Construction method and application of recombinant strain for down-regulating squalene content through protein degradation to increase gibberellin GA3 content

Recombinant strains were constructed through genetic engineering, and a protein degradation system was introduced to degrade squalene synthase, which solved the problem of increasing the yield of gibberellin GA3 in the prior art, achieved the effect of significantly increasing the yield of gibberellin GA3, and had the advantages of economical and environmental protection.

CN115960731BActive Publication Date: 2025-06-20NANJING NORMAL UNIVERSITY +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211415623.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-11
Publication Date
2025-06-20
Estimated Expiration
2042-11-11

AI Technical Summary

Technical Problem

The prior art is difficult to effectively increase the yield of gibberellin GA3. Traditional methods such as mutagenesis screening and fermentation regulation can only increase the yield in a limited manner and it is difficult to fundamentally solve the problem.

Method used

Recombinant strains were constructed through genetic engineering, and genes encoding protein degraders linked to squalene synthase and genes encoding auxiliary proteins were introduced to establish a protein degradation system induced by auxin, so as to degrade squalene synthase down-regulate squalene biosynthesis, thereby increasing the yield of gibberellin GA3.

Benefits of technology

It significantly increases the yield of gibberellin GA3, which has greater advantages compared with traditional methods, has lower fermentation costs, shortened production cycle, and has the advantages of raw material regeneration, mild conditions and green production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115960731B_ABST
    Figure CN115960731B_ABST
Patent Text Reader

Abstract

The present invention relates to the fields of genetic engineering and microbial fermentation, and discloses a recombinant strain for down-regulating squalene content through protein degradation to increase the content of gibberellin GA3, and a construction method and application thereof. The recombinant strain is obtained by genetic engineering transformation of a starting strain. Compared with the starting strain, the recombinant strain contains a gene encoding a protein degrader linked to squalene synthase and a gene encoding an auxiliary protein, and the amino acid sequence of the squalene synthase is as shown in SEQ ID NO.1. The method for fermenting to produce gibberellin GA3 includes inoculating the recombinant strain into a fermentation medium for fermentation. The recombinant strain can effectively down-regulate the biosynthesis of squalene under the action of biotin and increase the yield of gibberellin GA3.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and microbial fermentation, and specifically, to a method for constructing a recombinant strain for down-regulating squalene content through protein degradation to increase the content of gibberellin GA3 and its application. Background Art

[0002] Gibberellin 3 (GA3) is a diterpenoid carboxylic acid, belonging to the gibberellin family and is a natural plant growth hormone. GA3 is one of the best-selling and most important plant growth regulators (PGRs) at present and has been widely used in aspects such as hybrid rice seed production, citrus fruit retention, cotton bowling, vegetable and young tree growth, etc., and has great economic and social benefits for promoting agricultural and forestry production, especially food production and forest cutting propagation.

[0003] The production methods of GA3 mainly include three methods: plant extraction method, chemical synthesis method and microbial fermentation method. In industrial applications, microbial fermentation is mainly used to produce GA3, which is favored by people due to its advantages such as short cycle and high efficiency. However, in the face of the growing market demand, most of the research on improving the yield of gibberellin GA3 still focuses on mutagenesis screening of high-yield strains, optimization of culture media, etc. However, the time spent on mutagenesis screening is relatively long, it is difficult to master the direction of induced mutation, and it is difficult for mutants to concentrate multiple ideal traits. Fermentation regulation can only limitedly increase the yield of gibberellin GA3 and cannot fundamentally solve the problem.

[0004] With the continuous development of synthetic biology technology, modifying the terpene pathway through metabolic engineering to increase the yield of gibberellin GA3 has become the most promising method. However, so far, there is no method for increasing the yield of gibberellin GA3 by down-regulating the squalene synthesis flux in Gibberella fujikuroi. Summary of the Invention

[0005] The purpose of the present invention is to overcome the problems existing in the prior art, and provide a method for constructing a recombinant strain for down-regulating squalene content through protein degradation to increase the content of gibberellin GA3 and its application. This recombinant strain can effectively down-regulate the biosynthesis of squalene and increase the yield of gibberellin GA3.

[0006] To achieve the above purpose, the first aspect of the present invention provides a recombinant strain for down-regulating squalene content through protein degradation to increase the content of gibberellin GA3. This recombinant strain is obtained by genetic engineering transformation of a starting strain. Compared with the starting strain, this recombinant strain contains a gene encoding a proteolytic subunit linked to squalene synthase and a gene encoding an auxiliary protein, and the amino acid sequence of the squalene synthase is as shown in SEQ ID NO.1.

[0007] Preferably, the nucleotide sequence of the encoding gene ERG9 of squalene synthase is as shown in SEQ ID NO.2.

[0008] Preferably, the starting strain is Gibberella fujikuroi.

[0009] Preferably, the gene encoding the protein degrader is the AID gene, and the nucleotide sequence of the AID gene is as shown in SEQ ID NO.3.

[0010] Preferably, the auxiliary protein is an F-box protein.

[0011] Preferably, the gene encoding the auxiliary protein is the TIR1 gene or the AFB2 gene; more preferably, it is the TIR1 gene, and the nucleotide sequence of the TIR1 gene is as shown in SEQ ID NO.4.

[0012] The second aspect of the present invention provides a method for constructing a recombinant strain for down-regulating squalene content through protein degradation to increase the content of gibberellin GA3. The method includes: genetically engineering the starting strain so that the starting strain contains a gene encoding a protein degrader linked to squalene synthase and a gene encoding an auxiliary protein, and the amino acid sequence of the squalene synthase is as shown in SEQ ID NO.1.

[0013] Preferably, the nucleotide sequence of the encoding gene ERG9 of squalene synthase is as shown in SEQ ID NO.2.

[0014] Preferably, the starting strain is Gibberella fujikuroi.

[0015] Preferably, the gene encoding the protein degrader is the AID gene, and the nucleotide sequence of the AID gene is as shown in SEQ ID NO.3.

[0016] Preferably, the auxiliary protein is an F-box protein.

[0017] Preferably, the gene encoding the auxiliary protein is the TIR1 gene or the AFB2 gene; more preferably, it is the TIR1 gene, and the nucleotide sequence of the TIR1 gene is as shown in SEQ ID NO.4.

[0018] The third aspect of the present invention provides the application of the aforementioned recombinant strain or the aforementioned method in the preparation of gibberellin GA3.

[0019] The fourth aspect of the present invention provides a method for fermenting to produce gibberellin GA3. The method includes: inoculating the aforementioned recombinant strain into a fermentation medium for fermentation; or, constructing a recombinant strain according to the aforementioned method and inoculating the obtained recombinant strain into a fermentation medium for fermentation; wherein, an auxin capable of binding to the auxiliary protein is added during the fermentation process.

[0020] Preferably, the auxin is naphthalene acetic acid and / or indole acetic acid, and the addition amount of the auxin is 0.5 - 20 mM.

[0021] Preferably, the addition time of the auxin is 0 - 96 h after the start of fermentation.

[0022] Preferably, the conditions for fermentation include: the inoculum size is 8 - 12% by volume, the temperature is 20 - 35 °C, the rotation speed is 180 - 220 rpm, and the time is 6 - 8 days.

[0023] By the above technical solution, the beneficial effects of the present invention are as follows:

[0024] The recombinant strain provided by the present invention has established an auxin-induced protein degradation system in Gibberella fujikuroi, which can cooperate with auxin during the fermentation process to effectively degrade the target protein squalene synthase, so as to down-regulate the biosynthesis of squalene, thereby significantly increasing the yield of gibberellin GA3, and having obvious advantages compared with traditional methods. The fermentation of the present invention has the advantages of low cost, short production cycle, raw material regeneration, mild conditions, green production, and being not restricted by time and location. Description of the Drawings

[0025] Figure 1 is the structural diagram of the template plasmid pUC-fFuCas9-HTBNLS-hph in Example 1;

[0026] Figure 2 is the structural diagram of the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20 in Example 1;

[0027] Figure 3 is the structural diagram of the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-dn in Example 1;

[0028] Figure 4 is the structural diagram of the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-dn-TIR1 in Example 1;

[0029] Figure 5 is the structural diagram of the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-HR-TIR1-AID in Example 1;

[0030] Figure 6 is the structural diagram of the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-HR-TIR1 in Comparative Example 1;

[0031] Figure 7It is the schematic diagram of the degradation of squalene synthase by the recombinant strain I during the fermentation process in Example 3. Among them, Rbx1 is a protein factor that assists in identifying lysine residues. Detailed implementation manners

[0032] In the ranges disclosed herein, the endpoints and any values are not limited to the exact ranges or values. These ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0033] In a first aspect, the present invention provides a recombinant strain for down-regulating squalene content to increase the content of gibberellin GA3 through protein degradation. This recombinant strain is obtained by genetic engineering transformation of a starting strain. Compared with the starting strain, the recombinant strain contains a gene encoding a proteolysis tag linked to squalene synthase and a gene encoding an auxiliary protein.

[0034] In the present invention, the gene encoding the proteolysis tag is added to the C-terminus or N-terminus of squalene synthase in the recombinant strain, and at the same time, the gene encoding the auxiliary protein is introduced; the auxiliary protein can form a ubiquitin ligase complex in combination with an endogenous protein in the recombinant strain. When an auxin that can bind to the auxiliary protein is added during the cultivation of the recombinant strain, the auxin binds to the auxiliary protein, causing the conformation of the ubiquitin ligase complex to change, so as to specifically recruit the target protein squalene synthase with the proteolysis tag, and degrade the target protein. The target protein can be rapidly degraded within 10 - 360 minutes, thereby down-regulating the biosynthesis of squalene, enabling more farnesyl pyrophosphate (FPP) to flow towards the biosynthesis of gibberellin GA3, and ultimately increasing the yield of gibberellin GA3.

[0035] According to the present invention, preferably, the amino acid sequence of the squalene synthase is as shown in SEQ ID NO.1. Further preferably, the nucleotide sequence of the encoding gene ERG9 of the squalene synthase is as shown in SEQ ID NO.2.

[0036] According to the present invention, preferably, the starting strain is Fusarium fujikuroi. More preferably, it is the Fusarium fujikuroi disclosed in the patent application with the publication number CN105441340A, and the preservation number is: CCTCC NO:M2015614.

[0037] According to the present invention, the gene encoding the protein degrader can be any sequence capable of labeling squalene synthase. Preferably, the gene encoding the protein degrader is the AID gene, and the nucleotide sequence of the AID gene is as shown in SEQ ID NO.3.

[0038] According to the present invention, the auxiliary protein can be any protein sequence capable of binding to the corresponding biotin. The combination of the auxiliary protein and the endogenous protein in the recombinant strain can form a ubiquitin ligase complex. Then, when the corresponding biotin is added during the cultivation of the recombinant strain, the biotin binds to the auxiliary protein, causing a conformational change in the ubiquitin ligase complex, so as to specifically recruit the target protein with the protein degrader, and then degrade the target protein. Preferably, the auxiliary protein is an F-box protein. Further preferably, the gene encoding the auxiliary protein is the TIR1 gene or the AFB2 gene; more preferably, the auxiliary protein is the TIR1 gene, and the nucleotide sequence of the TIR1 gene is as shown in SEQ ID NO.4.

[0039] In the present invention, when the gene encoding the auxiliary protein is the TIR1 gene or the AFB2 gene, the corresponding auxin can be naphthaleneacetic acid (NAA) and / or indoleacetic acid (IAA).

[0040] The inventors of the present invention found that starting from Gibberella fujikuroi, an AID gene encoding a protein degrader was linked to its squalene synthase, and the TIR1 gene encoding an auxiliary protein was introduced. The auxiliary protein TIR1 can interact with endogenous Skp1 and Cul1 proteins to form an SCF-E3 ubiquitin ligase complex. In the case of adding auxin (naphthaleneacetic acid and / or indoleacetic acid) during fermentation, the auxin binds to the F-box protein TIR1, causing a conformational change in the SCF-E3 ubiquitin ligase complex, so as to specifically recruit the squalene synthase protein with the AID gene, degrade the squalene synthase in the cells of the recombinant strain, and thus more significantly improve the yield of gibberellin GA3 produced by the recombinant strain.

[0041] The second aspect of the present invention provides a method for constructing a recombinant strain for reducing squalene content by protein degradation to increase the content of gibberellin GA3. The method includes: genetically engineering a starting strain so that the starting strain contains a gene encoding a protein degrader linked to squalene synthase and a gene encoding an auxiliary protein, and the amino acid sequence of the squalene synthase is as shown in SEQ ID NO.1.

[0042] According to the present invention, preferably, the nucleotide sequence of the encoding gene ERG9 of the squalene synthase is as shown in SEQ ID NO.2.

[0043] According to the present invention, preferably, the starting strain is Gibberella fujikuroi.

[0044] According to the present invention, preferably, the gene encoding the protein degrader is the AID gene, and the nucleotide sequence of the AID gene is as shown in SEQ ID NO.3.

[0045] According to the present invention, preferably, the auxiliary protein is an F-box protein.

[0046] According to the present invention, preferably, the gene encoding the auxiliary protein is the TIR1 gene or the AFB2 gene; more preferably, it is the TIR1 gene, and the nucleotide sequence of the TIR1 gene is as shown in SEQ ID NO.4.

[0047] In the present invention, the gene encoding the protein degrader and the gene encoding the auxiliary protein are added or introduced into the starting strain by means of homologous recombination based on CRISPR-Cas9. The exogenous gene sequence fragments used for homologous recombination can be obtained in the following ways: The upstream and downstream fragment sequences of the required genes (such as the AID gene and the TIR1 gene) that are publicly available in well-known databases in the art (such as the GenBank database, https: / / www.ncbi.nlm.nih.gov / genbank / ) or artificially synthesized known sequences are artificially synthesized as homologous arms; or the upstream and downstream fragment sequences of the required genes are amplified from the genome of the starting strain (such as Gibberella fujikuroi) by PCR as homologous arms, so as to obtain the initial homologous sequence fragments of the required genes, but the present invention is not limited thereto.

[0048] In the present invention, the exogenous introduction of the protein degrader and the auxiliary protein can be achieved by conventional methods in the art. The exogenous introduced genes can all be replicated in Escherichia coli after constructing the corresponding recombinant vectors first, and then introduced into the competent starting strain. Various methods for constructing recombinant vectors are known in the art to be used to ligate the target gene fragments (such as the AID gene and the TIR1 gene) to the expression vector to prepare recombinant vectors, for example, but not limited to, the classical "enzymatic digestion-ligation" method, the Gateway cloning system developed by Invitrogen Corporation, and the ClonExpress cloning system developed by Novoprotein Scientific Inc. (such as the ClonExpress MultiS One Step Cloning Kit).

[0049] Exemplarily, the AID gene can be used to construct the recombinant vector of the present invention by a recombinase method: based on the genome of a starting strain (such as Gibberella fujikuroi), the upstream and downstream homologous arm sequences of the targeted insertion site are amplified by PCR; the target gene expression cassette to be inserted, the upstream and downstream homologous arm sequences, the resistance gene expression cassette, etc. are connected in series to obtain the recombinant vector, but the present invention is not limited thereto.

[0050] Subsequently, the recombinant vector can be introduced into the starting strain (such as Gibberella fujikuroi) by conventional methods in the art, such as but not limited to microinjection, gene gun, transformation (such as electroporation). The above microinjection, gene gun or transformation are all conventional operations in the art. For example, transformation refers to treating cells by using some known methods in molecular biology and genetic engineering, making the treated cells in a competent state, and thus contacting with exogenous DNA, so that the exogenous DNA enters the competent cells. Common transformation methods include protoplast transformation method, chemical transformation method and electroporation transformation method.

[0051] In the present invention, when using Gibberella fujikuroi as the starting strain, after the recombinant vector is introduced into the starting strain, positive clones can be screened out through a screening marker (such as a resistance gene), and verified by genomic PCR or by sequencing the genomic DNA, so as to obtain the recombinant strain with high-yield gibberellin GA3.

[0052] The third aspect of the present invention provides the application of the aforementioned recombinant strain or the aforementioned method in the preparation of gibberellin GA3.

[0053] The fourth aspect of the present invention provides a method for fermenting and producing gibberellin GA3, which includes: inoculating the aforementioned recombinant strain into a fermentation medium for fermentation; or, constructing a recombinant strain according to the aforementioned method, and inoculating the obtained recombinant strain into a fermentation medium for fermentation; wherein, auxin capable of binding to the auxiliary protein is added during the fermentation process.

[0054] In the case of adding auxin during the fermentation process, the auxiliary protein can bind to the endogenous protein in the recombinant strain to form a ubiquitin ligase complex. Furthermore, the binding of auxin to the auxiliary protein causes a conformational change in the ubiquitin ligase complex, so as to specifically recruit the squalene synthase protein with the proteasome, causing the degradation of squalene synthase in the recombinant strain cells, and further significantly increasing the yield of gibberellin GA3 produced by the recombinant strain.

[0055] In the present invention, preferably, the recombinant strain is first prepared into a seed solution, and then the seed solution is inoculated into the fermentation medium for fermentation to obtain a fermentation broth.

[0056] In the present invention, preferably, the method for preparing the seed liquid includes: picking a single colony of the recombinant strain and inoculating it into a seed medium for seed culture to obtain the seed liquid.

[0057] In the present invention, there is no particular limitation on the seed medium, and it can be a seed medium commonly used in the art for preparing the seed liquid of Gibberella fujikuroi. Preferably, the seed medium contains a carbon source, a nitrogen source, and inorganic salts. Further preferably, the seed medium contains glucose, soybean cake powder, peanut cake powder, dextrin, KH2PO4, (NH4)2SO4, and MgSO4·7H2O. Exemplarily, the seed medium is in a mass / volume ratio of: glucose 1.0 - 3.0%, soybean cake powder 1.5 - 2.5%, peanut cake powder 0.8 - 1.5%, dextrin 2.0 - 4.0%, KH2PO4 0.08 - 0.16%, (NH4)2SO4 0.01 - 0.03%, MgSO4·7H2O 0.05 - 0.15%.

[0058] In the present invention, there is no particular limitation on the method for seed culture, and parameters such as the temperature, pH, rotation speed, and time used for seed culture can be conventional settings in the art. Preferably, the conditions for seed culture include: a temperature of 20 - 35°C, a rotation speed of 280 - 220 rpm, and a time of 20 - 28 h. In the present invention, for seed culture, a single colony of the recombinant strain can be inoculated, for example, it can be selected from the colonies obtained by streak culture of the recombinant strain on a solid plate. Exemplarily, the recombinant strain is inoculated and streaked on a PDA solid plate and cultured at a temperature of 20 - 35°C for 2 - 3 days to obtain a single colony of the recombinant strain.

[0059] In the present invention, there is no particular limitation on the fermentation medium, and it can be a fermentation medium commonly used in the art for Gibberella fujikuroi. Preferably, the fermentation medium contains a carbon source, a nitrogen source, and inorganic salts. Further preferably, the carbon source is selected from at least one of starch liquefied liquid, dextrin, maltose syrup, maltose, and glucose, and the nitrogen source is selected from at least one of soybean cake powder, peanut cake powder, corn protein powder, rice protein powder, (NH4)2SO4, NH4COOH, NaNO3, and KNO3, and the inorganic salts are selected from at least one of MgSO4·7H2O, (NH4)2SO4, and KH2PO4. Exemplarily, the fermentation medium is in a mass / volume ratio of: carbon source 8 - 12%, nitrogen source 2.5 - 4.0%, MgSO4·7H2O 0.08 - 0.12%, (NH4)2SO4 0.02 - 0.04%, KH2PO4 0.15 - 0.30%.

[0060] According to the present invention, parameters such as inoculum size, temperature, pH, rotation speed, and time used in fermentation culture can be conventional settings in the art. Preferably, the conditions for the fermentation include: inoculum size is 8-12% by volume, temperature is 20-35 °C, rotation speed is 180-220 rpm, and time is 6-8 days. The inventors found that under this preferred specific embodiment, it is beneficial to promote the growth of the recombinant strain, and improve the biomass of the fermentation and the yield of gibberellin GA3.

[0061] In the present invention, in order to improve the yield of gibberellin GA3, preferably, relative to 100 parts by volume of the fermentation medium, the inoculum size of the seed liquid is 8-12 parts by volume.

[0062] According to the present invention, in order to further improve the yield of gibberellin GA3 produced by the recombinant strain through fermentation, preferably, when the coding gene of the auxiliary protein is the TIR1 gene or the AFB2 gene, the auxin is naphthaleneacetic acid and / or indoleacetic acid, and the addition amount of the auxin is 0.5-20 mM.

[0063] According to the present invention, preferably, the addition time of the auxin is 0-96 h after the start of fermentation. The inventors found that under this preferred specific embodiment, it is beneficial to promote the formation of the ubiquitin ligase complex, improve the degradation efficiency of squalene synthase, and further improve the yield of gibberellin GA3.

[0064] In the present invention, gibberellin GA3 in the obtained fermentation broth can be separated by known methods. Exemplarily, gibberellin GA3 can be secreted by the recombinant strain into the extracellular space. After removing the cells in the fermentation broth, the fermentation broth after removing the cells is concentrated to crystallize the product, or methods such as ion exchange chromatography are used for separation.

[0065] The present invention will be described in detail below through examples. However, these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, unless otherwise specified, the experimental methods used are conventional methods well known to those skilled in the art or according to the conditions recommended by the manufacturer.

[0066] In the following examples, unless otherwise specified, the reagents and media used are commercially available products, and the methods used are conventional methods; in the case of no special instructions, the room temperature is 25 ± 5 °C.

[0067] In the following examples, the starting strain is Fusarium fujikuroi, which is disclosed in the patent application with the publication number CN105441340A, and the preservation number is: CCTCC NO: M2015614.

[0068] In the following examples, the PDA medium contains: 200 g / L of potato pieces, 20 g / L of glucose, and 15 g / L of agar;

[0069] The seed medium, calculated by mass / volume ratio, is: 1.5% glucose, 2.0% soybean cake powder, 1.5% peanut cake powder, 2.5% dextrin, 0.12% KH2PO4, 0.02% (NH4)2SO4, and 0.10% MgSO4·7H2O;

[0070] The fermentation medium, calculated by mass / volume ratio, is: 10% starch liquefied solution, 1.5% peanut cake powder, 1.5% soybean cake powder, 0.10% MgSO4·7H2O, 0.03% (NH4)2SO4, and 0.25% KH2PO4;

[0071] The MYG medium contains: 10 g / L of glucose, 2 g / L of yeast powder, and 20 g / L of agar powder;

[0072] The hygromycin soft agar regeneration plate medium with a concentration of 100 μg / mL contains: 10 g / L of glucose, 2 g / L of yeast powder, 8 g / L of agar powder, 171 g / L of sucrose, and 100 μg / mL of hygromycin.

[0073] In the following examples, the preparation process of Gibberella fujikuroi competent cells is as follows:

[0074] (1) Inoculate a single colony of Gibberella fujikuroi into 100 mL of the seed medium and culture it at 30 °C and a rotation speed of 200 rcf for 48 h to obtain a regenerated bacterial solution; inoculate 10 mL of the regenerated bacterial solution into a new 100 mL of the seed medium for subculture for 12 h to obtain a culture solution, filter the culture solution with a sterile lens paper, and collect the bacterial cells;

[0075] (2) Dissolve a mixed enzyme with a Dryalase:Lysing mass ratio of = 3:7 (45 mg, 105 mg) in a sodium chloride buffer solution (0.41 g in 10 mL), stir and mix evenly, filter and sterilize with a 0.22 μm filter head, then add 1 g of the bacterial cells obtained in step (1) to each 10 mL, and enzymatically hydrolyze at 30 °C and a rotation speed of 200 rcf for 3.5 h to obtain an enzymatic hydrolysate;

[0076] (3) Filter the enzymatic hydrolysate obtained in step (2) through three layers of lens paper to remove mycelial debris. The following is the protoplast solution. Centrifuge at 3000 rcf for 10 min to obtain a protoplast precipitate. Suspend and centrifuge the protoplast precipitate with an ice-bath STC solution (containing 1 M sorbitol, 10 mM Tris-cl, 50 mM CaCl2, pH = 7.5). Repeat once, then suspend the protoplasts in an appropriate amount of STC solution and adjust the protoplast concentration to 10 7 -108 / mL to obtain the competent cell solution.

[0077] In the following examples, the transformation process of the recombinant plasmid is as follows:

[0078] Take 50 μL of the competent cell solution, add 10 - 15 μg of the plasmid, incubate on ice for 20 min, add 50 μL of a 25 wt% PEG6000 - STC solution (containing 1 M sorbitol, 10 mM Tris - Cl, 50 mM CaCl2, pH = 7.5), mix and incubate on ice for 20 min, then add 1 mL of the PEG6000 - STC solution, mix at room temperature for 5 min, then add 2 mL of the STC solution, mix well and take 160 μL to coat on the MYG solid regeneration plate. After culturing for 12 h, cover with 10 mL of a 100 μg / ml hygromycin soft agar regeneration plate and wait for 5 - 7 days for the transformants to appear.

[0079] In the following examples, the genomic extraction process is as follows:

[0080] Pick the transformants, inoculate them into the seed medium, culture at a temperature of 28°C and a rotation speed of 200 rpm for 24 h, then take 50 mL of the bacterial solution, centrifuge at 12000 rpm for 10 min to obtain the transformant bacteria, and extract the genome of the transformant bacteria according to the operation instructions of the fungal genomic extraction kit of Sangon Biotech (Shanghai) Co., Ltd.

[0081] In the following examples, the cloning process of genes and expression elements is as follows:

[0082] The PCR enzyme used in PCR amplification is PrimeSTAR Max DNA polymerase from TAKARA; the PCR amplification system is shown in Table 1.

[0083] Table 1 PCR amplification system

[0084] Reagent Dosage Final concentration PrimeSTAR Max(2×) 25 μl 1× Primer 1 10 - 15 pmol 0.2 - 0.3 μmol Primer 2 10 - 15 pmol 0.2 - 0.3 μmol Template <200 ng Sterilized distilled water Up to 50 μL

[0085] Among them, the PCR amplification process is: denaturation treatment at 98°C for 10 s, annealing at 55°C for 10 s, and then extension at 72°C. After repeating 35 cycles, each fragment is purified and recovered using the AxyPrepTM DNA Gel Extraction Kit (purchased from Corning Life Sciences (Wujiang) Co., Ltd.), where the extension time = target fragment length / 1 kb, unit min.

[0086] One-step cloning was achieved using the ClonExpress MultiS One Step CloningKit of Nanjing Novoprotein Scientific Inc. The reaction system is shown in Table 2. After incubating the reaction system at 50 °C for 15 min, a circular recombinant vector was obtained, and the PS gene expression cassette and the 3(B)-isopropylmalate dehydrogenase-encoding gene expression cassette (screening marker) were successfully inserted between the upstream and downstream homologous arms at the A08 site;

[0087] Table 2 One-step cloning system

[0088] Component Recombination reaction Linearized vector X μL N inserted fragments <![CDATA[Y1+Y2+…Y n μL]]> 2×ClonExpress Mix 5 μL <![CDATA[ddH2O]]> To 10 μL

[0089] The circular recombinant vector was transformed into Escherichia coli DH5α competent cells, screened by an ampicillin-resistant plate, and verified by colony PCR and sequencing to obtain a positive recombinant plasmid, which was sent for sequencing.

[0090] Example 1

[0091] (1) Construction of the original plasmid

[0092] According to the nucleotide sequences of the TIR1 gene and the AID gene provided on NCBI, after specific codon optimization, they were synthesized by Tsingke Biological Co., Ltd. The nucleotide sequence of the AID gene is shown in SEQ ID NO.3, and the nucleotide sequence of the TIR1 gene is shown in SEQ ID NO.4.

[0093] (2) Construction of the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20

[0094] The structural diagram of the template plasmid pUC-fFuCas9-HTBNLS-hph is as Figure 1 shown, where HPH represents the hygromycin selection gene, pTRPC is the promoter expressing the HPH gene, AmpR represents the ampicillin resistance gene, AmpR promoter is the promoter expressing the AmpR gene, FfuCas9 represents the Cas9 gene optimized for codons of Gibberella fujikuroi, pGPD is the strong promoter expressing FfuCas9, and HTB represents the histone H2B nuclear localization signal; the nucleotide sequence of the template plasmid pUC-fFuCas9-HTBNLS-hph is shown in SEQ ID NO.5;

[0095] Using pUC-fFuCas9-HTBNLS-hph as the backbone, the circular plasmid was digested into linear fragments with the restriction enzyme EcorI. Then, using the N20 expression cassette synthesized by Tsingke as a template, primers N20-F (nucleotide sequence shown in SEQ ID NO.6) and N20-R (nucleotide sequence shown in SEQ ID NO.7) were designed to amplify the N20 expression cassette with a linker (nucleotide sequence shown in SEQ ID NO.8). The backbone and the fragment were subjected to one-step cloning using a kit. After sequencing verification, the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20 was obtained, and its structural diagram is as shown in Figure 2 shown;

[0096] N20-F (SEQ ID NO.6): acgttgtaaaacgacggccagtgaattcCACATACGACCAAAGGTAGT,

[0097] N20-R (SEQ ID NO.7):

[0098] tgcattcgcgaggtaccgagctcGAATTAAAAAAGCACCGACTCGGTGCC;

[0099] (3) Construction of recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-dn

[0100] Using pUC-fFuCas9-HTBNLS-hph-N20 as the backbone, the circular plasmid was digested into linear fragments with the restriction enzyme NotI. Then, using the Gibberella genome as a template, primers dn-F (nucleotide sequence shown in SEQ ID NO.9) and dn-R (nucleotide sequence shown in SEQ ID NO.10) were designed to amplify the downstream homologous arm dn. The backbone and the fragment were subjected to one-step cloning using a kit. After sequencing verification, the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-dn was obtained, and its structural diagram is as shown in Figure 3 shown;

[0101] dn-F (SEQ ID NO.9): ACTACCGCATTAAGACCTCAGCGCGGCCTATTATGCGCGCCGatttgt,

[0102] dn-R (SEQ ID NO.10): ACTTCATTTTATTTAAATTTGCGGCCGCCCATTTGCTTCTCGTCAATG;

[0103] (4) Construction of recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-dn-TIR1

[0104] Using pUC-fFuCas9-HTBNLS-hph-N20-dn as the backbone, the circular plasmid was digested into a linear fragment with the restriction enzyme PmeI. Then, using the Gibberella genome as a template, primers P GPD -F (nucleotide sequence as shown in SEQ ID NO.11) and P GPD -R (nucleotide sequence as shown in SEQ ID NO.12) were designed to amplify the upstream homologous arm P GPD (nucleotide sequence as shown in SEQ ID NO.13). Primers T2-F (nucleotide sequence as shown in SEQ ID NO.14) and T2-R (nucleotide sequence as shown in SEQ ID NO.15) were designed to amplify T2 (nucleotide sequence as shown in SEQ ID NO.16). Then, using the TIR1 gene synthesized by Tsingke as a template, primers TIR1-F (nucleotide sequence as shown in SEQ ID NO.17) and TIR1-R (nucleotide sequence as shown in SEQ ID NO.18) were designed to amplify the gene fragment TIR1 (nucleotide sequence as shown in SEQ ID NO.4). The backbone and the fragments were subjected to one-step cloning using a kit. After sequencing verification, the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-dn-TIR1 was obtained, and its structural diagram is as shown in Figure 4 ;

[0105] P GPD -F (SEQ ID NO.11): TAGGTATAAACCTCGAAATCGTTTAAACGTACAGTGACCGGTGACTCT,

[0106] P GPD -R (SEQ ID NO.12): AGAGCGATTCGCTTCTGCATGGTGATGTCTGCTCAAGCGG,

[0107] T2-F (SEQ ID NO.14): TCACCACCAACGGCCTCTAATCAGAGAACGTTTTATGAAT,

[0108] T2-R (SEQ ID NO.15): ATTCATAAAACGTTCTCTGATTAGAGGCCGTTGGTGGTGA,

[0109] TIR1-F (SEQ ID NO.17): CCGCTTGAGCAGACATCACCATGCAGAAGCGAATCGCTCT,

[0110] TIR1-R (SEQ ID NO.18): GTCATGTAATATCACGTGTGTACAgtttGTTTGTTGCAGCTGTGTTTC.

[0111] (5) Construction of recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-HR-TIR1-AID

[0112] Using pUC-fFuCas9-HTBNLS-hph-N20-dn-TIR1 as the backbone, the circular plasmid was digested into a linear fragment with the restriction enzyme PmeI. Then, using the Gibberella genome as a template, primers up2-F (nucleotide sequence shown in SEQ ID NO.19) and up2-R (nucleotide sequence shown in SEQ ID NO.20) were designed to amplify the upstream homologous arm up2, and primers T1-F1 (nucleotide sequence shown in SEQ ID NO.21) and T1-R1 (nucleotide sequence shown in SEQ ID NO.22) were designed to amplify T1 (nucleotide sequence shown in SEQ ID NO.23); Then, using the AID plasmid synthesized by Tsingke as a template, primers AID-F (nucleotide sequence shown in SEQ ID NO.24) and AID-R (nucleotide sequence shown in SEQ ID NO.25) were designed to amplify the gene fragment AID (nucleotide sequence shown in SEQ ID NO.3). The backbone and the fragment were subjected to one-step cloning using a kit. After sequencing verification, the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-HR-TIR1-AID was obtained, and its structural diagram is as Figure 5 shown;

[0113] up2-F (SEQ ID NO.19): TAGGTATAAACCTCGAAATCGTTTAAACATGGGTTACCTCTACTACCT,

[0114] up2-R (SEQ ID NO.20): ATCATGGAGCCGCCGCCTCCTTACAATTCTTCGTGACCCG,

[0115] T1-F1 (SEQ ID NO.21): AGTGCAAGTCTCGAGCTTAAGCAACTTATTTCTGAAATGA,

[0116] T1-R1 (SEQ ID NO.22):

[0117] AGAAAGAGTCACCGGTCACTGTACGTTTGAAGGAAGAGATAATATTGT

[0118] AID-F (SEQ ID NO.24):

[0119] TGTAAGGAGGCGGCGGCTCCATGATGGGCTCTGTCGAGCT,

[0120] AID-R (SEQ ID NO.25): TCATTTCAGAAATAAGTTGCTTAAGCTCGAGACTTGCACT.

[0121] Comparative Example 1

[0122] Construct the recombinant plasmid according to the method of Example 1, except that step (5) is replaced with:

[0123] (5) Construction of recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-HR-TIR1

[0124] Using pUC-fFuCas9-HTBNLS-hph-N20-dn-TIR1 as the backbone, the circular plasmid was digested into linear fragments with the restriction enzyme Pme I. Then, using the Gibberella genome as a template, primers up1-F (nucleotide sequence shown in SEQ ID NO.26) and up1-R (nucleotide sequence shown in SEQ ID NO.27) were designed to amplify the upstream homologous arm up1, and primers T1-F2 (nucleotide sequence shown in SEQ ID NO.28) and T1-R2 (nucleotide sequence shown in SEQ ID NO.22) were designed to amplify T1 (identical to T1 nucleotide sequence in Example 1, only different in homologous arms). The backbone and fragments were subjected to one-step cloning using a kit, and after sequencing verification, the recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-HR-TIR1 was obtained, and its structural diagram is as Figure 6 shown;

[0125] up1-F (SEQ ID NO.26): TAGGTATAAACCTCGAAATCGTTTAAACATGGGTTACCTCTACTACCT,

[0126] up1-R (SEQ ID NO.27): TCATTTCAGAAATAAGTTGCTTACAATTCTTCGTGACCCG,

[0127] T1-F2 (SEQ ID NO.28): CGGGTCACGAAGAATTGTAAGCAACTTATTTCTGAAATGA,

[0128] Example 2

[0129] The recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-HR-TIR1-AID obtained in Example 1 was transformed into the competent cells of Gibberella fujikuroi, so that the AID end in the recombinant plasmid was ligated to the C-terminus of squalene synthase (nucleotide sequence as shown in SEQ ID NO.2) in Gibberella fujikuroi, and the recombinant strain I was obtained.

[0130] Comparative Example 2

[0131] The recombinant plasmid pUC-fFuCas9-HTBNLS-hph-N20-HR-TIR1-terminator obtained in Comparative Example 1 was transformed into the competent cells of Gibberella fujikuroi to obtain the recombinant strain II.

[0132] Example 3

[0133] (1) The recombinant strain I obtained in Example 2 was streaked on a PDA solid plate. After culturing for 3 days, single colonies were selected and inoculated into the seed medium, and cultured at a temperature of 28 °C and a rotation speed of 200 rpm for 24 h, and the well-cultured seed liquid was picked;

[0134] (2) Inoculated into the fermentation medium at an inoculation amount of 10% by volume, and fermented at a temperature of 28 °C and a rotation speed of 200 rpm for 7 days to obtain the fermentation broth I; among them, naphthaleneacetic acid (the final concentration of naphthaleneacetic acid is 1 mM) was added at 24 h of fermentation. The TIR1 gene interacts with the endogenous Skp1 and Cul1 proteins to form the SCF-E3 ubiquitin ligase complex. The binding of naphthaleneacetic acid to the TIR1 gene changes the conformation of the SCF-E3 ubiquitin ligase complex, which can specifically recruit squalene synthase carrying the AID gene, causing the degradation of squalene synthase (the degradation principle is as Figure 7 shown).

[0135] Comparative Example 3

[0136] (1) The recombinant strain II obtained in Comparative Example 2 was streaked on a PDA solid plate. After culturing for 3 days, single colonies were selected and inoculated into the seed medium, and cultured at a temperature of 28 °C and a rotation speed of 200 rpm for 24 h, and the well-cultured seed liquid was picked;

[0137] (2) It was inoculated into the fermentation medium at an inoculation amount of 10% by volume and fermented for 7 days at a temperature of 28 °C and a rotation speed of 200 rpm to obtain Fermentation Broth II, and 1-naphthaleneacetic acid (the final concentration of 1-naphthaleneacetic acid was 1 mM) was added at 24 h of fermentation.

[0138] Comparative Example 4

[0139] The fermentation of Recombinant Strain I was carried out according to the method of Example 3, except that step (2) was replaced with:

[0140] (2) It was inoculated into the fermentation medium at an inoculation amount of 10% by volume and fermented for 7 days at a temperature of 28 °C and a rotation speed of 200 rpm to obtain Fermentation Broth III.

[0141] Comparative Example 5

[0142] The fermentation of Recombinant Strain II was carried out according to the method of Comparative Example 3, except that step (2) was replaced with:

[0143] (2) It was inoculated into the fermentation medium at an inoculation amount of 10% by volume and fermented for 7 days at a temperature of 28 °C and a rotation speed of 200 rpm to obtain Fermentation Broth IV.

[0144] Test Example

[0145] 1. Take 4 mL of Fermentation Broth I - Fermentation Broth IV, centrifuge at a rotation speed of 6000 rpm for 10 min to obtain the supernatant, filter the supernatant through a 0.22 μm filter head to remove residues, and then load the filtrate into a liquid phase injection vial for HPLC detection of the content of gibberellin GA3. The results are shown in Table 3;

[0146] The HPLC detection conditions are as follows: Use a Dionex U3000 high performance liquid chromatograph, adopt a Venusil MPC18 column with a packing particle size of 5 μm, the volume ratio of methanol, water, and phosphoric acid in the mobile phase is 68:32:0.05, the flow rate is set at 0.8 mL / min, the detection wavelength is 210 nm, and the injection volume is 10 μL; the retention time of gibberellin GA3 is 17.565 min.

[0147] 2. Qualitative and quantitative analysis of DCW (dry cell weight) and squalene

[0148] Collect the bacterial cells of Fermentation Broth I - Fermentation Broth IV, freeze-dry them, weigh the mass of the dried bacterial cells, calculate the DCW, and the results are shown in Table 3;

[0149] Weigh 10 mg of dry bacterial powder quantitatively, resuspend the bacteria with 500 μL of sodium methoxide (sodium hydroxide dissolved in pure methanol) at a concentration of 0.5 M, shake at 1200 rpm for 2 h at room temperature, then add 40 μL of concentrated sulfuric acid for neutralization, and then add 400 μL of dodecane to extract squalene. After shaking at room temperature for 10 min, centrifuge and collect the dodecane layer. After passing the dodecane layer through a membrane, analyze the squalene content in the recombinant strain by GC-MS. The results are shown in Table 3;

[0150] GC-MS detection conditions: injection port temperature 250 °C, injection volume 1 μL, split ratio 20:1; chromatographic column: HP-5 (30 m × 320 μm × 0.25 μm); chromatographic conditions: hold at 175 °C for 3 min, increase the temperature to 200 °C at a rate of 20 °C / min and hold for 3 min, increase the temperature to 260 °C at a rate of 20 °C / min and hold for 4 min; use the standard product of squalene for qualitative and quantitative analysis.

[0151] Table 3

[0152] Number Gibberellin GA3 content (mg / L fermentation broth) Squalene content (mg / L fermentation broth) Example 3 3518 107 Comparative Example 3 2178 1103 Comparative Example 4 2204 1010 Comparative Example 5 2123 1082

[0153] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A recombinant strain for down - regulating squalene content through protein degradation to increase the content of gibberellin GA3, characterized in that, The recombinant strain is obtained by genetically engineering the starting strain. Compared with the starting strain, the recombinant strain contains a gene encoding a protein degron linked to squalene synthase and a gene encoding an auxiliary protein. The amino acid sequence of the squalene synthase is shown in SEQ ID NO.1; the starting strain is Gibberella fujikuroi; the gene encoding the protein degron is the AID gene, and the nucleotide sequence of the AID gene is shown in SEQ ID NO.3; the gene encoding the auxiliary protein is the TIR1 gene, and the nucleotide sequence of the TIR1 gene is shown in SEQ ID NO.

4.

2. The recombinant strain according to claim 1, characterized in that, The nucleotide sequence of the encoding gene ERG9 of the squalene synthase is shown in SEQ ID NO.

2.

3. A method for constructing a recombinant strain for down - regulating squalene content through protein degradation to increase the content of gibberellin GA3, characterized in that, The method includes: genetically engineering the starting strain so that the starting strain contains a gene encoding a protein degron linked to squalene synthase and a gene encoding an auxiliary protein. The amino acid sequence of the squalene synthase is shown in SEQ ID NO.1; The starting strain is Gibberella fujikuroi; the gene encoding the protein degron is the AID gene, and the nucleotide sequence of the AID gene is shown in SEQ ID NO.3; the gene encoding the auxiliary protein is the TIR1 gene, and the nucleotide sequence of the TIR1 gene is shown in SEQ ID NO.

4.

4. The method according to claim 3, characterized in that, The nucleotide sequence of the encoding gene ERG9 of the squalene synthase is shown in SEQ ID NO.

2.

5. The application of the recombinant strain according to claim 1 or 2 or the method according to claim 3 or 4 in the preparation of gibberellin GA3.

6. A method for fermenting to produce gibberellin GA3, characterized in that, The method includes: inoculating the recombinant strain according to claim 1 or 2 into a fermentation medium for fermentation; Alternatively, constructing a recombinant strain according to the method of claim 3 or 4, and inoculating the obtained recombinant strain into a fermentation medium for fermentation; Wherein, an auxin capable of binding to the auxiliary protein is added during the fermentation process.

7. The method according to claim 6, characterized in that, The auxin is naphthaleneacetic acid and / or indoleacetic acid, and the addition amount of the auxin is 0.5 - 20 mM.

8. The method according to claim 7, characterized in that, The addition time of the auxin is 0 - 96 h after the start of fermentation.

9. The method according to claim 7, characterized in that, The conditions for the fermentation include: the inoculation amount is 8 - 12% by volume, the temperature is 20 - 35 °C, the rotation speed is 180 - 220 rpm, and the time is 6 - 8 days.

Citation Information

Patent Citations

  • High-producing strain of GA (gibberellin) 4+7 and application of high-producing strain

    CN105441340A

  • Method for producing gibberellins GA3 through gibberella fujikuroi residues

    CN106520886A

  • Gibberella fujikuroia mutant strain with high yield of gibberellin GA3 and applications thereof

    CN110042061A