A method and kit for constructing a standard curve for fluorescent oligonucleotides

Abstract

The application discloses a method and a kit for constructing a fluorescent oligonucleotide standard curve. In the application, the method comprises the following steps: step one, preparing a standard solution of the fluorescent oligonucleotide by using an aqueous solution of ammonia. The method for constructing the fluorescent oligonucleotide standard curve provided by the embodiment of the application has good linearity, and can be used for measuring the background fluorescence intensity of a TaqMan probe with extremely low response value.

Description

Technical Field

[0001] This invention relates to the field of analytical detection, and in particular to a method and kit for constructing a fluorescent oligonucleotide standard curve. Background Technology

[0002] Real-time quantitative PCR (polymerase chain reaction) is a method that involves adding a fluorescent reporter group to the PCR reaction system, using the accumulation of fluorescence signals to monitor the entire PCR process in real time, and finally quantifying unknown templates using a standard curve. This technology not only achieves quantification of DNA templates but also features high sensitivity, stronger specificity and reliability, the ability to perform multiplex reactions, high automation, no contamination, real-time performance, and high accuracy. It is currently widely used in molecular biology research and medical research.

[0003] Real-time quantitative PCR commonly uses TaqMan probes and SYBR Green I detection modes. TaqMan probes are more widely used due to their multiplex detection capabilities and high specificity. A TaqMan probe is labeled with a fluorescent reporter group at its 5'-end and a fluorescent quencher group at its 3'-end. When the probe is intact, the fluorescence emitted by the reporter group is absorbed by the quencher group, resulting in fluorescence resonance energy transfer (FRET), and the fluorescence emitted by the 5'-end fluorescent reporter group is undetectable. During PCR amplification, the 5'-3' exonuclease activity of Taq polymerase cleaves the fluorescent reporter group attached to the 5'-end of the probe, making it free in the reaction system and preventing FRET and fluorescence emission. The number of cleaved fluorescent molecules is proportional to the amount of PCR product; therefore, the initial template quantity can be calculated based on the fluorescence intensity of the PCR reaction solution.

[0004] TaqMan probes are synthesized using a solid-phase synthesis method, employing CPG (glass beads) with quenching groups as a carrier. The probes are synthesized using A, G, C, and T phosphorimide monomers and a fluorescent reporter phosphorimide monomer, following the probe sequence from the 3'-5' direction. After synthesis, the probes undergo cleavage, deprotection, purification, and quantitative concentration before being applied in real-time quantitative PCR. A decrease in the fluorescence performance of the 5' reporter dye used in the synthesis of TaqMan probes, or low purity or degradation of the TaqMan probes, will affect their luminescence performance, leading to a decrease in fluorescence intensity during the plateau phase of the real-time quantitative PCR curve and a later Ct (cycle threshold).

[0005] However, the inventors have discovered at least the following problems with the existing technology: Because the background fluorescence intensity response value of the TaqMan probe is extremely low, detecting the background fluorescence intensity of the TaqMan probe requires constructing a standard curve with good linearity using a control TaqMan probe. In the existing technology, using tris-HCl solution or water as the solvent medium results in TaqMan probe standard curves with very poor linearity, which is insufficient to meet the requirements of the standard curve method for testing the background fluorescence intensity of the TaqMan probe. Therefore, there is a need in the art to find a method for constructing a TaqMan probe with good linearity. Summary of the Invention

[0006] The purpose of this invention is to provide a method for constructing a fluorescent oligonucleotide standard curve.

[0007] Another objective of this invention is to provide a kit for constructing a standard curve of fluorescent oligonucleotides.

[0008] To address the aforementioned technical problems, the first aspect of the present invention provides a method for constructing a fluorescent oligonucleotide standard curve, the method comprising step one:

[0009] A standard solution of the fluorescent oligonucleotide was prepared using an aqueous solution of ammonia.

[0010] In some preferred embodiments, step two is included after step one:

[0011] The background fluorescence intensity of the standard solution of the fluorescent oligonucleotide obtained in step one was measured.

[0012] In some preferred embodiments, step two is followed by step three:

[0013] A standard curve was constructed based on the concentration of the standard solution of the fluorescent oligonucleotide and the background fluorescence intensity of the standard solution of the fluorescent oligonucleotide obtained in step two.

[0014] In some preferred embodiments, the aqueous solution of ammonia contains 0.008 to 0.012% ammonia by mass.

[0015] In some preferred embodiments, the concentration range of the fluorescent oligonucleotide standard solution is 1–10 pmol / μL.

[0016] In some preferred embodiments, at least three of the fluorescent oligonucleotide standard solutions are prepared.

[0017] In some preferred embodiments, the fluorescent reporter group in the fluorescent oligonucleotide is FITC, 5-FAM, 6-FAM, HEX, Rhodamine B, texas red, Cy3, or Cy5.

[0018] In some preferred embodiments, the fluorescent oligonucleotide is selected from FAM-BHQ1 modified TaqMan probes, HEX-BHQ1 modified TaqMan probes, or FAM modified 5' reporter groups.

[0019] In some preferred embodiments, the background fluorescence intensity of the standard solution of the fluorescent oligonucleotide is measured using an enzyme-linked immunosorbent assay (ELISA) reader or a fluorescence spectrophotometer.

[0020] In some preferred embodiments, at least five fluorescent oligonucleotide standard solutions are prepared, wherein the concentrations of the five fluorescent oligonucleotide standard solutions are 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL and 10 pmol / μL, respectively.

[0021] The fluorescent oligonucleotide standard curve constructed according to the embodiments of the present invention has a correlation coefficient ≥0.999.

[0022] A second aspect of the present invention provides a kit for constructing a fluorescent oligonucleotide standard curve, characterized in that the kit comprises:

[0023] Fluorescent oligonucleotide standards; and ammonia water with a mass percentage of 0.008–0.012%.

[0024] The embodiments of the present invention have at least the following advantages over the prior art:

[0025] (1) The method for constructing a fluorescent oligonucleotide standard curve provided by the embodiments of the present invention has good linearity and can be used to measure the background fluorescence intensity of TaqMan probes with extremely low response values.

[0026] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Detailed Implementation

[0027] The TaqMan probe exhibits extremely low background fluorescence intensity response, resulting in a very poor linearity in the obtained TaqMan probe background fluorescence intensity standard curve. Through detailed research, the inventors discovered that placing the 5' reporter group of the TaqMan probe or the synthetic TaqMan probe in an aqueous ammonia solution can stabilize these groups, resulting in background fluorescence standard curves with correlation coefficients all above 0.999.

[0028] Based on the above research findings, the inventors propose a method for constructing fluorescent oligonucleotide standard curves to obtain standard curves with good linearity. Furthermore, the inventors also provide a kit for constructing fluorescent oligonucleotide standard curves.

[0029] the term

[0030] As used herein, the term "fluorescent oligonucleotide" refers to a linear polynucleotide fragment consisting of 2–30 nucleotide residues linked by phosphodiester bonds and labeled with a fluorescent reporter group, which can be used as a primer and gene probe for DNA synthesis.

[0031] As used herein, the term "background fluorescence intensity" refers to the fluorescence response measured in a fluorescence measuring instrument when the sample has not undergone fluorescence quenching. For example, in this invention, the background fluorescence intensity of the TaqMan probe refers to the extremely weak fluorescence signal generated in a fluorescence measuring instrument when the TaqMan probe has not broken.

[0032] As used in this article, the term "FITC" refers to fluorescein isothiocyanate, a commonly used fluorescent label.

[0033] As used in this article, the term "5-FAM" refers to 5-carboxyfluorescein, a commonly used fluorescent label for labeling proteins, peptides, antibodies, and oligonucleotides.

[0034] As used in this article, the term "6-FAM" refers to 5-carboxyfluorescein, a commonly used fluorescent label for labeling proteins, peptides, antibodies, and oligonucleotides.

[0035] As used in this article, the term "HEX" refers to hexachloro-6-methylfluorescein, a commonly used fluorescent label.

[0036] As used in this article, the term "Rhodamine B" refers to Rhodamine B, a commonly used fluorescent staining agent.

[0037] As used in this article, the term "texas red" refers to bright red phospholipids, a commonly used fluorescent staining agent.

[0038] As used in this article, the terms "Cy3" and "Cy5" refer to anthocyanin dyes, which are a class of commonly used near-infrared fluorescent dyes. They can be linked to nucleic acids or proteins through their reactive groups and are widely used for labeling proteins, antibodies, nucleic acids and other biomolecules.

[0039] As used in this article, the term "FAM-BHQ1 modified TaqMan probe" means that the 5' end of the TaqMan probe is modified with FAM and the 3' end is modified with BHQ1.

[0040] As used in this article, the term "HEX-BHQ1 modified TaqMan probe" means that the 5' end of the TaqMan probe is modified with HEX and the 3' end is modified with BHQ1.

[0041] The first aspect of the present invention provides a method for constructing a fluorescent oligonucleotide standard curve, the method comprising step one:

[0042] A standard solution of the fluorescent oligonucleotide was prepared using an aqueous solution of ammonia.

[0043] In some preferred embodiments, step two is included after step one:

[0044] The background fluorescence intensity of the standard solution of the fluorescent oligonucleotide obtained in step one was measured.

[0045] In some preferred embodiments, step two is followed by step three:

[0046] A standard curve was constructed based on the concentration of the standard solution of the fluorescent oligonucleotide and the background fluorescence intensity of the standard solution of the fluorescent oligonucleotide obtained in step two.

[0047] In some preferred embodiments, the aqueous solution of ammonia contains 0.008 to 0.012% ammonia by mass.

[0048] In some preferred embodiments, the concentration range of the fluorescent oligonucleotide standard solution is 1–10 pmol / μL. The linear regression constant of the standard curve obtained from other concentration ranges may not meet the requirements.

[0049] In some preferred embodiments, at least three of the fluorescent oligonucleotide standard solutions are prepared.

[0050] In some preferred embodiments, the fluorescent reporter group in the fluorescent oligonucleotide is FITC, 5-FAM, 6-FAM, HEX, Rhodamine B, texas red, Cy3, or Cy5.

[0051] In some preferred embodiments, the fluorescent oligonucleotide is selected from at least one of FAM-BHQ1 modified TaqMan probe, HEX-BHQ1 modified TaqMan probe, and FAM modified 5' reporter group.

[0052] In some preferred embodiments, the background fluorescence intensity of the standard solution of the fluorescent oligonucleotide is measured using an enzyme-linked immunosorbent assay (ELISA) reader or a fluorescence spectrophotometer.

[0053] When performing measurements using a fluorescence spectrophotometer and an ELISA reader, the endpoint method is employed, and measurements are taken according to the optimal absorption and emission wavelengths of the fluorescent reporter groups. The optimal absorption wavelengths for the aforementioned fluorescent reporter groups are: FAM (474-494 nm, 525-545 nm); HEX (515-535 nm, 556-576 nm); CY3 (526-546 nm, 563-583 nm); Texas Red (576-586 nm, 615-635 nm); and CY5 (626-646 nm, 662-682 nm). The optimal absorption and emission wavelengths for other fluorescent reporter groups are not listed individually.

[0054] The fluorescent reporter group was synthesized on a DNA synthesizer from 3' to 5' according to the following sequence: ID1: 5' reporter group -TTTTTTTTTT. After ammonolysis purification, it was diluted with the appropriate solvent to the specified concentration. The fluorescence intensity of the fluorescent reporter group under the ID1 sequence at different concentrations was measured, and a curve of fluorescence intensity versus concentration of the fluorescent reporter group under the ID1 sequence was plotted.

[0055] In some preferred embodiments, at least five fluorescent oligonucleotide standard solutions are prepared, wherein the concentrations of the five fluorescent oligonucleotide standard solutions are 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL and 10 pmol / μL, respectively.

[0056] The fluorescent oligonucleotide standard curve constructed according to the embodiments of the present invention has a correlation coefficient ≥0.999.

[0057] A second aspect of the present invention provides a kit for constructing a fluorescent oligonucleotide standard curve, characterized in that the kit comprises: a fluorescent oligonucleotide standard; and ammonia water with a mass percentage of 0.008 to 0.012%.

[0058] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight. Unless otherwise specified, the experimental materials and reagents used in the following embodiments are commercially available.

[0059] Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. It should be noted that the terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the exemplary embodiments of this application.

[0060] Example 1: Construction of standard curves for FAM-BHQ1-modified Taqman probes

[0061] Preparation of control probe solutions of different concentrations:

[0062] Take 10 nmol of FAM-BHQ1 modified TaqMan control probe powder and place it in a centrifuge tube (the FAM-BHQ1 modified TaqMan probe sequence is as follows: ID2: TTGTTGCGTGCACACCCACCG(5'FAM,3'BHQ1)). Add 1000 μL of 0.01% ammonia solution to the above probe and shake at 1500 rpm for 3 min in a mixer. Centrifuge briefly for 15 s to obtain a control probe stock solution with a probe concentration of 10 pmol / μL.

[0063] Preparation of 2 pmol / μL control probe solution: Take 60 μL of the control probe stock solution into a new 1.5 ml centrifuge tube, add 240 μL of 0.01% ammonia water, shake at 1500 rpm for 3 min in a mixer, and centrifuge briefly for 15 s to obtain a probe concentration of 2 pmol / μL.

[0064] Preparation of 4 pmol / μL control probe solution: Take 120 μL of the control probe stock solution into a new 1.5 ml centrifuge tube, add 180 μL of 0.01% ammonia, shake at 1500 rpm for 3 min in a mixer, and centrifuge briefly for 15 s to obtain a probe concentration of 4 pmol / μL.

[0065] Preparation of 6 pmol / μL control probe solution: Take 180 μL of the control probe stock solution into a new 1.5 ml centrifuge tube, add 120 μL of 0.01% ammonia, shake at 1500 rpm for 3 min in a mixer, and centrifuge briefly for 15 s to obtain a control probe solution with a probe concentration of 6 pmol / μL.

[0066] Preparation of 8 pmol / μL control probe solution: Take 240 μL of the control probe stock solution into a new 1.5 ml centrifuge tube, add 60 μL of 0.01% ammonia, shake at 1500 rpm for 3 min in a mixer, and centrifuge briefly for 15 s to obtain a control probe solution with a probe concentration of 8 pmol / μL.

[0067] Preparation of 10 pmol / μL control probe solution: Take 240 μL of the control probe stock solution into a new 1.5 ml centrifuge tube to obtain a control probe solution with a probe concentration of 10 pmol / μL.

[0068] Standard curves were constructed using control probes at different concentrations:

[0069] Add 200 μL each of the control probe solutions with concentrations of 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL, and 10 pmol / μL to a fluorescent microplate, labeled A2, B2, C2, D2, E2, and F2. Detect the probes using a Thermo Scientific Varioskan LUX microplate reader with an endpoint method, setting the absorption and emission wavelengths to 494 nm and 525 nm, respectively.

[0070] The data obtained from the standard curve are shown in Table 1 below:

[0071] Table 1

[0072]

[0073] From Table 1 above, we can see that R 2 ≥0.999, good linearity, standard curve successfully constructed.

[0074] Example 2: Construction of standard curves for HEX-BHQ1 modified TaqMan probes

[0075] Preparation of control probe solutions of different concentrations:

[0076] Take 10 nmol of control HEX-BHQ1 dry powder and place it in a centrifuge tube (HEX-BHQ1 dry powder sequence is as follows: ID3: CAGCCACTCCCGTGAAACATCAGGG(5'HEX,3'BHQ1)). Add 1000 μL of 0.01% ammonia solution to the above probe and shake at 1500 rpm for 3 min in a mixer. Centrifuge briefly for 15 s to obtain the control HEX-BHQ1 probe stock solution with a probe concentration of 10 pmol / μL.

[0077] Control HEX-BHQ1 dry powder solutions of 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL, and 10 pmol / μL were prepared in the same manner as in Example 1.

[0078] Standard curves were constructed using control probes at different concentrations:

[0079] Take 200 μL of each of the above-mentioned HEX-BHQ1 dry powder solutions with concentrations of 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL, and 10 pmol / μL and add them to the fluorescent microplate at positions A2, B2, C2, D2, E2, and F2. Use a Thermo Scientific Varioskan LUX microplate reader to perform endpoint detection, with the absorption and emission wavelengths set to 494 nm and 525 nm, respectively.

[0080] The data obtained from the standard curve are shown in Table 2 below:

[0081] Table 2

[0082]

[0083] From Table 2 above, we can see that R 2 ≥0.999, good linearity, standard curve successfully constructed.

[0084] Example 3: Construction of the 5' reporter group (FAM) standard curve

[0085] Preparation of control 5' reporter group (FAM) solutions of different concentrations:

[0086] Take 10 nmol of control 5' reporter group (FAM) dry powder and place it in a centrifuge tube (the 5' reporter group (FAM) sequence is as follows: FAM ID1(5'FAM-TTTTTTTTTT)). Add 1000 μL of 0.01% ammonia water to the above probe and shake at 1500 rpm for 3 min in a mixer. Centrifuge briefly for 15 s to obtain a control 5' reporter group (FAM) stock solution with a probe concentration of 10 pmol / μL.

[0087] 5' reporter group (FAM) solutions of 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL, and 10 pmol / μL were prepared in the same manner as in Example 1.

[0088] Standard curves were constructed using control 5' reporter group (FAM) solutions of different concentrations.

[0089] Add 200 μL each of the above-mentioned control 5' reporter group (FAM) solutions at concentrations of 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL, and 10 pmol / μL to a fluorescent microplate, at positions A2, B2, C2, D2, E2, and F2; use a Thermo Scientific Varioskan LUX microplate reader with endpoint method for detection, setting the absorption wavelength and emission wavelength to 494 nm and 525 nm, respectively.

[0090] The data obtained from the standard curve are shown in Table 3 below:

[0091] Table 3

[0092]

[0093] From Table 3 above, we can see that R 2 ≥0.999, good linearity, standard curve successfully constructed.

[0094] Comparative Example 1: Construction of a standard curve for a Taqman probe modified with FAM-BHQ1

[0095] Take 10 nmol of FAM-BHQ1 modified TaqMan control probe powder and place it in a centrifuge tube (the FAM-BHQ1 modified TaqMan probe sequence is as follows: ID2: TTGTTGCGTGCACACCCACCG(5'FAM,3'BHQ1)). Add 1000 μL of 0.01% tris-hydrochloric acid to the above probe and shake at 1500 rpm for 3 min in a mixer. Centrifuge briefly for 15 s to obtain a control probe stock solution with a probe concentration of 10 pmol / μL. Except for replacing the diluent with 0.01% tris-hydrochloric acid, solutions with molar concentrations of 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL, and 10 pmol / μL were prepared in the same manner as in Example 1. The response values ​​at each concentration were measured using a Thermo Scientific Varioskan LUX microplate reader, following the same method used in Example 1 for measuring different concentrations of the control probe solution. Concentration-response curves were plotted, and R² was calculated. The response values ​​at each concentration and R² are then compared. 2 The results are shown in Table 4 below.

[0096] Table 4

[0097]

[0098] The data in the table above show that using 10 mM tris-hydrochloric acid at pH 8.0 as the solvent, the obtained standard curve R... 2 The values ​​are too poor to be used for quantitative analysis.

[0099] Comparative Example 2: Construction of the standard curve for a Taqman probe modified with FAM-BHQ1

[0100] In Comparative Example 2, the method for constructing the standard curve of the FAM-BHQ1-modified TaqMan probe was largely the same as in Comparative Example 1, except that 10 mM pH 8.0 TE buffer (prepared from Tris and EDTA) was used as the solvent. The response values ​​and R values ​​for each concentration are shown below.2 The results are shown in Table 5 below.

[0101] Table 5

[0102]

[0103] The R value of the obtained standard curve 2 The value is 0.8739.

[0104] Comparative Example 3: Construction of the standard curve of the Taqman probe modified with FAM-BHQ1

[0105] In Comparative Example 3, the method for constructing the standard curve of the FAM-BHQ1-modified TaqMan probe is largely the same as in Comparative Example 1, except that deionized water is used as the solvent. The response values ​​at each concentration and R0 are shown. 2 The results are shown in Table 6 below.

[0106] Table 6

[0107]

[0108] The R value of the obtained standard curve 2 The value is 0.8847.

[0109] Those skilled in the art will understand that the above embodiments are specific examples of implementing the present invention, and in practical applications, various changes in form and detail may be made without departing from the spirit and scope of the present invention.

Claims

1. A method of constructing a standard curve of a fluorescent oligonucleotide probe in real-time fluorescent quantitative PCR, characterized by, The method includes Step 1: A standard solution of the fluorescent oligonucleotide probe was prepared using an aqueous solution of ammonia. Step Two: Measure the background fluorescence intensity of the standard solution of the fluorescent oligonucleotide probe obtained in step one; Including step three: A standard curve was constructed based on the concentration of the standard solution of the fluorescent oligonucleotide probe and the background fluorescence intensity of the standard solution of the fluorescent oligonucleotide probe obtained in step two; wherein, The aqueous solution of ammonia contains 0.008 to 0.012% ammonia by mass.

2. The method of claim 1, wherein, The concentration range of the fluorescent oligonucleotide probe standard solution is 1~10 pmol / μL.

3. The method of claim 1, wherein, Prepare at least three of the fluorescent oligonucleotide probe standard solutions.

4. The method of claim 1, wherein, The fluorescent reporter group in the fluorescent oligonucleotide probe is FITC, 5-FAM, 6-FAM, HEX, Rhodamine B, texas red, Cy3, or Cy5.

5. The method of claim 1, wherein, The background fluorescence intensity of the standard solution of the fluorescent oligonucleotide probe was measured using an enzyme-linked immunosorbent assay (ELISA) reader or a fluorescence spectrophotometer.

6. The method of claim 1, wherein, At least five fluorescent oligonucleotide probe standard solutions are prepared, with concentrations of 2 pmol / μL, 4 pmol / μL, 6 pmol / μL, 8 pmol / μL, and 10 pmol / μL, respectively.

Images