A method and kit for detecting and screening L452R and T478K mutations in the Delta strain of SARS-CoV-2.
By combining the CRISPR/Cas system with RT-RAA amplification technology, specific CRISPR detection crRNA and fluorescent probes were designed, solving the problem of rapid and accurate detection of L452R and T478K mutations in the Delta strain of SARS-CoV-2, and realizing low-cost real-time detection in multiple scenarios.
Patent Information
- Application Number
- CN202211081694.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-06
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2042-09-06
AI Technical Summary
Existing methods for detecting mutations in the novel coronavirus are time-consuming, costly, and unsuitable for rapid screening, especially for detecting the L452R and T478K mutations in the Delta strain of the novel coronavirus.
Using a CRISPR/Cas system combined with RT-RAA amplification technology, specific CRISPR detection crRNA and fluorescent probes were designed. The L452R and T478K mutations of the SARS-CoV-2 Delta strain were detected under isothermal conditions using a CRISPR reaction mixture. Rapid detection was achieved by utilizing the base recognition specificity of the Cas protein.
It enables rapid, accurate, and low-cost detection of L452R and T478K mutations in the Delta strain of the novel coronavirus, with low equipment dependence and is suitable for real-time detection in multiple scenarios.
Smart Images

Figure CN115927749B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology and relates to a method and kit for detecting and screening the L452R mutation and T478K mutation of the Delta strain of SARS-CoV-2. Background Technology
[0002] COVID-19, or novel coronavirus for short, is a newly discovered single-stranded RNA virus, 29,903 nucleotides in length. It is transmitted through respiratory droplets via the respiratory tract and conjunctiva, and is highly contagious and has a wide spread. It is the seventh known coronavirus to cause disease in humans. Compared to the acute symptoms caused by other coronaviruses, the symptoms of COVID-19 infection range from mild, cough, and fever to severe cases. The symptoms are similar to common respiratory illnesses, making it highly insidious and extremely contagious.
[0003] As the novel coronavirus spreads, thousands of mutations have been detected globally. Most mutations do not alter the virus's characteristics, but some specific mutations on the SARS-CoV-2 spike protein may make the virus more dangerous. The SARS-CoV-2 spike protein is a component of the virus's outermost structure. The virus invades cells by recognizing the hACE2 receptor on the host cell surface through its surface proteins. The human body also achieves viral immunity by recognizing viral surface antigens and producing corresponding antibodies. Most current COVID-19 vaccines are designed to target the SARS-CoV-2 spike protein. Therefore, mutations in the SARS-CoV-2 spike protein may lead to changes in the corresponding amino acids, making the virus's invasion method more infectious. These amino acid changes may also lead to alterations in viral antigenic epitopes, thus rendering vaccine-induced protective antibodies ineffective.
[0004] Delta is a variant of the novel coronavirus, first discovered in India in October 2020. This variant was named B.1.617.2 by the WHO and officially named Delta on May 31st using the Greek letter δ. The Delta strain has the following notable characteristics: 1. High transmissibility, exceeding 40% compared to the Alpha strain found in the UK; 2. Shortened incubation period or passage interval, accelerating viral transmission; 3. High viral load: PCR testing of infected samples shows a significant increase in viral load. Patients exhibit very low Ct values; a lower Ct value indicates a higher viral load and a longer time required for nucleic acid testing to become negative. Delta variants include RBD mutations such as L452R and T478K. Delta variants are resistant to the neutralization of some anti-NTD and anti-RBD monoclonal antibodies. For example, the antibodies etesivimab, casirivimab, and imdevimab are inactive against Delta variants, and these antibodies show impaired binding to the spike protein. For mAb 7B8, the T478K variant exhibits immune escape; for mAb 9G11, LL452R and E484 show low affinity; the mutations L452R, T478K, and E484Q are located away from the binding site of mAb CB6, leading to immune escape. The neutralizing effect of convalescent plasma and vaccine serum on the Delta variant was reduced, with convalescent plasma showing a 2.7-fold reduction, Pfizer-BioNTech vaccine a 2.5-fold reduction, and Oxford-AstraZeneca vaccine a 4.3-fold reduction. This indicates that this variant can cause immune escape and render vaccine-immune serum ineffective, potentially leading to breakthrough infection in vaccinated populations. Therefore, rapid identification of Delta strains provides a reference for antibody treatment selection, offers technical tools for precise epidemic control, and is of great significance in avoiding large-scale breakthrough infections.
[0005] Single nucleotide polymorphism (SNP) refers to polymorphism in nucleic acid sequences caused by changes in a single nucleotide base. SNP detection is a technique used to detect DNA sequence polymorphisms caused by single nucleotide variations at the genomic level. SNP detection methods are broadly classified into three categories: ① gel-based detection of known polymorphisms, including polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP) labeling, oligonucleotide ligation analysis, and minisequencing; ② non-gel high-throughput detection techniques, including fluorescence energy resonance transfer (FERT), mass spectrometry, and DNA microarrays; ③ conformation-based detection of unknown mutations, including single-strand conformation polymorphism (SSP), chemical or enzymatic mismatch modification analysis, denaturing gradient gel electrophoresis, and denaturing high-performance liquid chromatography (HPLC). Currently, monitoring of SARS-CoV-2 mutations mainly relies on high-throughput sequencing to identify SNPs. While this method has high accuracy, the detection cycle is long (up to 7 days) and expensive, making it unsuitable for rapid screening of SARS-CoV-2 mutations. Therefore, developing a fast, accurate, and low-cost rapid SNP detection method for screening SARS-CoV-2 mutations is of great significance.
[0006] CRISPR is an abbreviation for "Clustered regularly interspaced short palindromic repeats." Cas is an abbreviation for "CRISPR-associated," referring to CRISPR-related sequences. The CRISPR / Cas system is an adaptive mechanism evolved in bacteria and archaea to defend against bacteriophage invasion. It was later discovered and developed into a technology where guide RNA directs Cas nucleases to perform specific nucleic acid editing on target genes. The CRISPR / Cas system works by crRNA (CRISPR-derived RNA) binding to tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA / crRNA complex. This complex guides nucleases such as Cas9 proteins to the target site paired with the crRNA sequence to cleave double-stranded DNA, thereby editing the genomic DNA sequence. By artificially designing these two RNAs, gRNA (guide RNA) can be created, sufficient to guide Cas9 to perform site-specific DNA cleavage. Currently, CRISPR-based rapid nucleic acid detection technologies are mainly divided into two categories: DETECTR, a nucleic acid isothermal detection technology based on Cas12a developed by Jennifer Doudna, the 2020 Nobel Prize laureate in Chemistry, and SHERLOCK, a nucleic acid isothermal detection technology based on Cas13a developed by Feng Zhang, the patent holder of CRISPR. Both technologies work by amplifying and enriching the target fragment using isothermal amplification methods such as RPA. The amplified fragment is then targeted and recognized by the Cas protein via a crRNA, activating the Cas protein to act as a DNA cleaver (Cas12a) or RNA cleaver (Cas13a), cutting all nearby single-stranded DNA (Cas12a) or single-stranded RNA (Cas13a). This property, when applied to single-stranded nucleic acid fluorescent probes, can be used to report detection results.
[0007] CRISPR / Cas cleavage detection requires CRISPR-targeting RNA (crRNA) to bind to and recognize the target sequence and activate the Cas protein before it can be performed. Single nucleotide mutation (SNP) detection utilizes the base recognition specificity of crRNA. By placing the mutated base at different positions on the crRNA or artificially introducing base mismatches, the crRNA can only recognize the mutated sequence and not the original sequence without SNP, thereby achieving mutation typing detection.
[0008] like Figure 1The diagram illustrates the SNP differentiation mechanisms of LwaCas13a and LbaCas12a. For Cas12a, the PAM (Protospacer Adjacent Motif) is a short, fixed sequence (TTTN) near the crRNA target-binding region (spacer). The PAM and the seed region (1-6 bases) adjacent to it are crucial for LbaCas12a recognition and activation. Base mismatches in the PAM and seed region can reduce the cleavage activity of LbaCas12a by approximately 1000-fold. Placing mutated bases in the PAM or seed region can significantly influence LbaCas12a activation, thus enabling SNP identification. For Cas13a, unlike LbaCas12a's high sensitivity to single bases, LwaCas13a lacks a PAM-like region and can be activated and cleavage detected with a single base mismatch. However, LwaCas13a cannot be activated with two base mismatches. Therefore, by artificially introducing an additional base mismatch into the crRNA of LwaCas13a, the critical point for SNP detection can be reached: when detecting an SNP sequence with only one artificial mismatch, the crRNA activates the Cas protein for cleavage and detection; when detecting the original sequence without SNPs, because there are two base mismatches, the crRNA cannot activate the Cas protein to cause the corresponding spatial structural changes, resulting in a negative test. Existing literature reports on using LwaCas13a for SNP typing of ZIKV virus tends to place the mutant base at the third base of the spacer and the artificially synthesized base mismatch at the fifth base of the crRNA corresponding to the spacer for SNP differentiation. However, because the base composition sequences of different detection sites are different, their influence on the spatial changes of the LwaCas13a protein after binding with crRNA also varies. Therefore, other people's SNP identification designs can only be used as references and cannot be directly applied. Therefore, when detecting Delta strains of LwaCas13a, it is necessary to try placing mutated bases at different positions on the spacer and try placing artificial mismatches at different positions on the crRNA, so as to design multiple sets of crRNAs for screening, and finally screen out a crRNA sequence that can detect Delta strains most specifically and sensitively. Summary of the Invention
[0009] The purpose of this invention is to provide a method and kit for detecting and screening the L452R mutation and T478K mutation of the Delta strain of SARS-CoV-2.
[0010] To achieve the above and other related objectives, the technical solution provided by this invention is: a kit for detecting and screening the L452R mutation and T478K mutation of the Delta strain of SARS-CoV-2, the kit comprising:
[0011] Two sets of RT-RAA amplification primers:
[0012] Cas13-L452R-for:
[0013] 5'-GAAATTAATACGACTCACTATAGGGtatagcttggaattctaacaatcttgattc-3';
[0014] Cas13-L452R-rev: 5'-accggcctgatagatttcagttgaaatatc-3';
[0015] Cas12-T478K-for:5'-ttgtttaggaagtctaatctcaaacctttt-3';
[0016] Cas12-T478K-rev:5'-gaaagtaacaattaaaaccttcaacaccat-3'.
[0017] Two types of crRNA specifically detected by CRISPR:
[0018] L452R-Cas13-crRNA:
[0019] 5'-ggauuuagacuaccccaaaaacgaaggggacuaaaacuauuccgguaauuauaauuaccaccaac-3';
[0020] T478K-Cas12-crRNA:
[0021] 5'-guaauuucuacuaaguguagauguaccggccugauagauuuc-3';
[0022] Two fluorescent probes:
[0023] RNA fluorescent probe: 5'-FAM-mArArUrGrGrCmAmArArUrGrGrCmA-BHQ1-3';
[0024] Where m represents the 2-position oxygen methyl modification, and r represents ribonucleotide;
[0025] DNA fluorescent probe: 5'-VIC-TTATTATT-BHQ1-3'.
[0026] The preferred technical solution further includes: HEPES buffer, MgCl2 solution, 10×NEB buffer 2.1 buffer, rNTP mix, LwaCas13a, Cas13-crRNA, LbaCas12a, Cas12-crRNA, RNase inhibitor, T7 RNA polymerase and RNase-free water mixture.
[0027] To achieve the above and other related objectives, the technical solution provided by this invention is: a method for detecting and screening for L452R and T478K mutations in the Delta strain of SARS-CoV-2 for non-diagnostic purposes, comprising the following steps:
[0028] Step 1: Immerse the sample to be tested in the virus preservation solution, and then use an RNA extraction kit to extract nucleic acid to obtain the nucleic acid to be tested;
[0029] Step 2: Add 37.5 μL of Buffer A solution, 2 μL of Cas13-L452R-for, 2 μL of Cas13-L452R-rev, 2 μL of Cas12-T478K-for, 2 μL of Cas12-T478K-rev, and 2 μL of the nucleic acid to be tested to a reaction tube containing lyophilized protease powder. Then add 2.5 μL of Buffer B solution, cap the reaction tube, and perform the amplification reaction to obtain the nucleic acid amplification product.
[0030] Two sets of RT-RAA amplification primers:
[0031] Cas13-L452R-for:
[0032] 5'-GAAATTAATACGACTCACTATAGGGtatagcttggaattctaacaatcttgattc-3';
[0033] Cas13-L452R-rev: 5'-accggcctgatagatttcagttgaaatatc-3';
[0034] Cas12-T478K-for:5'-ttgtttaggaagtctaatctcaaacctttt-3';
[0035] Cas12-T478K-rev:5'-gaaagtaacaattaaaaccttcaacaccat-3'.
[0036] Step 3: Prepare the CRISPR reaction mixture: 0.4 μL of 1M HEPES buffer, 0.18 μL of 1M MgCl2 solution, 1.6 μL of 10×NEB buffer 2.1, 0.8 μL of 25 μM rNTP mix, 2 μL of 63.2 ng / μL LwaCas13a, 1 μL of 5 ng / μL Cas13-crRNA, 1 μL of 1M LbaCas12a, 1 μL of 7.5 ng / μL Cas12-crRNA, 1 μL of 40 U / μL RNase inhibitor, and 0.1 μL of 50 U / μL T7. Mix RNA polymerase, 0.1 μL of 100 μM DNA fluorescent probe, 0.1 μL of 100 μM RNA fluorescent probe and 8.92 μL of RNase-free water;
[0037] Two types of crRNA specifically detected by CRISPR:
[0038] L452R-Cas13-crRNA:
[0039] 5'-ggauuuagacuaccccaaaaacgaaggggacuaaaacuauuccgguaauuauaauuaccaccaac-3';
[0040] T478K-Cas12-crRNA:
[0041] 5'-guaauuucuacuaaguguagauguaccggccugauagauuuc-3';
[0042] Two fluorescent probes:
[0043] RNA fluorescent probe: 5'-FAM-mArArUrGrGrCmAmArArUrGrGrCmA-BHQ1-3';
[0044] Where m represents the 2-position oxygen methyl modification, and r represents ribonucleotide;
[0045] DNA fluorescent probe: 5'-VIC-TTATTATT-BHQ1-3';
[0046] Step 4: Add 2 μL of the nucleic acid amplification product obtained in Step 2 to the CRISPR reaction mixture prepared in Step 3, and incubate at 37°C for 30 minutes; judge the result using the following method:
[0047] Fluorescence values in the FAM and VIC channels can be read using a fluorescence reading instrument at the start of the CRISPR reaction incubation. Incubation is performed at 37°C for 20 cycles, with a 1.5-minute interval between each cycle. A fluorescence signal is recorded at the end of each cycle. The detection results of L452R and T478K mutations are determined by the final fluorescence signal intensity.
[0048] A fluorescence value greater than 3000 indicates a positive result for the corresponding site. For example, a fluorescence value greater than 3000 in the FAM channel indicates a positive result for the SARS-CoV-2 S site corresponding to Cas13a; a fluorescence value greater than 3000 in the VIC channel indicates a positive result for the SARS-CoV-2 N site corresponding to Cas12a. A fluorescence value less than 2000 indicates a negative result for the corresponding site. If the fluorescence value is between 2000 and 3000, a retest is performed. If the fluorescence value is still between 2000 and 3000, the corresponding site is considered positive. The FAM channel is a fluorescence detection channel used by qPCR instruments to read fluorescence signals at wavelengths of 450nm-490nm; the VIC channel reads fluorescence signals at wavelengths of 500-535nm.
[0049] The preferred technical solution is as follows: The bμffer A solution is prepared by adding 50 mmol of Tris buffer, 100 nmol of potassium acetate, 20 g of polyethylene glycol powder and 2 mmol of dithiothreitol to 1 L of water; the bμffer B solution is a 280 mM magnesium acetate solution.
[0050] Due to the application of the above technical solution, the advantages of this invention compared with the prior art are:
[0051] This invention provides accurate, fast, and low-cost mutation site detection, and its detection method is not dependent on equipment, enabling real-time detection in multiple scenarios. Attached Figure Description
[0052] Figure 1 Diagrams for distinguishing SNPs using LwaCas13a and LbaCas12a.
[0053] Figure 2 Flowchart of CRISPR dual-channel simultaneous detection of two mutations in Delta strain
[0054] Figure 3 Design and screening diagram of crRNA for Cas13a at L452R site.
[0055] Figure 4 Design and screening diagram of crRNA for Cas12a at T478K site.
[0056] Figure 5 CRISPR dual-channel detection simultaneously detects two mutations in the Delta strain. Detailed Implementation
[0057] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification.
[0058] Please see Figure 1-5 It should be noted that the structures, proportions, sizes, etc., illustrated in the accompanying drawings are merely for illustrative purposes and to aid those skilled in the art in understanding and reading the invention. They are not intended to limit the scope of the invention and therefore have no substantial technical significance. Any modifications to the structure, changes in proportions, or adjustments to the size are not permitted. The following embodiments are provided to better understand the invention, but are not intended to limit it. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.
[0059] Example 1: A method and kit for detecting and screening the L452R mutation and T478K mutation of the Delta strain of SARS-CoV-2. A method for detecting and screening the Delta strain of SARS-CoV-2, characterized by including the following technical steps.
[0060] (1) Extraction of SARS-CoV-2 nucleic acid
[0061] Immerse the sample in 2-3 ml of virus preservation solution (isotonic saline solution can also be used), discard the tail end, and tighten the cap. Nucleic acid extraction and testing should be performed as soon as possible. Samples that can be tested within 24 hours can be stored at 4°C; samples that cannot be tested within 24 hours should be stored at -70°C or below. Nucleic acid extraction is performed using an RNA extraction kit. Taking the Mini Kit (QIAGEN, Cat No. 74106) as an example: Add 200 μL of virus preservation solution to 350 μL of Buffer RLT and mix by pipetting. Then add 550 μL of 70% anhydrous ethanol to precipitate viral RNA. Filter the resulting turbid suspension through a column and centrifuge at 12000 rpm for 2 min at 4℃. Elute impurities successively with Buffer RW1 and Buffer RPE. Finally, add 80 μL of RNase-free water to the adsorption column and dissolve and elute viral nucleic acid by centrifugation.
[0062] (2) RT-RAA primer design
[0063] RT-RAA (Reverse-Transcription-Recombinase-Aid Amplification) is a reverse transcription-recombinase-mediated amplification reaction. Reverse transcriptase reverse-transcribes RNA into cDNA, which is then amplified at 37°C under the guidance of multiple recombinases and specific RT-RAA primers. The RT-RAA reaction is the first step in CRISPR detection methods, amplifying the signal and thus improving detection sensitivity.
[0064] The design of RT-RAA primers should follow these principles: 1. Primer length should be 30-35 bases; 2. Primer GC content should be 30% < GC < 70%; 3. Amplified product length should be between 100bp and 200bp; 4. The amplified region should have a GC content of 40% < GC < 60%, avoiding single repetitive sequences and palindromic sequences. It is recommended to design three sets of upstream and downstream RT-RAA primers around the detection site, and use a complete CRISPR detection and cleavage reaction to screen for the RT-RAA primers with the best amplification effect.
[0065] This invention designed three sets of primers for the L452R mutation and T478K mutation of the Delta strain of the novel coronavirus. After final screening, the optimal amplification primers were obtained. Compared with the Cas12a system, the Cas13a system adds a T7 promoter recognition site (indicated by uppercase letters) at the 5' end of the upstream primer for RNA transcription during CRISPR detection.
[0066] Cas13-L452R-for:5'-GAAATTAATACGACTCACTATAGGGtatagcttggaattctaacaatcttgattc-3'Cas13-L452R-rev:5'-accggcctgatagatttcagttgaaatatc-3'
[0067] Cas12-T478K-for:5'-ttgtttaggaagtctaatctcaaacctttt-3'
[0068] Cas12-T478K-rev:5'-gaaagtaacaattaaaaccttcaacaccat-3'
[0069] (3) RT-RAA nucleic acid amplification
[0070] The extracted nucleic acid was amplified using the Hangzhou Zhongce RT-RAA Nucleic Acid Amplification Basic Kit and the corresponding RT-RAA primers, and incubated at 37℃ for 20 minutes. The specific operating steps are as follows:
[0071] For the 50 μL RT-RAA amplification system, take a reaction tube containing lyophilized protease powder and add 37.5 μL of Buffer A solution (50 mM Tris pH 7.9, 100 nM potassium acetate, 5% polyethylene glycol (PEG), 2 mM dithiothreitol (DTT)), 2 μL each of two 10 μM RT-RAA upstream primers, 2 μL each of two 10 μM RT-RAA downstream primers, and 2 μL of the nucleic acid to be tested. Add 2.5 μL of Buffer B solution (280 mM magnesium acetate solution) to the tube cap. After capping, briefly disconnect the reaction tube to start the amplification reaction. Incubate the reaction tube in a 39°C water bath for 20 minutes or hold it in your palm to incubate using body temperature for 20 minutes.
[0072] (4) Configure a CRISPR reaction system for rapid SNP detection and screening of the Delta strain of the novel coronavirus.
[0073] This invention designed 18 crRNAs for the differentiation and identification of the Delta strain of the novel coronavirus. Seven crRNAs were designed using LbaCas12a to detect the T478K mutation in the Delta strain, and eleven crRNAs were designed using LwaCas13a to detect the T478K mutation in the Delta strain. The LbaCas12a crRNA for detecting mutations was designed by placing the mutation in the PAM region, while the LwaCas13a crRNA for detecting mutations was designed by placing the mutated base at the 3rd, 4th, and 6th bases of the spacer, and then placing artificially mismatched bases at the 2nd, 3rd, 4th, 5th, and 6th bases of the corresponding spacer of the crRNA. The designed crRNA sites were screened using complete fluorescence cleavage detection by comparing the fluorescence signal intensity of these crRNA sites when detecting the mutant strain and the original strain.
[0074] This invention ultimately screened out two specific and sensitive crRNA sequences that can be used to differentiate between Delta strains L452R and T478K mutations, which are now disclosed as follows:
[0075] L452R-Cas13-crRNA: (Number O4)
[0076] 5'-ggauuuagacuaccccaaaaacgaaggggacuaaaacuauuccgguaauuauaauuaccaccaac-3';
[0077] T478K-Cas12-crRNA: (Q2)
[0078] 5'-guaauuucuacuaaguguagauguaccggccugauagauuuc-3';
[0079] The effectiveness of each crRNA in detecting L452R mutations was verified using the CRISPR / Cas13a system.
[0080] The effectiveness of each crRNA in detecting T478K mutations was verified using the CRISPR / Cas12a system.
[0081] Prepare the CRISPR reaction system according to the components, volumes, and concentrations described in the table below:
[0082] The CRISPR Cas13a reaction mixture was prepared as follows:
[0083]
[0084]
[0085] The CRISPR Cas12a reaction mixture was prepared as follows:
[0086] Components concentration volume source LbaCas12a 1μM 1μL NEB crRNA 15ng / μL 1μL In vitro transcription NEB buffer2.1 10× 2μL NEB RNase-free water none 13.9μL Thermo Fisher DNA fluorescent probe 100μM 0.1μL Nanjing Qingke total 18μL
[0087] RNA fluorescent probe: m represents the 2-position oxygen methylation, and r represents RNA.
[0088] 5'-FAM-mArArUrGrGrCmAmArUrGrGrCmA-BHQ1-3';
[0089] DNA fluorescent probe:
[0090] 5'-VIC-TTATTATT-BHQ1-3'.
[0091] The CRISPR reaction system's role in SNP detection primarily lies in its specificity; the specific base recognition characteristics of the CRISPR system endow it with the ability to detect SNPs. The crRNA provided in this invention can effectively recognize the Delta strain sequence and activate the corresponding Cas protein. Cutting the surrounding fluorescent reporter probe shows a positive result for the Delta strain. However, when this crRNA detects the original sequence without mutations, it fails to activate the corresponding Cas protein due to base mismatches, thus showing a negative result for the Delta strain.
[0092] (5) Fluorescence detection and result interpretation of Delta strain
[0093] Add 2 μL of nucleic acid amplification product to 18 μL of prepared CRISPR reaction mixture and incubate at 37°C for 30 minutes. Fluorescence can be detected simultaneously using a quantitative real-time PCR instrument, or directly incubated in a water bath and observed visually. Depending on the Cas protease used, there are two types of CRISPR reaction mixtures: a CRISPR Cas13a reaction mixture for mutation detection using the LwaCas13a effector protein and a CRISPR Cas12a reaction mixture for mutation detection using the LbaCas12a effector protein.
[0094] The fluorescence value under the FAM channel can be read using a qPCR instrument (Bio-Ray CFX96) at the beginning of the CRISPR reaction incubation. Incubate at 37°C for 20 cycles, with a 2-minute interval between each cycle. Record the fluorescence signal at the end of each cycle. The Delta strain detection result is determined by the final fluorescence signal intensity: a fluorescence value greater than 3000 indicates a positive Delta strain detection, and a fluorescence value less than 2000 indicates a negative Delta strain detection. If the fluorescence value is between 2000 and 3000, a retest is performed. If the fluorescence value remains between 2000 and 3000, the Delta strain detection is considered positive.
[0095] The FAM channel is a fluorescence detection channel used by qPCR instruments to read fluorescence signals at wavelengths of 450nm-490nm.
[0096] Establishment of Delta strain detection method
[0097] 1. Materials and Methods
[0098] 1.1 Materials
[0099] RT-RAA amplification primers, crRNA, and single-stranded probes were synthesized by Nanjing Qingke Biotechnology Co., Ltd. and Nanjing GenScript Biotech Co., Ltd. The RT-RAA basic nucleic acid amplification kit was purchased from Hangzhou Zhongce Biotechnology Co., Ltd. LbaCas12a protein was purchased from NEB. LwaCas13a protein was purchased from Nanjing GenScript Biotech Co., Ltd. The pseudoviruses containing the mutant sequences were obtained through laboratory packaging; alternatively, the packaging of pseudoviruses containing the corresponding mutant sequences could be outsourced to the company.
[0100] 1.2 Methods
[0101] 1.2.1: Design of RT-RAA primers
[0102] Based on the original SARS-CoV-2 strain sequences published in GenBank, RT-RAA amplification primers for the Delta strain locus were designed. Upstream primers were designed according to the RT-RAA design requirements, and the optimal amplification primers were finally selected.
[0103] Cas13-L452R-for:5'-GAAATTAATACGACTCACTATAGGGtatagcttggaattctaacaatcttgattc-3'
[0104] Cas13-L452R-rev:5'-accggcctgatagatttcagttgaaatatc-3'
[0105] Cas12-T478K-for:5'-ttgtttaggaagtctaatctcaaacctttt-3'
[0106] Cas12-T478K-rev:5'-gaaagtaacaattaaaaccttcaacaccat-3'
[0107] 1.2.2 Design of LwaCas13a crRNA for detecting Delta strain L452R mutation
[0108] This embodiment uses LwaCas13a to detect mutations in the Delta strain L452R as an example.
[0109] crRNA is a guide RNA consisting of a fixed backbone (scaffold) and a spacer region complementary to the target sequence. According to existing reports, Cas13a can tolerate and successfully activate a single base mismatch on the spacer. Therefore, when detecting Delta strains, if a mutation mismatch already exists, introducing an additional artificial mismatch on the spacer could potentially cause crRNA to recognize only the mutated sequence and not the original sequence, thus achieving mutation typing. After comprehensively analyzing the spatial structure of the interaction between Cas13a protein and crRNA, this invention artificially introduces base mismatches in different regions of the spacer for the L452R mutation, designing a total of 11 crRNAs for subsequent screening. Specific sequences are shown in the table below, and the sequence display is available in [link to table]. Figure 3
[0110]
[0111]
[0112] 1.2.3 Design of LbaCas12a crRNA for detecting the T478K mutation in Delta strain
[0113] The T478K mutation in the Delta strain introduces a PAM sequence in this region that can be specifically recognized by Cas12a. The PAM is a key sequence for Cas12a recognition and activation. Based on this characteristic, this invention designs seven Cas12a crRNAs for the recognition of the T478K mutation. The sequences are shown in the table below. (Sequence display is available in [link to documentation]). Figure 4 :
[0114]
[0115] 1.2.4 Screening for crRNAs that effectively distinguish L452R mutations using a complete RT-RAA CRISPR / Cas13a reaction.
[0116] Pseudoviruses containing Delta strain sequences were used to simulate viral mutation-positive samples, while pseudoviruses containing the original sequence served as negative controls. Eleven designed crRNAs were screened using 100 cp / μL of each of the two pseudovirus samples. Cas13a crRNAs that could detect the L452R mutation but not the original L452R sequence were selected based on fluorescence intensity detected by RT-RAA-CRISPR Cas13a cleavage.
[0117] 1.2.5 Use the complete RT-RAA CRISPR Cas12a reaction to screen for crRNAs that can effectively distinguish T478K mutations.
[0118] Pseudoviruses containing Delta strain sequences were used to simulate viral mutation-positive samples, while pseudoviruses containing the original sequence served as negative controls. Seven designed crRNAs were screened using 100 cp / μL of each of the two pseudovirus samples. Cas12a crRNAs that could detect the T478K mutation but not the original T478K sequence were selected based on fluorescence intensity detected by RT-RAA-CRISPR Cas12a cleavage.
[0119] 1.2.6 Simultaneous detection of L452R and T478K mutations in the Delta strain using two screened crRNAs. Pseudoviruses carrying the corresponding mutations were used to simulate the Delta strain, while pseudoviruses carrying the normal sequence were used to simulate the original SARS-CoV-2 strain.
[0120] Nucleic acid was extracted from pseudovirus samples at different concentration gradients: 0 cp / ul, 10 cp / ul, 100 cp / ul, 1000 cp / ul, 10000 cp / ul, and 100000 cp / ul. A 2-ul volume of the sample nucleic acid was amplified at isothermal temperature. 2-ul of the amplified RT-RAA product was added to a prepared 18-ul CRISPR dual-target detection system containing the specific detection crRNA for the Delta strain L452R and T478K sites mentioned in this invention. The mixture was incubated at 37°C for 30 minutes, and the fluorescence values of the FAM and VIC channels were read using an instrument.
[0121] 2. Results
[0122] 2.1 Screening results of crRNAs that effectively distinguish L452R by CRISPR Cas13a
[0123] Effective crRNAs were screened using an RT-RAA-CRISPR Cas13a cleavage detection reaction, employing both positive and negative samples containing mutations. Pseudovirus samples were used at a concentration of 100 cp / μL, with two replicates. Nucleic acid was extracted using a nucleic acid extraction kit. Amplification was performed at isothermal using a crowdsourced RT-RAA nucleic acid amplification kit. Each crRNA was prepared with a separate CRISPR reaction system; 18 μL of the CRISPR reaction system was added to 2 μL of the RT-RAA amplification product, and incubated at 37°C for 20 cycles. Fluorescence was collected using a Bio-Rad CFX96 throughout the incubation process. The mutation discrimination ability of each crRNA was determined by comparing the fluorescence intensity when detecting mutated samples and the original samples. Figure 3 The Cas13-L452R-6+4 (numbered O4) shown can effectively detect the L452R mutation, but not the original template.
[0124] 2.2 Screening results of CRISPR Cas12a effectively distinguishing T478K crRNA
[0125] Using positive samples containing mutations and negative samples without mutations, effective crRNAs were screened using an RT-RAA-CRISPR Cas12a cleavage detection reaction. The pseudovirus sample concentration was 100 cp / μL, with two replicates. Nucleic acid was extracted using a nucleic acid extraction kit. Amplification was performed at isothermal using a crowdsourced RT-RAA nucleic acid amplification kit. Each crRNA was prepared with a separate CRISPR reaction system; 18 μL of the CRISPR reaction system was added to 2 μL of the RT-RAA amplification product, and incubated at 37°C for 20 cycles. Fluorescence was collected using a Bio-Rad CFX96 throughout the incubation. The mutation discrimination ability of each crRNA was determined by comparing the fluorescence intensity when detecting mutant samples and the original samples. Figure 4As shown, Cas12-T478K-1st (Q2) can effectively detect the T478K mutation but not the original template.
[0126] 2.3 Simultaneous detection of L452R and T478K mutations in Delta strains using two screened crRNAs
[0127] Nucleic acid was extracted from pseudovirus samples at different concentration gradients: 0 cp / ul, 10 cp / ul, 100 cp / ul, 1000 cp / ul, 10000 cp / ul, and 100000 cp / ul. A 2-ul volume of the sample nucleic acid was amplified at an isothermal temperature. 2-ul of the amplified RT-RAA product was added to a prepared 18-ul CRISPR dual-target detection system containing the specific detection crRNA for the Delta strain L452R and T478K sites mentioned in this invention. The mixture was incubated at 37°C for 30 minutes, and the fluorescence values of the FAM and VIC channels were read using an instrument. Figure 5 As shown, this method can effectively detect different concentrations of Delta strain L452R and T478K mutations and can be used for the identification of Delta strains.
[0128] Figure 1 This demonstrates the principles of mutation detection using CRISPR / Cas13a and CRISPR / Cas12a, respectively. Specifically, the mutant strain is more compatible with the guide RNA (crRNA), thereby activating the Cas protein for cleavage and detection.
[0129] Figure 2 The flowchart for simultaneous detection of two mutations in Delta strain using CRISPR dual channels is as follows: First, the sample is processed to obtain nucleic acid. Then, two pairs of RT-RAA primers are used to simultaneously amplify the two nucleic acid sites to be detected at an isothermal temperature. Finally, the obtained RT-RAA product is added to the prepared dual-target CRISPR reaction system, incubated at 37°C for one hour, and the fluorescence signals of the FAM and VIC channels are detected to obtain the detection results.
[0130] Figure 3 The first part, the base sequence diagram, shows 11 designed LwaCas13a crRNAs used to distinguish the L452R mutation in the Delta strain. By artificially introducing base mismatches into the crRNAs, the Cas effector proteins can recognize and activate them when detecting the mutant strain, but cannot recognize them when detecting the original strain. The second part shows the screening effect of various crRNAs in detecting mutations. Each designed crRNA was used to detect Delta strain samples and original strain samples, and the mutation detection effect was compared. The screening results show that Cas13-L452R-6+4 (numbered O4) has the strongest mutation-distinguishing ability.
[0131] Figure 4 The first part, the base sequence diagram, shows the seven designed LbaCas12a crRNAs used to distinguish the T478K mutation in Delta strains. Placing the mutation site in the PAM recognition region of Cas12a allows the Cas effector protein to recognize and activate when detecting the mutant strain, but not when detecting the original strain. The second part shows the screening results of various crRNAs for mutation detection. Each designed crRNA was used to detect Delta strain samples and original strain samples, comparing their mutation detection performance. The screening results show that Cas12-T478K-1st (Q2) has the strongest mutation-distinguishing ability.
[0132] Figure 5 The method for detecting L452R and T478K mutations in Delta strains is shown in the figure. The FAM channel corresponds to the L452R mutation, and the VIC channel corresponds to the T478K mutation. This method can be used to simultaneously detect L452R and T478K mutations in Delta strains at different concentrations.
[0133] The above description is merely a preferred embodiment for explaining the present invention and is not intended to limit the present invention in any way. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included within the scope of protection intended by the present invention.
Claims
1. A kit for detecting and screening the L452R mutation and T478K mutation of the Delta strain of SARS-CoV-2, characterized in that: The kit includes: Two sets of RT-RAA amplification primers: Cas13-L452R-for:5'-GAAATTAATACGACTCACTATAGGGtatagcttggaattctaacaatcttgattc-3'; Cas13-L452R-rev: 5'-accggcctgatagatttcagttgaaatatc-3'; Cas12-T478K-for:5'-ttgtttaggaagtctaatctcaaacctttt-3'; Cas12-T478K-rev:5'- gaaagtaacaattaaaaccttcaacaccat -3'; Two types of crRNA specifically detected by CRISPR: L452R-Cas13-crRNA: 5'-ggauuuagacuaccccaaaaacgaaggggacuaaaacuauuccgguaauuauaauuaccaccaac-3'; T478K-Cas12-crRNA: 5'-guaauuucuacuaaguguagauguaccggccugauagauuuc-3'; Two fluorescent probes: RNA fluorescent probe: 5'-FAM-mArArUrGrGrCmAmArArUrGrGrCmA-BHQ1-3'; Where m represents the 2-position oxygen methyl modification, and r represents ribonucleotide; DNA fluorescent probe: 5'-VIC-TTATTATT-BHQ1-3'.
Citation Information
Patent Citations
Method and kit for detecting and screening novel coronavirus N439K mutation
CN113308575A
Novel coronavirus double-target rapid detection method and kit based on CRISPR / Cas system
CN113373264A