An antibacterial composite preparation containing eucommia leaf extract and its application in food preservation

Abstract

The present invention discloses an antibacterial composite preparation containing eucommia leaf extract and its application in food preservation and fresh-keeping. The present invention obtains a fusion antibacterial polypeptide CLysM with significantly improved antibacterial activity through optimization, mutation, screening and fusion, and its amino acid sequence is shown in SEQ ID NO: 1, and its nucleotide sequence of the encoding gene is shown in SEQ ID NO: 2. It can withstand high temperatures above 80°C and is non-hemolytic; and has a significant inhibitory effect on Staphylococcus aureus, Clostridium perfringens, Streptococcus agalactiae, Escherichia coli, and Salmonella. The present invention compounded the fusion antibacterial polypeptide CLysM with the eucommia leaf extract into an antibacterial composite preparation, and experiments verified that it has a good effect of inhibiting the growth of food bacteria, thereby achieving the purpose of food preservation and fresh-keeping, so that it has good application prospects in the fields of food and the like.

Description

Technical Field

[0001] The invention belongs to the field of enzyme engineering and food, and particularly relates to an antibacterial composite preparation containing eucommia leaf extract and application of the antibacterial composite preparation in food preservation. Background Art

[0002] Cecropin antimicrobial peptide is the first antimicrobial peptide discovered in the world and is also the most studied type of antimicrobial peptide. Antimicrobial peptides are green additives and preservatives with no toxic side effects, no drug residues, and no environmental pollution. They are ideal substitutes for antibiotics and can prevent antibiotic residues in meat, milk, and eggs. This is beneficial to improving the quality of poultry and livestock products, and to human health. It can also avoid inducing the production of drug-resistant pathogens and prevent the vicious cycle caused by cross-infection. It has long-term and social benefits in the sustainable development of agriculture and animal husbandry and the protection of the ecological environment.

[0003] Lysozyme is widely present in many tissues of the human body, as well as in the egg white of birds and poultry, and in the tears, saliva, plasma, and milk of mammals. Lysozyme, also known as muramidase or N-acetyl muramid polysaccharide hydrolase, is an alkaline enzyme that can hydrolyze mucopolysaccharides in bacteria. It mainly breaks the β-1,4 glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine in the cell wall, decomposing the insoluble mucopolysaccharides in the cell wall into soluble glycopeptides, causing the cell wall to rupture and the contents to escape, causing the bacteria to dissolve, thereby having an antibacterial effect.

[0004] Antimicrobial peptide products are suitable for the preservation of various foods and are also safe feed additives. Adding them to feed can prevent mildew, extend the storage period of feed, and reduce unnecessary losses.

[0005] However, lysozyme from natural sources generally has low activity and requires a higher addition amount to achieve a more ideal effect. Therefore, finding or designing safe lysozyme with good antibacterial effect is an urgent problem to be solved, and obtaining new preservative and fresh-keeping products is of great significance to the food industry. Summary of the invention

[0006] The present invention provides an antibacterial composite preparation containing eucommia leaf extract and its application in food preservation and fresh-keeping. The present invention obtains a fusion antibacterial polypeptide CLysM with improved antibacterial activity, and the antibacterial composite preparation prepared by the fusion antibacterial polypeptide and the eucommia leaf extract has a good food preservation and fresh-keeping effect.

[0007] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0008] The present invention provides a fusion antibacterial polypeptide CLysM, whose amino acid sequence is shown in SEQ ID NO: 1.

[0009] Furthermore, the fusion antibacterial polypeptide CLysM can withstand high temperatures above 80°C and is non-hemolytic.

[0010] Furthermore, the amino acid sequence of the fusion antimicrobial polypeptide CLysM is composed of the amino acid sequence of the cecropin mutant CM1 as shown in SEQ ID NO: 3, the connecting peptide as shown in SEQ ID NO: 4 and the lysozyme mutant LysM1 as shown in SEQ ID NO: 5.

[0011] The present invention also provides a coding gene, which is the coding gene of the fusion antibacterial polypeptide CLysM, and the nucleotide sequence is shown in SEQ ID NO: 2.

[0012] The present invention also provides a recombinant engineering bacterium, which comprises the encoding gene.

[0013] Furthermore, the genetically engineered bacteria are Pichia pastoris, Bacillus subtilis, and Bacillus licheniformis.

[0014] The present invention also provides an antibacterial composite preparation, which is prepared by mixing the spray-dried powder of the fusion antibacterial polypeptide CLysM with the eucommia leaf extract and dissolving the mixture in water.

[0015] Furthermore, the mass ratio of the spray-dried powder of the fusion antibacterial polypeptide CLysM to the eucommia leaf extract is 2 to 5:2.

[0016] Furthermore, the usage amount of the fused antibacterial polypeptide CLysM in the antibacterial composite preparation is 1% of the volume of water.

[0017] The present invention also provides the use of the fusion antibacterial polypeptide CLysM in the preparation of an antibacterial agent.

[0018] Furthermore, the pathogenic bacteria inhibited by the antibacterial agent are Staphylococcus aureus, Clostridium perfringens, Streptococcus agalactiae, Escherichia coli, and Salmonella.

[0019] The present invention also provides the use of the fusion antibacterial polypeptide CLysM or the antibacterial composite preparation in food preservation.

[0020] Furthermore, when used for food preservation and freshness-keeping, the concentration of the fusion antimicrobial polypeptide CLysM or the antimicrobial composite preparation is 1% to 5%.

[0021] Compared with the prior art, the advantages and technical effects of the present invention are:

[0022] 1. The present invention optimizes and mutates the gene codons of cecropin and lysozyme, respectively, obtains mutants with improved enzyme activity and antibacterial activity by screening, and then fuses and expresses the cecropin antibacterial peptide and Bacillus subtilis lysozyme by fusion gene expression, thereby obtaining a fusion antibacterial polypeptide CLysM with significantly improved antibacterial activity, which can withstand high temperatures above 80°C and is non-hemolytic; and has a significant inhibitory effect on Staphylococcus aureus, Clostridium perfringens, Streptococcus agalactiae, Escherichia coli, and Salmonella.

[0023] 2. The present invention compounds the fused antibacterial polypeptide CLysM with Eucommia ulmoides leaf extract into an antibacterial composite preparation. Experimental verification shows that it has a good effect of inhibiting the growth of food bacteria, thereby achieving the purpose of food preservation and freshness preservation, making it have good application prospects in the fields of food and so on. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 These are the PCR results of cecropin, lysozyme and fusion gene, where numbers 1-3 are cecropin, lysozyme and fusion gene, respectively.

[0025] Figure 2 It is a comparison of the antibacterial activity of fused antimicrobial peptides in shake flask fermentation.

[0026] Figure 3 This is the fermentation curve of the fusion antimicrobial peptide in a 15L fermenter.

[0027] Figure 4 It is the result of the heat resistance of the fused antimicrobial peptide.

[0028] Figure 5 This is a fusion antimicrobial peptide hemolytic experiment, in which the first column is the negative control; columns 2-3 are the experimental groups; and column 4 is the positive control. DETAILED DESCRIPTION

[0029] In order to facilitate the understanding of the present invention, the present invention will be described in more comprehensive and detailed manner with reference to the accompanying drawings and embodiments below, but the protection scope of the present invention is not limited to the following specific embodiments.

[0030] The molecular biology experimental methods not specifically described in the following examples can be performed by referring to the specific methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook, or according to the kits and product instructions. The reagents and biological materials used in the specific examples can be obtained from commercial channels unless otherwise specified.

[0031] The culture medium formula used in the present invention is as follows:

[0032] LB medium: 1% tryptone, 0.5% yeast extract, 1% NaCl;

[0033] MD medium: 1.34% YNB, 0.4 mg / L biotin, 2% glucose;

[0034] YPD medium: 1% yeast extract, 2% peptone, 2% glucose;

[0035] BMGY medium: 1% yeast extract, 2% peptone, 100 mmol / L potassium phosphate buffer (pH 6.0), 1.34% YNB, 0.4 mg / L biotin, 1% glycerol;

[0036] BMMY medium: 1% yeast extract, 2% peptone, 100 mmol / L potassium phosphate buffer (pH 6.0), 1.34% YNB, 0.4 mg / L biotin, 1% methanol;

[0037] BSM medium: 26.7 mL 85% phosphoric acid, 0.93 g calcium sulfate dihydrate, 14.9 g magnesium sulfate dihydrate, 4.13 g potassium hydroxide, 18.2 g potassium sulfate, 40 g glycerol, 4.0 mL PMT1.

[0038] When the above culture medium is a solid culture medium, just add 2% agar powder to the original formula.

[0039] Enzyme activity determination: refer to the lysozyme determination method in the "Nanjing Jiancheng-Lysozyme Assay Kit".

[0040] Determination of antibacterial activity: According to the agar diffusion method, Staphylococcus aureus is used as the target bacteria and chlortetracycline antibiotic is used as the reference. An appropriate amount of Staphylococcus aureus is added to the melted warm LB agar medium, poured into a plate, and punched after the plate solidifies. An equal amount of fermentation liquid or antibiotic is added to each well, and the plate is placed in an incubator for static culture until an inhibition zone is produced. The diameter of the inhibition zone is measured and compared with the antibiotic to obtain the corresponding antibacterial titer, that is, the antibacterial activity of the fermentation liquid is equivalent to a few ppm of antibiotics.

[0041] Example 1: Construction and screening of lysozyme mutant genes

[0042] The amino acid sequence of lysozyme from Bacillus subtilis (GenBank: AOR99681.1) was referred to and translated into the corresponding nucleotide sequence, and after the gene sequence was optimized, it was artificially synthesized. The following primers were designed, with an EcoR I restriction enzyme site at the 5' end and a Not I restriction enzyme site at the 3' end.

[0043] Lys-F: CCGGAATTCATGGCTGCCCTGATTTC (SEQ ID NO: 6);

[0044] Lys-R: ATAAGCGGCCGCTTATCTCAAAGTTTGCAACAATTG (SEQ ID NO: 7).

[0045] GeneMorph II random mutagenesis PCR kit was used to perform random mutagenesis using the artificially synthesized gene as a template, and the primer sequences used were Lys-F and Lys-R.

[0046] The amplified random mutation PCR product was double digested with EcoR I and Not I, purified and recovered, and connected to the pET-21a(+) vector, transformed into E. coli BL21-DE3, and the positive clones were screened on an ampicillin-resistant LB plate to obtain pET-LysMx. The synthesized original gene was connected to the pET-21a(+) vector and transformed into E. coli BL21-DE3 in the same way to obtain pET-Lys0.

[0047] The screened single colonies were inoculated into a 96-well deep-well plate. Two single colonies expressing Lys0 were inoculated into each plate as a control. 300uL LB liquid culture medium (containing 100μg / mL ampicillin) was placed in each well, and after shaking and culturing at 37°C and 200rpm for 4 hours, 50uL of bacterial solution was transferred to a new 96-well plate for seed preservation. 200uL LB-Amp culture medium containing IPTG was added to the remaining bacterial solution on the plate, so that the final concentration of IPTG was 1mM and the final concentration of ampicillin was 100μg / mL. The expression of lysozyme was induced by shaking and culturing at 37°C and 200rpm for 10h.

[0048] The induced bacterial solution was repeatedly frozen and thawed to break it, the broken cell solution was centrifuged to obtain the supernatant, and then the activity of lysozyme was detected. The mutant gene with higher enzyme activity than the control was sequenced. After sequencing, the lysozyme mutant LysM1 was obtained, and its amino acid sequence is shown in SEQ ID NO: 5, and its corresponding nucleotide sequence is shown in SEQ ID NO: 8.

[0049] Example 2: Construction and screening of cecropin mutant genes

[0050] The amino acid sequence of cecropin (NCBI PRF: 2018170A) was referred to and translated into the corresponding nucleotide sequence, and the signal peptide sequence was removed and the gene sequence was optimized before artificial synthesis. The following primers were designed, with an EcoR I restriction enzyme site at the 5' end and a Not I restriction enzyme site at the 3' end.

[0051] CF: CCGGAATTCGCTCCAGAACCTAGATG (SEQ ID NO: 9);

[0052] CR: ATAAGCGGCCGCCTTACCAATAGCCTTAGCGCTAC (SEQ ID NO: 10).

[0053] GeneMorph II random mutagenesis PCR kit was used to perform random mutagenesis using the artificially synthesized gene as a template, and the primer sequences used were CF and CR.

[0054] The amplified random mutation PCR product was double digested with EcoR I and Not I, purified and recovered, connected to the pET-21a(+) vector, transformed into E. coli BL21-DE3, and the positive clones were screened on an ampicillin-resistant LB plate to obtain pET-CMx. The synthesized original gene was connected to the pET-21a(+) vector and transformed into E. coli BL21-DE3 in the same way to obtain pET-C0.

[0055] The screened single colonies were inoculated into a 96-well deep-well plate. Two single colonies expressing C0 were inoculated into each plate as controls. 300uL LB liquid culture medium (containing 100μg / mL ampicillin) was placed in each well, and after shaking and culturing at 37°C and 200rpm for 4 hours, 50uL of bacterial solution was transferred to a new 96-well plate for seed preservation. 200uL LB-Amp culture medium containing IPTG was added to the remaining bacterial solution on the plate, so that the final concentration of IPTG was 1mM and the final concentration of ampicillin was 100μg / mL. The expression of lysozyme was induced by shaking and culturing at 37°C and 200rpm for 10h.

[0056] The induced bacterial solution was repeatedly frozen and thawed to break it, the broken cell solution was centrifuged to obtain the supernatant, and then the antibacterial activity of the cecropin antimicrobial peptide was detected. The mutant gene with higher antibacterial activity than the control was sequenced. After sequencing, the mutant CM1 was obtained, and its amino acid sequence is shown in SEQ ID NO: 3, and its corresponding nucleotide sequence is shown in SEQ ID NO: 11.

[0057] Example 3: Construction of fusion antibacterial polypeptide CLysM gene and verification of antibacterial activity

[0058] Referring to the mutants LysM1 and CM1 obtained in Examples 1 and 2, the mutant CM1 was amplified using primers CF and CL1-R, the mutant LysM1 was amplified using primers CL2-F and Lys-R, and the fusion gene CLysM was obtained by overlapping PCR amplification using primers CF and Lys-R. After electrophoresis verification, the results were as follows: Figure 1 As shown, the fusion fragment was successfully constructed.

[0059] The overlapping PCR reaction system is 50μL, without adding primers first, and other conditions are carried out according to the instructions of the corresponding DNA polymerase. The reaction conditions are 2-step cycles: 96℃ pre-denaturation for 5min, 94℃ denaturation for 30sec, 68℃ annealing (extension) for 45sec. After 5 cycles, pause the PCR program, take out the PCR tube, put it on ice, add 2μL upstream primer and 2μL downstream primer, and mix well. 94℃ denaturation for 30sec, 68℃ annealing (extension) for 45sec, cycle 30 times, 72℃, post-extension for 10min, and store at 15℃.

[0060] The primers used are as follows:

[0061] CF: CCGGAATTCGCTCCAGAACCTAGATG (SEQ ID NO: 9);

[0062] CL1-R:AGCCTTAGCGGCAGCTTCCTTAGCGGCAGCTTCGGCCTTACCAATAGCCTTAGCGC (SEQ IDNO: 12);

[0063] CL2-F:GCCGAAGCTGCCGCTAAGGAAGCTGCCGCTAAGGCTATGGCTGCCGCTGATTTCAT (SEQ IDNO: 13);

[0064] Lys-R: ATAAGCGGCCGCTTATCTCAAAGTTTGCAACAATTG (SEQ ID NO: 7).

[0065] The fusion gene CLysM was cloned into the pET-21a(+) vector according to the methods in Examples 1 and 2, and transformed into Escherichia coli BL21-DE3, and shake flask fermentation was performed to verify the antibacterial activity.

[0066] Using Staphylococcus aureus as the target bacteria and chlortetracycline antibiotic as the reference, the supernatant after centrifugation of the fermentation broth was taken to verify its antibacterial activity, and the diameter of the inhibition zone was measured and converted into the corresponding potency.

[0067] The results are as follows Figure 2 As shown, the antibacterial activity of the fused antimicrobial polypeptide CLysM is significantly higher than that of cecropin or lysozyme expressed alone, and its amino acid sequence is shown in SEQ ID NO: 1, and its nucleotide sequence is shown in SEQ ID NO: 2.

[0068] In summary, the amino acid sequence of the fusion antibacterial polypeptide CLysM is divided into three parts. The first segment 1-41 amino acids are the cecropin mutant CM1 as shown in SEQ ID NO: 3, the second segment 42-53 amino acids are the connecting peptide as shown in SEQ ID NO: 4, and the third segment 54-627 amino acids are the lysozyme mutant LysM1 as shown in SEQ ID NO: 5.

[0069] Example 4: Transformation of Pichia pastoris SMD168 with fused antimicrobial polypeptide CLysM

[0070] The fusion antibacterial polypeptide CLysM gene was connected to the pPIC9K plasmid with EcoR I and Not I double restriction sites and transformed into Escherichia coli DH5α to obtain the expression vector pPIC-CLysM, which was sequenced and verified. The positive expression vector was linearized with Sal I and then electrotransformed into Pichia pastoris SMD168. The transformants were screened on the MD plate and transferred to the YPD plate for activation (generally 24-48 transformants were selected). The activated transformants were inoculated in a shake flask for fermentation (each bottle contained 20mL BMGY medium), and after shaking culture at 30°C for 18h, 1% methanol was added for induction, and shaking culture was continued. Thereafter, 1% methanol of the culture volume was added every 24h. After induced expression for 96h, the culture broth was centrifuged to obtain the supernatant, and the average antibacterial activity of the fermentation broth supernatant was determined. Under the conditions of shake flask fermentation, the antibacterial activity of the fusion antibacterial polypeptide CLysM in yeast SMD168 was about 3 times that in Escherichia coli BL21, and the antibacterial activity was further improved.

[0071] Example 5: Fermentation and preparation of fusion antibacterial polypeptide CLysM in a 15L fermenter

[0072] The genetically engineered bacteria fused with the antimicrobial polypeptide CLysM were streaked on YPD plates, cultured at 30°C for 3 days to grow single colonies, and single colonies with good growth were picked and continued to be streaked on YPD plates. The single colonies of Pichia pastoris obtained by activation for three generations were inoculated into 20 mL BMGY medium and cultured at 30°C and 200 rpm for 24 h. 2% of the inoculum was inoculated into 300 mL BMGY medium, cultured at 30°C and 200 rpm until OD600 was 5, and used as seed liquid to inoculate the fermenter. Fermentation production process: BSM culture medium, pH 4.8, temperature 30°C, stirring rate 500rpm, ventilation volume 1.5 (v / v), dissolved oxygen controlled at more than 20%. The fermentation process is divided into three stages: (1) bacterial culture stage: seed liquid is added at a ratio of 8%, and cultured at 30°C for 20 to 24 hours to exhaust the glycerol in the fermentation liquid; (2) starvation stage: when the carbon source glycerol is exhausted, no carbon source is added temporarily, and the starvation stage ends when the dissolved oxygen rises to 80%; (3) induction expression stage: adjust the pH to the required value with ammonia water or phosphoric acid, add methanol for induction, and keep the dissolved oxygen above 20%, and the induction time is 160 to 200 hours; after the fermentation is completed, the fermentation liquid is treated by a plate and frame filter and then spray-dried into a powder preparation through a spray tower for application testing.

[0073] The fermentation process curve is as follows Figure 3 As shown: samples were taken every 8 hours to measure the enzyme production level, and the antibacterial activity reached the highest point after 168 hours of fermentation.

[0074] Example 6: MIC of fusion antimicrobial peptides against common pathogens

[0075] The MIC method was used to determine the antibacterial effect of the fusion antimicrobial peptide CLysM on common pathogenic bacteria. The specific method is as follows.

[0076] Preparation of fusion antimicrobial peptide fermentation broth: CLysM fermentation broth was powdered to a concentration of 0.1 g / mL, and filtered for sterilization. In a clean bench, 100 μL of LB was added to each well of a 96-well plate under aseptic operation. Starting from the first column, 100 μL of 0.1 g / mL CLysM was added to the first column after dilution by 2 times, and then 100 μL was taken from the first column and added to the second column. CLysM was diluted in sequence, and the last column (No. 12) was blank, that is, 100 μL was taken from the 11th column after dilution and discarded.

[0077] Preparation of bacterial suspension: Inoculate the following common pathogens into LB medium, culture overnight, and dilute to a certain multiple for later use. Add to rows CD, E, F, G, and G of a 96-well plate according to the dilution gradient. Add an equal amount of sterile water to rows AB as a control.

[0078] The 96-well plate containing the fusion antibacterial peptide and pathogenic bacteria was cultured in a shaker at a low speed, and the minimum inhibitory concentration was calculated. As shown in the following table, the fusion antibacterial peptide has a good antibacterial effect on Staphylococcus aureus, Clostridium perfringens, Streptococcus agalactiae, Escherichia coli, and Salmonella.

[0079] Table 1: Effects of fusion antimicrobial peptides on pathogenic bacteria

[0080]

[0081]

[0082] The results are shown in Table 1. The fusion antibacterial peptide CLysM has a good antibacterial effect on Gram-positive bacteria such as Staphylococcus aureus, Clostridium perfringens, and Streptococcus agalactiae, as well as Escherichia coli and Salmonella.

[0083] Example 7: Determination of heat resistance of fusion antibacterial polypeptides

[0084] The fusion antibacterial polypeptide enzyme solution (0.1 g / mL) was appropriately diluted for use. 9 mL of sterile water was added to each of 2 test tubes and preheated in a water bath at 80°C and 90°C for 5 minutes respectively. Then 1 mL of enzyme solution was added to each preheated test tube. The time was kept at the same time. Samples were taken every 5 minutes to detect the residual antibacterial activity. The untreated samples were used as a reference.

[0085] After testing, if Figure 4 As shown, the fusion antibacterial peptide CLysM has almost no loss after being kept at 80°C for 25 minutes, and the residual rate is above 80% after being kept at 90°C for 20 minutes, indicating that the fusion antibacterial peptide has good heat resistance, laying a foundation for its industrial application and product promotion.

[0086] Example 8: Determination of hemolytic activity of fusion antibacterial polypeptide

[0087] Preparation of blood cell suspension: Take fresh blood from broilers and immediately add sodium citrate with a final concentration of 1% to mix (anticoagulation), centrifuge at 2000rpm for 10min to collect blood cells, wash the precipitate with an equal volume of 0.9% sodium chloride, centrifuge again at 2000rpm for 10min to remove the supernatant, wash 3 times until the upper solution is clear and has no red color. Resuspend the blood cell solution with 10mM PBS (pH 7.4) and mix it to a final concentration of 2%. Take a clean 96-well plate, add 200μL of blood cell suspension to each well, add 100μL of fermentation liquid of fused antibacterial polypeptide to the experimental group, add 100μL of PBS to the negative control group, and add 100μL of 0.1% Triton X-100 to the positive control group. The above mixture is water bathed at 37℃ for 1 hour, centrifuged at 2000rpm for 10min, and the supernatant is taken to measure the absorbance value at 540nm.

[0088] The results are as follows Figure 5 As shown, only the positive control, i.e., column 4, showed hemolysis, while the fermentation broth containing the fused antimicrobial peptides did not show hemolysis, indicating that it can be safely used in the field of animal breeding.

[0089] Example 9: Preparation of antibacterial composite preparation and its preservation experiment on braised chicken

[0090] The preparation method of Eucommia leaf extract is as follows: extract the Eucommia leaves with water, the extraction temperature is 55-65°C, the extraction time is 2-4h, and then filter, take the filtrate and vacuum concentrate it at 60°C to a specific gravity of 1.2 (the solution concentrated to this specific gravity takes the shortest time to spray dry, because chlorogenic acid decomposes at high temperature, the spray drying time is short, the chlorogenic acid is sprayed dry instantly, there is no loss, and energy is saved), and spray drying in a spray drying tower to obtain the Eucommia leaf extract.

[0091] 60g of eucommia leaf extract and 40g of fused antibacterial polypeptide spray-dried powder were mixed and dissolved in 4L of sterile water to obtain an antibacterial composite preparation, wherein the amount of the fused antibacterial polypeptide added in the antibacterial composite preparation was 1% of the sterile water.

[0092] Fresh braised chickens were purchased and divided into experimental group, extract group and control group, with 3 replicates in each group and 1 braised chicken in each replicate. The braised chickens were unpacked in a clean bench and operated aseptically throughout the process. The control group was soaked in sterile water for 1 hour, the extract group was soaked in an equal amount of 1% Eucommia leaf extract solution for 1 hour, and the experimental group was soaked in an equal amount of antibacterial compound preparation for 1 hour. The two groups of braised chickens were placed in a cool room temperature and covered with 2 layers of gauze. The preservation of the braised chickens was observed every 12 hours. At the same time, a 1cm square of braised chicken skin tissue was taken and added to a test tube containing 5mL of sterile water, shaken, and 200μL was taken for plate coating. The colonies were counted after overnight culture.

[0093] The results are shown in Table 2. After the third day, the number of miscellaneous bacteria in the control group reached more than 2000, while the number of miscellaneous bacteria in the experimental group was still relatively small. Although the Eucommia leaf extract had a certain antibacterial effect, the number of miscellaneous bacteria in the experimental group was significantly lower than that in the extract group, indicating that the use of antibacterial compound preparations can play a good role in the preservation of food.

[0094] Table 2: The results of the antimicrobial compound preparation on the preservation of braised chicken

[0095] Date (day) 1 2 3 4 5 Experimental group CFU / mL 5 15 50 400 1545 Extract group CFU / mL 16 67 1230 2891 6570 Control group CFU / mL 25 100 2075 6480 21090

[0096] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A fusion antibacterial polypeptide CLysM, characterized in that: Its amino acid sequence is shown in SEQ ID NO:

1.

2. A coding gene, characterized in that It is the coding gene of the fusion antibacterial polypeptide CLysM as claimed in claim 1, and the nucleotide sequence is shown in SEQ ID NO:

2.

3. A recombinant engineered bacterium, characterized in that: It comprises the coding gene according to claim 2.

4. An antibacterial composite preparation, characterized in that: The antibacterial composite preparation is prepared by mixing the spray-dried powder of the fusion antibacterial polypeptide CLysM according to claim 1 with an eucommia leaf extract and then dissolving the mixture in water.

5. The antibacterial composite preparation according to claim 4, characterized in that: The mass ratio of the spray-dried powder of the fusion antibacterial polypeptide CLysM to the eucommia leaf extract is 2-5:

2.

6. Use of the fusion antibacterial polypeptide CLysM according to claim 1 in preparing an antibacterial agent, characterized in that: The pathogenic bacteria inhibited by the antibacterial agent are Staphylococcus aureus, Clostridium perfringens, Streptococcus agalactiae, Escherichia coli and Salmonella enteritidis.

7. Use of the fusion antibacterial polypeptide CLysM according to claim 1 or the antibacterial composite preparation according to claim 4 in food preservation.

8. The use according to claim 7, characterized in that: When used for food preservation and freshness keeping, the concentration of the fusion antimicrobial polypeptide CLysM or the antimicrobial composite preparation is 1% to 5%.

Images