0053] The following examples facilitate a better understanding of the application, but do not limit the application. In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the test materials used are commercially available from conventional biochemical reagent stores unless otherwise specified. In the following examples, the quantitative tests were set up with three repeated experiments, and the results were averaged.

[0054] The reagents involved in the following examples and their sources are as follows:

[0055] NTP mix (NEB, N0466S), 2* Super PFX MasterMix (Kangwei 07984 / 30425), LwCas13a protein (GenScript Z03486-100), Agarose gel electrophoresis DNA purification and recovery kit (Tiangen Biotech, DP219-03), T7 transcription kit (T7 Quick High Yield RNA Synthesis kit, NEB, E2050S), RNase inhibitor (MurineRNase inhibitor, NEB, M0314L), T7 RNA polymerase (NEB, M0251S), RNA purification magnetic beads (AgencourtRNAClean XP, Beckman Coulter, A63987), ExTaq Mix (TaKaRa, RR001Q), Tris balanced phenol (Haoyang Biotechnology, TBD0001HY), RAA amplification kit (Hangzhou Zhongce), fluorescent reporter RNA (RNaseAlert) TM QC System v2 (Thermo Fisher Scientific, 4479769), Reporter RNA (Tianyi Huiyuan, 203130347), HEPES buffer (Solepro, YZ-B-HEPES250), MgCl2 solution (Tiangen Biotech, RP107), CRISPR test strip (Hangzhou Zhongce, 211108004).

[0056] Plasmids were constructed from the pathogens of cyclophosphamide virus (JV, GenBank ID:2943089), yellow fever virus (YFV, GenBank ID:NC_002031), Ebola virus (EBOV, GenBank ID:AF086833.2), rickettsia (Cb, GenBank ID:NZ-CP040059.1), Venezuelan equine encephalitis virus (VEEV, GenBank ID:U34999.1), and dengue virus (DENV, GenBank ID:U87411).

[0057] Example 1: CRISPR-Cas13a-based nucleic acid detection kit and detection method for Jiuning virus

[0058] I. CRISPR-Cas13a-based Jiuning virus nucleic acid detection kit

[0059] (I) Preparation of crRNA

[0060] 1. Primer sequence synthesis

[0061] Synthesize the sequences in Table 1.

[0062] Table 1, primer sequence

[0063]

[0064] 2, PCR amplification

[0065] The sequence synthesized in step 1 above was diluted with ddH2O to 10 μM, and a PCR reaction system was prepared. The preparation of the PCR reaction system is shown in Table 2.

[0066] Table 2, PCR amplification system

[0067] Name Volume JV-crRNA-F 2 μL T7-crRNA-F 2 μL JV-crRNA-R 2 μL 2*Super pfx MasterMix 25 μL ddH2O 19 μL Total volume 50 μL

[0068] PCR reaction conditions: 95°C for 5 min for heat denaturation; 95°C for 30 s, 55°C for 30 s, 72°C for 15 s, for a total of 38 cycles; 72°C for automatic extension for 10 min; 4°C for storing the PCR product. The PCR product obtained by amplification with the JV-crRNA primer pair shown in Table 1 was obtained.

[0069] 3, PCR product purification

[0070] The PCR product obtained in step 2 was purified using Tris-balanced phenol, and the specific steps were as follows: 500 μL of Tris-balanced phenol (Cantabio) was taken, an equal volume of chloroform was added, and after oscillation and mixing, a short centrifugation was performed, and the supernatant was discarded; 150 μL of the phenol-chloroform mixture was added to the PCR product, mixed, and centrifuged at 12,000 rpm for 1 min; the supernatant was taken to a new 1.5 mL centrifuge tube, anhydrous ethanol was added to make the ratio of supernatant to ethanol 3:7, and centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded; 200 μL of 75% ethanol was added, and centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded (this step was performed three times). The obtained precipitate was air-dried at room temperature (about 10 min), and the purified PCR product was obtained.

[0071] The purified PCR product was added to 50 μL of RNase-free water, the concentration was detected by Nanodrop, and it was stored at -20°C.

[0072] 4, transcription

[0073] 1 μg of the purified PCR aqueous solution obtained in step 3 was taken, and a T7 transcription kit (NEB) was used to transcribe crRNA. The crRNA transcription system is shown in Table 3.

[0074] Table 3, crRNA transcription system

[0075]

[0076]

[0077] After mixing the above crRNA transcription system, transcription was performed at 37°C overnight, and DNase I was used to remove excess DNA: 20 μL of RNase-free water was added to the transcription product obtained in the previous step, 2 μL of DNase I was added, mixed, incubated at 37°C for 15 min.

[0078] The crRNA sequence obtained by transcription was named JV-crRNA-1 and JV-crRNA-2, and the sequence of JV-crRNA-2 was as follows: GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCCUGCCUAUAUUUUCGGAGGAUGUGUU (sequence 2), wherein the first to 38th positions of sequence 2 are an anchor sequence for binding with a Cas13a protein; and the 39th to 66th positions of sequence 2 are a guide sequence targeting a target sequence of a pigeon paramyxovirus.

[0079] The target sequence of JV-crRNA-2 is as follows: AACACATCCTCCGAAAATATAGGCAGGA (sequence 1), located at positions 5325-5352 of the JV genome (GeneID: 2943089). The prepared JV-crRNA-2 is used for subsequent CRISPR-Cas13a detection.

[0080] 5. crRNA purification

[0081] The crRNA obtained by transcription in step 3 was purified according to the Agencourt RNA Clean XP instruction (Beckman Coulter), and the specific steps were as follows: the magnetic beads were mixed by oscillation, 1.8 times the volume of magnetic beads was added to the transcription product, and the magnetic beads and transcription system were mixed by blowing 10 times or vortexing 30 s, and then the reaction system was placed in a magnetic stand and incubated at room temperature for 5-10 min to separate the magnetic beads. The liquid in the system was gently sucked out to avoid the magnetic beads being sucked out, 200 μL of 70% ethanol (prepared with RNase-free water) was added to the magnetic beads, and the system was incubated at room temperature for 30 s, and then the ethanol was sucked out; the magnetic beads were washed by repeating the above process for 3 times. The system was air-dried at room temperature to remove the ethanol, about 10 min. 50 μL of RNase-free water was added, vortexed for 30 s or blown 10 times with a pipette, and then the supernatant was sucked out and placed in an RNase-free 1.5 mL centrifuge tube. The concentration of the purified crRNA was determined by Nanodrop (the concentration of JV-crRNA-1 was 2500 ng / μL, and the concentration of JV-crRNA-2 was 2250 ng / μL), and the prepared crRNA was stored at -80°C.

[0082] (II) Preparation of plasmid standard

[0083] 1. Plasmid sequence

[0084] Plasmid-Junin is a plasmid obtained by inserting the sequence from Junin virus genome: AACACTAACAATCTTAATATTGGCCTTGTCATTGTCATGAGTTCGTGGCTAAAATCCAACCAGCTGGTCATTTCCTCACACATTTCAATTAACACATCCTCCGAAAATATAGGCAGGAAAAATCTCTTTGGATCACAGTAAAAAGAGCCTTGTTCTTC (Sequence 3) into pUC57 vector (purchased from Beijing Tianyi Huisheng Biotechnology Co., Ltd.). In Sequence 3, positions 90-117 are the target sequence of JV-crRNA-1, and positions 91-118 are the target sequence of JV-crRNA-2.

[0085] The Plasmid-Junin is transformed into E. coli TOP10 bacteria to obtain a recombinant bacterium.

[0086] 2. Plasmid extraction (full-scale gold)

[0087] The glycerol bacteria obtained in the above 1 (1:500) are added to Amp + LB (10 μL of glycerol bacteria + 5 ml of LB) is taken, 37°C, 200 rpm, and bacteria are inoculated overnight. The bacterial solution of the overnight culture is centrifuged at 10,000 g for 1 min, and the supernatant is removed (as much as possible). If the amount of bacterial solution is too large, it can be centrifuged in multiple times. Add 250 μL of colorless solution RB (containing RNase A), shake to suspend the bacterial precipitate, and do not leave small bacterial clumps. Add 250 μL of blue solution LB, gently mix 4-6 times, and fully lyse the bacterial cells to form a blue transparent solution. The color changes from semi-transparent to transparent blue, indicating complete lysis (not more than 5 min). Add 350 μL of yellow solution NB, mix gently 5-6 times (the color changes from blue to yellow, indicating uniform mixing and complete neutralization), until a compact yellow agglomeration is formed. Let it stand at room temperature for 2 min. Centrifuge at 12,000 g for 5 min, and carefully remove the supernatant and add it to the centrifugal column. Centrifuge at 12,000 g for 1 min, and discard the effluent. If the volume of the supernatant is greater than 800 μL, it can be added to the column in multiple times, and centrifuged as above, and the effluent is discarded. Add 650 μL of solution WB, centrifuge at 12,000 g for 1 min, and discard the effluent. Centrifuge at 12,000 g for 1-2 min to completely remove the residual WB. Place the centrifugal column in a clean centrifuge tube, and add 30-50 μL of EB or deionized water (pH > 7.0) to the center of the column. Let it stand at room temperature for 1 min. Centrifuge at 10,000 g for 1 min to elute the DNA, measure the concentration, and store it at -20°C.

[0088] 3. Plasmid concentration determination

[0089] The concentration of the plasmid Plasmid-Junin extracted above 2 was measured by Thermo's ultramicro spectrophotometer: 185.7 ng / μL.

[0090] The length of the plasmid Plasmid-Junin was 2868 bp.

[0091] Formula: copies / μL = 6.02 x 10 23 x (ng / μL) x 10 -9 / DNA Length x 660.

[0092] The copy number of the plasmid Plasmid-Junin was 6 x 10 10 copies / μL.

[0093] 4、Dilution

[0094] Take 10 μL of plasmid into 50 μL of water to obtain a concentration of 1 x 10 9 copies / μL of plasmid standard.

[0095] (Three) Design of RAA amplification primer and obtaining of RAA amplification product

[0096] 1、Design of RAA amplification primer

[0097] According to the RPA primer design in the reference (PMID: 27246147) for the design of Junin Virus specific RAA primer for CRISPR detection, there is a T7 transcription sequence at the 5' end of the primer, so that the double-stranded DNA (dsDNA) obtained by RAA amplification can be recognized by T7 RNA polymerase and transcribed. The primer sequence is shown in Table 4, which is synthesized by Beijing Tianyi Huiyuan Company.

[0098] Table 4, JV-RAA amplification primer

[0099]

[0100]

[0101] 2、Obtaining of RAA amplification product

[0102] The plasmid standard was used as a template, and the primer designed in step 1 was used for RAA amplification to obtain the RAA amplification product. The RAA amplification system is shown in Table 5.

[0103] Table 5, RAA amplification system

[0104] Name Volume Plasmid-Junin 5 μL JV-F (10 μM) 2 μL JV-R (10 μM) 2 μL Buffer (provided with RAA amplification kit) 25 μL ddH2O 13.5 μL Total volume 47.5 μL

[0105] Add the mixed 47.5 μL solution to the base reaction unit containing the lyophilized powder, and fully resolubilize and homogenize the lyophilized powder. Add 2.5 μL of magnesium acetate solution to the cap of each reaction tube, close the tube cap, and collect and mix evenly. Place the above reaction tube at 42°C for 30 minutes to obtain the RAA amplification product.

[0106] II. Method for detecting pigeon paramyxovirus nucleic acid based on CRISPR-Cas13a system

[0107] (I) Preparation of CRISPR-Cas13a fluorescent detection system

[0108] Extract the nucleic acid of the sample to be tested, and use the primers JV-RAA-F5 and JV-RAA-R6 in 1 of (III) of the above (I) to perform RAA amplification on the nucleic acid of the sample to be tested to obtain the RAA amplification product;

[0109] Take 5 μL of the above-obtained RAA amplification product as a template, and prepare the CRISPR-Cas13a detection system according to the following Table 6.

[0110] Replace the RAA product in Table 6 with ddH2O, and keep other reagent components unchanged, which is the negative control.

[0111] Table 6, CRISPR-Cas13a fluorescent detection system

[0112]

[0113]

[0114] Place the PCR tube containing the reaction system shown in Table 6 in the above (I) into a fluorescent quantitative PCR instrument, set the channel excitation wavelength to 490 nm, the emission wavelength to 520 nm, the temperature to 37°C, read the value once every 2 min, read for 40 times, a total of 80 min, and detect the change in fluorescence intensity in the detection system.

[0115] Result determination: In the same detection time, if the fluorescence intensity value of the experimental group is more than 3 times higher than that of the negative control (ddH2O), it is determined as a positive result (including the case where the fluorescence intensity value of the experimental group is 3 times higher than that of the negative control), or at any time, if the fluorescence intensity is greater than or equal to 0.1 a.u., it is determined as a positive result, i.e., the sample to be tested contains or is suspected to contain pigeon paramyxovirus or pigeon paramyxovirus nucleic acid; otherwise, it is a negative result, i.e., the sample to be tested does not contain or is suspected not to contain pigeon paramyxovirus or pigeon paramyxovirus nucleic acid.

[0116] (II) Preparation of CRISPR-Cas13a test paper detection system

[0117] Extract the nucleic acid from the sample to be tested, and use the primers JV-RAA-F5 and JV-RAA-R6 from section (iii) of the above-mentioned section to perform RAA amplification on the nucleic acid of the sample to be tested, and obtain the RAA amplification product.

[0118] Take 5 μL of the RAA amplification product obtained above as a template and prepare the CRISPR-Cas13a detection system according to Table 7 below.

[0119] The negative control is to replace the RAA product in Table 7 with ddH2O while keeping other reagent components unchanged.

[0120] Table 7. CRISPR-Cas13a test strip detection system

[0121]

[0122]

[0123] Cap the reaction tube containing the reaction system shown in Table 7, invert it 5-6 times to mix, and centrifuge at low speed (provide centrifugation rate) for 10 seconds. Place the reaction tube at 37°C for 30 minutes. After the reaction is complete, add the entire reaction system (50 μL) to the sample well of the CRISPR test paper.

[0124] Result Interpretation: After the reaction system is applied to the test strip, the results should be interpreted 2-5 minutes later. If no "T" line appears on the test strip but a "C" line does, the sample contains or is a candidate for containing the quinine virus. If both a "T" line and a "C" line appear on the test strip, the sample does not contain or is a candidate for containing the quinine virus. If no "C" line appears on the test strip, the test strip is invalid and needs to be replaced and the experiment repeated.

[0125] III. Optimization of Conditions for Detecting Jiuning Virus Nucleic Acid Based on CRISPR-Cas13a System

[0126] (I) Screening of optimal primers

[0127] The concentration prepared in step (ii) of step one is 1×10 9 Using copies / μL of plasmid standard as a template, RAA amplification was performed using the method in step 1(iii) 2 above. The primers were the primer combinations shown in Table 4 (the combination forms are as follows). Figure 1 As shown in the figure, the RAA amplification product was obtained.

[0128] Amplification products using water as a template were set as negative controls.

[0129] Take 20 μL of the amplification product, add 20 μL of chloroform: Tris balanced phenol = 1:1 to the reaction product, mix well, shake and centrifuge for 10 min, discard the supernatant mixture, shake well, centrifuge at 10,000 rpm for 10 min, take 10 μL of the supernatant, add 3 μL of 6*Loading Buffer, mix well and perform agarose gel electrophoresis.

[0130] Configure 1.5% agarose gel, voltage U = 150 V, current I = 150 mA, time T = 30 min, electrophoresis detection, and observe the electrophoresis band.

[0131] As shown in Figure 1 , J3: F5&R6 primer amplification product J3+ has obvious bands around 150 bp, which is significantly different from the negative control J3-.

[0132] Therefore, F5&R6 is used as the best amplification primer for RAA amplification against JV virus.

[0133] Then, CRISPR fluorescence screening is performed: the method of (i) in Example 1 is used, wherein the RAA amplification primers are F5&R4, F5&R5, F5&R6, F6&R6, and F7&R8, and the crRNA is JV-crRNA-1 and JV-crRNA-2.

[0134] As shown in Figure 2 and Figure 3 , J-F5R4-5 in Figure 2 represents that the RAA amplification primer is F5&R4 and the crRNA is JV-crRNA-1, and the template is 10 5 copies / μL; in turn, J-F5R4-NC represents that the RAA amplification primer is F5&R4 and the crRNA is JV-crRNA-1, and the template is water; Figure 3 J-F5R4-5 in 5 represents that the RAA amplification primer is F5&R4 and the crRNA is JV-crRNA-2, and the template is 10 5 copies / μL; in turn; as shown in Figure 2 and Figure 3 , the fluorescence value corresponding to F5&R6 primer is higher, and the sensitivity is higher, so JV-RAA-F5 and JV-RAA-R6 are used as the best amplification primer for RAA amplification against JV virus.

[0135] (II), optimal crRNA screening

[0136] To screen for a crRNA with higher detection sensitivity and shorter detection time, two crRNAs, JV-crRNA-1 and JV-crRNA-2, were designed in the JV target sequence (sequence 3). The target sequence of JV-crRNA-1 is as follows: taacacatcctccgaaaatataggcagg, located at positions 5324-5351 of the JV genome (GeneID: 2943089); and the target sequence of JV-crRNA-2 is as follows: aacacatcctccgaaaatataggcagga (sequence 1), located at positions 5325-5352 of the JV genome (GeneID: 2943089).

[0137] 1. Synthesis of primer sequences

[0138] Each sequence in Table 8 was synthesized.

[0139] Table 8, primer sequences

[0140]

[0141] 2. The plasmid standard obtained in (ii) of step 1 of Example 1 was gradient-diluted to obtain plasmid solutions containing different concentrations of the JV gene fragment: 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL.

[0142] 3. RAA amplification was performed according to the method in (iii) of step 1 of Example 1, and the primers used were F5 & R6 (optimal primers), to obtain the RAA amplification product.

[0143] 4. After RAA amplification, 5 μL of the amplification product was used to detect the nucleic acid of the pigeon paramyxovirus according to the method in step 2 of Example 1 using different crRNAs, and the amplification product with water as the template was set as the negative control.

[0144] Figure 2 The bar chart shows the fluorescence values of the first candidate crRNA for detecting the pigeon paramyxovirus, Figure 3The fluorescence value column chart of the candidate 2nd crRNA for detecting the pigeon paramyxovirus is shown. The detection results show that the effect of F5&R6 primers for amplifying the pigeon paramyxovirus nucleic acid template and then detecting the same crRNA is obviously better than that of other primers. When the same concentration of pigeon paramyxovirus nucleic acid is used as a template, the fluorescence value detected by JV-crRNA-2 is higher than that of other 1 crRNA. Therefore, JV-crRNA-2 is selected to detect different concentrations of JV templates, and the detection sensitivity of JV-crRNA-2 can reach 10 -1 copies / μL Figure 4 , and the detection speed is fast, and 10 -1 copies / μL of JV Figure 5 can be effectively detected after 4 min of reaction. Since the sensitivity and detection efficiency of JV-crRNA-2 are high, therefore, JV-crRNA-2 is selected as the preferred crRNA for JV detection.

[0145] Example 2, sensitivity detection of detecting pigeon paramyxovirus nucleic acid based on CRISPR-Cas13a system

[0146] The plasmid standard with gradient dilution is used as a template, and the plasmid containing different concentrations of JV gene fragments is detected according to the method in Example 1, so as to detect the sensitivity of the method. The specific steps are as follows:

[0147] 1. The plasmid standard obtained in step (ii) of Example 1 is gradient diluted to obtain plasmid solutions containing different concentrations of JV gene fragments: 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL, 10 -1 copies / μL, 10 -2 copies / μL.

[0148] 2. The RAA amplification is carried out according to the method in step (iii) of Example 1, and the primers are F5 and R6 (optimal primers), and the RAA amplification product is obtained.

[0149] 3. CRISPR fluorescence detection:

[0150] After RT-RAA amplification, 5 μL of the amplification product is detected based on the CRISPR-Cas13a system for detecting the pigeon paramyxovirus nucleic acid according to the method in Example 1, and the amplification product of water as a template is set as a negative control. The crRNA is JV-crRNA-2.

[0151] CRISPR-Cas13a fluorescence detection results are as follows: Figure 4 and Figure 5 As shown, 10 -2 -10 5 The fluorescence signal of the plasmid amplification product at copies / μL began to increase after the reaction started, while the fluorescence intensity in the negative control group (ddH2O) did not increase over time. The fluorescence value of the experimental group containing kuning virus nucleic acid was significantly higher than that of the negative control. Figure 4 From the 10th minute after the start of the test, 10 -2 copies / μL to 10 5 The fluorescence signals corresponding to copies / μL template were 0.02±0.031au, 1.15±0.327au, 0.75±0.371au, 0.56±0.253au, 0.75±0.079au, 0.51±0.097au, 0.43±0.033au, and 0.51±0.133au, respectively, while the fluorescence signal of the negative control was 0.003±0.005au. Figure 5 Compared with the negative control, the fluorescence intensity showed statistically significant differences (T test, P<0.001), indicating that the CRISPR-Cas13a detection system of the present invention can detect quinine nucleic acid in as little as 10 minutes, with a sensitivity of 0.1 copy / μL.

[0152] 4. CRISPR test strip detection

[0153] After completing step 2 above, take 5 μL of RAA amplification product and detect JV nucleic acid using the method in step 2(ii) of Example 1 based on the RAA-CRISPR / Cas13a system. At the same time, set up the amplification product with ddH2O as template as a negative control. The crRNA is JV-crRNA-2, and the primers are JV-RAA-F5 and JV-RAA-R6.

[0154] CRISPR test strip results are as follows: Figure 6 As shown, in 10 -0 -10 5 The "T" line disappears and the "C" line appears in the copies / μL group, 10 -1 Both the T and C lines were visible in the negative control group and the JV-crRNA2 assay, indicating that the JV site can be detected using JV-crRNA2 with a sensitivity of 1 copy / μL. 5 -10 0 The copies / μL group was positive, 10 -1The copy / μL group and the negative control group were negative, indicating that the sensitivity of the method was 1 copy / μL. Figure 6

[0155] Example 3, Specific detection of Junin virus nucleic acid based on CRISPR-Cas13a system

[0156] The pathogenic nucleic acids of yellow fever virus (YFV), Ebola virus (EBOV), Rickettsia (Cb), Junin virus (Junin), Venezuelan equine encephalitis virus (VEEV) and dengue virus (DENV) were used as templates, and the method in Example 1 was used to detect different viral nucleic acids to verify the specificity of the method. The specific steps are as follows:

[0157] 1. Yellow fever virus (YFV), Ebola virus (EBOV), Rickettsia (Cb), Junin virus (Junin), Venezuelan equine encephalitis virus (VEEV) and dengue virus (DENV) nucleic acids were used as detection templates, and the method in Example 1 step one (three) was used for RAA amplification to obtain RAA amplification products. The primers were JV-RAA-F5 and JV-RAA-R6.

[0158] 2. After RAA amplification, 5 μL of the amplification product was used to detect the viral nucleic acid based on the CRISPR-Cas13a system according to the method in Example 1 step two, and the amplification product with water as the template was set as the negative control. The crRNA was JV-crRNA-2.

[0159] The CRISPR-Cas13a fluorescence detection results showed that the fluorescence signal of the experimental group containing JV began to rise after the reaction started, while the fluorescence intensity of the negative control group (ddH2O) and the experimental group containing other viral nucleic acids did not increase with time, and the fluorescence intensity of the experimental group containing JV gene was significantly higher than that of the negative control and other viral groups( Figure 7 ) 150 times higher than that of the negative control and other viral groups( Figure 8 ) 30 minutes after the start of the detection. It showed that the method for detecting Junin virus nucleic acid based on CRISPR-Cas13a system had high specificity, and there was no cross reaction in the detection process.

[0160] 3. After step 1, 5 μL of the RAA amplification product was used to detect the viral nucleic acid based on the CRISPR-Cas13a system according to the method in Example 1 step two (two), and the amplification product with water as the template was set as the negative control. The crRNA was JV-crRNA-2.

[0161] ​The results show that the "T" line disappears and the "C" line appears in the experimental group containing the JV gene, while the "T" line and the "C" line appear in the negative control group (ddH2O) and the experimental group of nucleic acids thereof. Figure 9

[0162] It is illustrated that the method for detecting pigeon paramyxovirus nucleic acid based on the CRISPR-Cas13a system has high specificity, and there is no cross reaction in the detection process.

[0163] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In short, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.​

Claims

1. A CRISPR-Cas13a system for detecting kuning virus, comprising Cas13a protein and crRNA, or a complex of the two; The crRNA includes an anchoring sequence for binding to the Cas13a protein and a guide sequence for targeting the cytokine virus target sequence. The target sequence of the quinine virus is sequence 1; the crRNA sequence is sequence 2.

2. The CRISPR-Cas13a system according to claim 1, characterized in that: The Cas13a protein is the LwCas13a protein.

3. A kit for detecting kuning virus, comprising the CRISPR-Cas13a system for detecting kuning virus as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that: The kit also includes primer pairs for specifically amplifying the target sequence of the kuning virus; the primer pairs consist of single-stranded DNA molecules shown in Sequence 4 and Sequence 5.

5. Any of the following substances: A1) The crRNA as described in claim 1 or 2; A2) The Cas13a protein and crRNA as described in claim 1 or 2, or a complex formed therefrom.

6. Any of the following applications: B1) The use of the system of claim 1 or 2, the kit of claim 3 or 4, or the substance of claim 5 in the preparation of products for detecting or assisting in the detection of kuning virus or its nucleic acid; B2) The use of the system of claim 1 or 2, the kit of claim 3 or 4, or the substance of claim 5 in the preparation of products for detecting or assisting in the detection of whether a sample to be tested contains quinine virus or its nucleic acid; B3) The use of the system of claim 1 or 2, the kit of claim 3 or 4, or the substance of claim 5 in the preparation of products for screening or assisting in screening drugs for the prevention and treatment of kuning virus; B4) Use of the substance of claim 5 in the preparation of the kit of claim 3 or 4.

7. A method for detecting or assisting in the detection of kuning virus for non-disease diagnostic and therapeutic purposes, comprising the following steps: C1) Using the nucleic acid of the sample to be tested as a template, RAA amplification was performed using a primer pair consisting of single-stranded DNA molecules shown in sequence 4 and single-stranded DNA molecules shown in sequence 5 to obtain RAA products; C2) Prepare a CRISPR-Cas13a detection system containing the following components: the RAA product, the Cas13a protein as described in claim 1 or 2, the crRNA as described in claim 1 or 2, reporter RNA, NTP, T7 RNA polymerase, and RNase inhibitor; water is used instead of the RAA product as a negative control. C3) The CRISPR-Cas13a detection system is reacted, and the reaction products are detected to determine whether the sample to be tested contains the cinnabar virus.

8. The method according to claim 7, characterized in that: In step C1), the reaction conditions for RAA amplification are: 42℃ for 20-40 minutes.

Images