A Death Valley Bacillus SSB-10 and its application

Abstract

The present invention provides a Death Valley Bacillus SSB-10 and its application, which belongs to the field of microorganisms and biological control technology. Death Valley Bacillus SSB-10 has been deposited in the China Center for Type Culture Collection on July 8, 2022, with a deposit number of CCTCC NO: M20221063. The antibacterial substance produced by the SSB-10 strain has a significant inhibitory effect on the activity of Ralstonia solanacearum, and can be used to prevent and treat plant bacterial wilt caused by Ralstonia solanacearum. The SSB-10 strain is used to prevent and treat tobacco bacterial wilt, and the prevention effect reaches 70%.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and biological control, and specifically relates to a Death Valley Bacillus SSB-10 and an application thereof. Background Art

[0002] Tobacco bacterial wilt is a soil-borne bacterial disease caused by infection with Ralstonia solanacearum. The disease has a high incidence and mortality rate in tobacco fields in my country, which has a great impact on tobacco yield and quality, causing huge economic losses. Due to the increasing prominence of environmental safety issues and the continuous emergence of drug resistance, the use of chemical pesticides has been increasingly restricted, and the research focus on tobacco bacterial wilt has gradually shifted to biological control. The mechanism of action of microbial control of bacterial wilt is mainly to utilize the mutual antagonism and competition between microorganisms. There are many kinds of microorganisms in nature, which provide rich microbial resources for the biological control of bacterial wilt.

[0003] At present, the microorganisms used for the prevention and control of tobacco bacterial wilt mainly include endophytes and rhizosphere soil microorganisms. Commonly used rhizosphere soil microorganisms mainly include Bacillus, Pseudomonas, Actinomycetes, etc. Commonly used Bacillus include Bacillus subtilis, Bacillus megaterium, Bacillus cereus, Bacillus polymyxa, Bacillus pumilus and Bacillus amyloliquefaciens. For example, Yang Huan disclosed in "Screening, Identification and Application Evaluation of Tobacco Bacterial Wilt Biocontrol Strains" that a strain of Bacillus amyloliquefaciens YH-22 was screened out using a plate confrontation test, which can effectively colonize the roots and stems of tobacco, and in field tests, during the high incidence period of tobacco bacterial wilt, it showed a better prevention effect than chemical agents. Wang Anan et al. disclosed in "Effect of K1, K2 Anti-bacterial agents on tobacco Ralstonia solanacearum" (Engineering, 2010, 02 (11): 930-934) that two strains of bacteria, K1 and K2, were screened out, which could significantly inhibit the growth of Ralstonia solanacearum at low concentrations and cause damage to the bacteria. In addition, they could also effectively reduce the probability of young tobacco being infected with bacterial wilt. Liu Yanxia et al. disclosed in "Tobacco bacterial wilt can be biologically controlled by the application of antagonistic strains in combination with organic fertilizer" that Bacillus brevis and Streptomyces rocheri, which were effective in antagonizing Ralstonia solanacearum, were separated from tobacco roots using an in vitro confrontation test. In subsequent pot tests and field tests, the control effects of these strains, when mixed with organic fertilizers, could reach 92.3%-100.0%. Chinese patent CN111117936B discloses that a strain of Bacillus amyloliquefaciens TBA03 was screened from the rhizosphere soil of flue-cured tobacco strain K326, which can significantly inhibit the growth of Ralstonia solanacearum pathogen and reduce the harm of tobacco bacterial wilt. However, there is no relevant report on the antibacterial activity of Bacillus death valley against Ralstonia solanacearum. Summary of the invention

[0004] In the present invention, multiple bacteria are separated from the rhizosphere soil of tobacco plants, and a Bacillus vallismortis SSB-10 is screened out through an antagonistic experiment against Ralstonia solanacearum. The fermentation product of the strain is diluted with water and applied to the roots of tobacco plants. The results show that the strain has a good control effect on tobacco bacterial wilt.

[0005] Specifically, the present invention collects rhizosphere soil from tobacco fields in Shuijing'ao Village, Jiaoyuan Town, Xuan'en County, Enshi Prefecture, Hubei Province, and applies soil microbial suspension on TSB medium by dilution and coating method for bacterial culture and separation, and screens Ralstonia solanacearum by plate test to obtain strain SSB-10 with significant antibacterial activity against Ralstonia solanacearum, which is then identified as Bacillus vallismortis by 16S rDNA sequence identification. The SSB-10 strain has been deposited in the China Center for Type Culture Collection on July 8, 2022, address: Wuhan University, Wuhan, China, with a deposit number of CCTCC NO: M20221063.

[0006] The method for screening Death Valley Bacillus SSB-10 in the present invention comprises the following steps:

[0007] S1. Bacterial screening

[0008] Tobacco rhizosphere soil was collected from tobacco fields in Shuijing'ao Village, Jiaoyuan Town, Xuanen County, Enshi Prefecture, Hubei Province, and placed in a sterile container containing several small glass beads to prepare a 10 wt % soil suspension. The soil suspension was then diluted with sterile water to prepare a concentration gradient of 10 -2 , 10 -3 , 10 -4 of soil suspension; take 10 -2 , 10 -3 , 10 -4 The soil suspension was spread on TSB plates and cultured at 28°C for 5 days, and single colonies on the plates were picked and preserved; the main components of TSB plate culture medium included 17.0 g / L tryptone, 3.0 g / L soybean papain hydrolysate, 5.0 g / L sodium chloride, 2.5 g / L glucose monohydrate, 2.5 g / L potassium hydrogen phosphate, and 15 g / L agar powder;

[0009] S2. Screening of antagonistic bacteria against Ralstonia solanacearum

[0010] The single colony in step S1 was inoculated to the center of the PDA plate, and the plate was inverted and placed in a 28°C incubator for 3 days; then the Ralstonia solanacearum cultured to the logarithmic phase was sprayed onto the plate where the bacteria had grown, and the plate was cultured at 28°C for 24 hours to select bacteria with significant antibacterial activity against Ralstonia solanacearum; the main components of the PDA plate culture medium included 200 g / L potato, 20 g / L glucose, and 15 g / L agar powder;

[0011] S3. Bacterial Identification

[0012] The bacteria with significant antibacterial activity against Ralstonia solanacearum obtained in step S2 are cultured in liquid, the genomic DNA of the bacteria is extracted, PCR amplification is performed with 16S rDNA universal primers, and the amplified DNA fragments are sequenced to obtain the 16S rDNA sequence of the bacteria as shown in SEQ ID No. 1; the 16S rDNA sequence is compared in the NCBI database by Blast, and a phylogenetic tree is constructed with related sequences with a high matching degree in the Ezbiocloud database, and it is determined to be Bacillus death valley. The main components of the liquid culture medium contain 20g / L soluble starch, 1g / L potassium nitrate, 0.5g / L potassium dihydrogen phosphate, 0.5g / L sodium chloride, 0.01g / L ferrous sulfate heptahydrate, 15g / L agar powder, and the pH is 7.4.

[0013] The antibacterial substance produced by the SSB-10 strain screened by the present invention has been confirmed by temperature adaptability test and acid-base stability test to have strong environmental temperature adaptability and acid-base stability, and has the activity of inhibiting Ralstonia solanacearum when treated for different time in the range of -20°C to 115°C, and has the activity of inhibiting Ralstonia solanacearum when treated for 16h in the range of pH=1.0 to 14.0. This shows that under the extreme environment beyond the survival conditions of bacteria, although the vegetative cells of the SSB-10 strain may die, the antibacterial substance produced by it is still active.

[0014] Preferably, the antibacterial substance produced by the SSB-10 strain has significant activity in inhibiting Ralstonia solanacearum when treated at 50-100°C for 60 minutes; and has significant activity in inhibiting Ralstonia solanacearum when treated at pH=3.0-9.0 for 16 hours.

[0015] The SSB-10 strain screened by the present invention has been successfully used to prevent and control tobacco bacterial wilt, and the specific method is as follows:

[0016] The SSB-10 strain was fermented and the fermentation culture was diluted with water to prepare a strain concentration of 1×10 8 CFU / mL of bacterial solution; when transplanting tobacco seedlings in the field, 200 mL of the antibacterial solution is irrigated into the roots of each tobacco seedling.

[0017] Preferably, the method for fermentation culture of SSB-10 strain comprises the following steps:

[0018] Take Death Valley Bacillus SSB-10 and streak it on LB plate, and culture it at 37℃ overnight; pick a single colony of fresh streaked bacteria, inoculate it into 5mL LB liquid medium, and culture it overnight at 37℃ and 180r / min; take 5mL of bacterial liquid and inoculate it into 300g solid medium, shake it thoroughly to mix it, and culture it at 37℃ for 7-9d. Among them, the main components of LB plate medium include 5g / L yeast powder, 10g / L peptone, 10g / L sodium chloride, 15g / L agar powder, and the pH is 7.2; the main components of LB liquid medium include 5g / L yeast powder, 10g / L peptone, 10g / L sodium chloride, and the pH is 7.2; the main components of solid medium include 40g / L brown sugar, 1000g / L vermiculite, and 1000g / L corn starch.

[0019] In order to facilitate storage and use, the Death Valley Bacillus SSB-10 or its fermentation product can be prepared into a bacterial agent, which can be used directly when needed without further fermentation and cultivation.

[0020] The beneficial effects of the present invention are as follows: the Death Valley Bacillus SSB-10 obtained by the present invention has significant antibacterial activity against Ralstonia solanacearum, can be used to prevent and treat plant bacterial wilt caused by Ralstonia solanacearum, and especially has a good preventive effect for preventing and treating tobacco bacterial wilt. The antibacterial substance produced by the fermentation of the SSB-10 strain is diluted into a 30wt% antibacterial liquid, which is used for the prevention and treatment of tobacco bacterial wilt in the field, and the preventive effect reaches 70%. The SSB-10 strain also has strong temperature adaptability and acid-base stability, and can be applied to different climates and soil environments for plant cultivation. The successful prevention and treatment of tobacco bacterial wilt by the SSB-10 strain not only has no environmental pollution, reduces the use of chemical pesticides, but also provides more options for the prevention and treatment of plant bacterial wilt caused by Ralstonia solanacearum. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 A comparison of the antibacterial activities of the bacteria SSB-10 screened by the present invention, Agrobacterium SSB-11, Acinetobacter SSB-12, and Bacillus amyloliquefaciens WH-1 against Ralstonia solanacearum;

[0022] Figure 2 Phylogenetic tree of the bacterium SSB-10 screened for the present invention;

[0023] Figure 3 A single colony morphology diagram of the bacterium SSB-10 screened in the present invention;

[0024] Figure 4 The cell morphology of the bacteria SSB-10 screened in the present invention;

[0025] Figure 5This is a comparison chart of the antibacterial activity of the fermentation broth of the bacteria SSB-10 screened by the present invention against Ralstonia solanacearum after being treated at different temperatures;

[0026] Figure 6 This is a comparison chart of the antibacterial activity of the fermentation broth of the bacteria SSB-10 screened in the present invention against Ralstonia solanacearum after being treated with acids and alkalis at different pH values. DETAILED DESCRIPTION

[0027] The following is a clear and complete description of the technical solution of the present invention in conjunction with the embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present invention. Any equivalent transformation or substitution made by those skilled in the art based on the following implementation methods belongs to the protection scope of the present invention.

[0028] Example 1

[0029] This embodiment provides a method for screening Death Valley Bacillus SSB-10, which specifically comprises the following steps:

[0030] S1. Bacterial screening

[0031] Tobacco rhizosphere soil was collected from tobacco fields in Shuijing'ao Village, Jiaoyuan Town, Xuanen County, Enshi Prefecture, Hubei Province (E109.3736°E, N29.9645°N). 5 g of soil sample was weighed and placed in a 150 mL sterile triangular flask containing 15 to 20 small glass beads. 45 mL of sterile water was added and the triangular flask was shaken at room temperature for 20 min. The resulting soil suspension was 10 -1 Dilution gradient soil infusion; then use a 1mL sterile pipette to draw 1mL 10 -1 Add the diluted solution into a test tube containing 9 mL of sterile water, pipette and aspirate 3 times to mix the soil infusion evenly. -2 dilution; and so on, prepare 10 -3 , 10 -4 Dilution, take 100 μL of 10 -2 , 10 -3 , 10 -4 The soil extract was evenly applied on TSB medium (17.0 g / L tryptone, 3.0 g / L soybean papain hydrolysate, 5.0 g / L sodium chloride, 2.5 g / L glucose monohydrate, 2.5 g / L potassium hydrogen phosphate, 15 g / L agar powder) plates with a spreading rod; all plates were placed for 20 minutes, then the culture plates were turned over and cultured at 28°C for 5 days; single colonies on the plates were picked and preserved.

[0032] S2. Screening of antagonistic bacteria against Ralstonia solanacearum

[0033] The plate spray method was used to screen bacteria with antagonistic effects on Ralstonia solanacearum. The single bacterial colony obtained in step S1 was inoculated to the center of the PDA (200 g / L potato, 20 g / L glucose, 15 g / L agar powder) plate, inverted and placed in a 28°C incubator for 3 days; the single colony of Ralstonia solanacearum was inoculated into LB medium and cultured in a 37°C incubator for 36 hours, and then the Ralstonia solanacearum cultured to the logarithmic phase was sprayed onto the plate where the bacteria had grown, and the plate was inverted and placed in a 28°C incubator. After 24 hours, the diameter of the inhibition zone was observed. The results are as follows: Figure 1 shown. Figure 1 The larger the inhibition zone, the better the antibacterial effect. It can be seen from the figure that Agrobacterium SSB-11 and Acinetobacter SSB-12 have no antibacterial activity against Ralstonia solanacearum. The bacterial strain obtained in step S1 is resistant to Ralstonia solanacearum and shows an obvious inhibition zone (inhibition zone diameter is 26 mm). The activity of Bacillus amyloliquefaciens WH-1 against Ralstonia solanacearum (inhibition zone diameter is 24 mm) is slightly lower than that of the bacterial strain obtained in step S1. The Ralstonia solanacearum, Agrobacterium SSB-11, Acinetobacter SSB-12, and Bacillus amyloliquefaciens WH-1 used were isolated from tobacco rhizosphere soil by Teacher Zhao Xiuyun of Huazhong Agricultural University in the early stage of the experiment.

[0034] S3. Bacterial Identification

[0035] The bacteria with significant antibacterial activity against Ralstonia solanacearum in step S2 were subjected to 16S rDNA sequence identification and morphological identification. The bacteria with significant antibacterial activity against Ralstonia solanacearum in step S2 were cultured in Gao's No. 1 liquid medium (20 g / L soluble starch, 1 g / L potassium nitrate, 0.5 g / L potassium hydrogen phosphate, 0.5 g / L sodium chloride, 0.01 g / L ferrous sulfate heptahydrate, 15 g / L agar powder, pH 7.4) for 48 hours; the genomic DNA of the bacteria was extracted using a bacterial genomic DNA extraction kit (TIANampbacteria DNAkit, Tiangen Biochemical Technology (Beijing) Co., Ltd.), and PCR amplification was performed using universal primers for 16S rDNA (primer F: AAGGAGGTGATCCAGCCGCA; primer R: AGAGTTTGATCCTGGCTCAG, synthesized by Beijing Aoke Biotechnology Co., Ltd.), and the PCR reaction system was: 19 μL of double distilled water, 10×PCR buffer (Mg 2+15mM) 2.5μL, forward and reverse primers 1μL each, dNTP 1μL, Taq enzyme 0.5μL; PCR reaction program: 94℃3min; 30 cycles of 94℃30s, 55℃30s, 72℃2min; finally 72℃10min; the amplified product was analyzed by electrophoresis on 0.8% agarose gel, and a DNA fragment of about 1.5kb was successfully amplified, and sequence determination was performed by Beijing Aoke Biotechnology Co., Ltd. to obtain the 16S rDNA sequence of the bacterium as shown in SEQ ID No.1; the 16SrDNA sequence was compared and analyzed by Blast in the NCBI database, and a phylogenetic tree was constructed with related sequences with a high matching degree in the Ezbiocloud database (see Figure 2 ), identified as Bacillus vallismortis, and named SSB-10. Figure 2 It can be seen that the 16S rDNA sequence homology between the SSB-10 strain and the Death Valley Bacillus DSM11031 strain is 100%. The single colony morphology of Death Valley Bacillus SSB-10 is shown in the attached Figure 3 ,Depend on Figure 3 It can be seen that the colony morphology is white, opaque, with irregular edges, dry surface, wrinkles, a circular protrusion in the middle, and flat. Figure 4 ,Depend on Figure 4 It can be seen that the single cell morphology of SSB-10 is rod-shaped, the size is 0.9μm×2.0μm, and spores are produced. The Death Valley Bacillus SSB-10 has been deposited in the China Center for Type Culture Collection on July 8, 2022, with the deposit number CCTCC NO: M20221063.

[0036] In this example, the thermal stability and acid-base stability of the antibacterial substance produced by the above-screened Bacillus vallismortis SSB-10 were also tested, and the specific method is as follows:

[0037] (1) Thermal stability

[0038] Pick the freshly streaked Death Valley Bacillus SSB-10 strain and place it in 5mL LB liquid culture medium, activate it overnight at 37℃ and 180rpm; then inoculate it into 100mL LB liquid culture medium with 1% inoculum, and culture it at 37℃ and 180rpm for 48h; centrifuge it at 4℃ and 8000rpm, take the supernatant fermentation liquid, filter and sterilize it as antibacterial liquid. Take the antibacterial liquid in a 1.5mL sterile centrifuge tube, prepare 7 copies of the same sample, 6 of which are treated at -20℃ for 12h, heated in a water bath at 50℃, 60℃, 70℃, 80℃, 90℃, and 100℃ for 60min, and treated at 115℃ for 10min, and the untreated sample is used as the control group. Set up 3 replicates for each treatment group and control group.

[0039] Inoculate Ralstonia solanacearum into LB liquid medium (5g / L yeast powder, 10g / L peptone, 10g / L sodium chloride, pH 7.2), culture overnight at 28°C and 180r / min, add to LB solid medium (5g / L yeast powder, 10g / L peptone, 10g / L sodium chloride, 15g / L agar powder, pH 7.2) cooled to 40°C-55°C at a ratio of 1v / v%, mix well, and pour into plates. Using the Oxford cup method, place 4 sterile Oxford cups on each plate, add 50μL of the above sterile antibacterial solution treated at different temperatures to each Oxford cup, culture at 28°C for 2-3 days, observe and measure the size of the antibacterial zone, and the results are as follows: Figure 5 shown. Figure 5 CK in the middle represents the control group. Figure 5 It can be seen that with the increase of treatment temperature, the antibacterial effect of the fermentation broth of Death Valley Bacillus SSB-10 on Ralstonia solanacearum gradually decreases, and both lower temperature (-20℃) and higher temperature (115℃) inhibit the activity of antibacterial substances, which is significantly different from the control group, but does not cause complete inactivation; overall, the antibacterial substances produced by Death Valley Bacillus SSB-10 have good thermal stability.

[0040] (2) Acid-base stability

[0041] Treatment group: The antibacterial solution was adjusted to pH 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, and 14.0 with 1 mol / L hydrochloric acid and 1 mol / L sodium hydroxide, respectively. After standing for 16 h, the pH was adjusted to 7.0 and filtered for sterilization.

[0042] Control group: The untreated samples were used as the control group;

[0043] Three replicates were set for each treatment group and control group.

[0044] Ralstonia solanacearum was inoculated into LB liquid medium, cultured overnight at 28℃ and 180r / min, then added to LB solid medium cooled to about 40℃~55℃ at a ratio of 1% (v / v), mixed evenly, and poured into plates. Using the Oxford cup method, 4 sterile Oxford cups were placed on each plate, and 50μL of the above sterile antibacterial solution with different pH values ​​was added to each Oxford cup. The plates were cultured at 28℃ for 2~3 days, and the size of the antibacterial zone was observed and measured. The results are as follows: Figure 6 shown. Figure 6 CK in the middle represents the control group. Figure 6 It can be seen that after the antibacterial solution with pH of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0 was left standing for 16 hours, the resistance of the fermentation broth of Death Valley Bacillus SSB-10 to Ralstonia solanacearum did not decrease significantly. After the antibacterial solution with pH>9.0 or pH<3.0 was left standing for 16 hours, the resistance of the fermentation broth of Death Valley Bacillus SSB-10 to Ralstonia solanacearum decreased significantly, decreasing to between 0.8cm-1.0cm, but was not completely inactivated. Overall, the inhibitory substances produced by Death Valley Bacillus SSB-10 that antagonize Ralstonia solanacearum have good acid-base adaptability.

[0045] Application Examples

[0046] A field experiment for preventing and controlling tobacco bacterial wilt was carried out using Bacillus vallismortis SSB-10 selected in the example. The experiment was conducted in a tobacco field in Xiaoguan Town, Xuanen County, Enshi Prefecture, Hubei Province.

[0047] 1. Fermentation culture of Death Valley Bacillus SSB-10

[0048] Take Death Valley Bacillus SSB-10 and streak it on LB plate, and culture it at 37℃ overnight; pick a single colony of the freshly streaked bacteria, inoculate it into 5mL LB liquid culture medium, and culture it overnight at 37℃ and 180r / min; take 5mL of bacterial liquid and inoculate it into 300g solid culture medium (2g brown sugar dissolved in 50mL distilled water, add 50g vermiculite and 50g corn starch, and stir evenly), shake it thoroughly to mix, and culture it at 37℃ for 7-9d.

[0049] 2. Field control effectiveness test

[0050] Tobacco fields with a history of bacterial wilt were selected and a regional comparative test was conducted. The test variety was Yunyan 87.

[0051] Take 300g of the fermentation culture of Death Valley Bacillus SSB-10 and dilute it to 10L with water to prepare a bacterial solution. The number of effective live bacteria in the bacterial solution is 1×10 8CFU / mL; 50 tobacco seedlings were treated in each treatment, and 200mL of bacterial solution was irrigated to the roots of each tobacco seedling, and applied when the tobacco seedlings were transplanted in the field. Clean water was used in the same way as the control group CK1, and 72% streptomycin sulfate was diluted 1000 times with clean water (purchased from Hebei Sannong Agricultural Chemical Co., Ltd.) as the agent control group CK2. After 2 months of irrigation treatment, the incidence of bacterial wilt in each treatment was investigated, and the incidence rate, disease index, and control effect were calculated. The results are shown in Table 1. It can be seen from Table 1 that the Death Valley Bacillus SSB-10 bacterial agent has a significant preventive effect on bacterial wilt, with a preventive effect of 70%, which significantly reduces the incidence rate and disease index of tobacco bacterial wilt.

[0052] Table 1 The efficacy of Bacillus vallismortis SSB-10 against tobacco bacterial wilt

[0053]

[0054]

[0055] In Table 1, the incidence rate = (number of diseased plants / total number of plants investigated) × 100%, the disease index = ∑ [(number of diseased plants at each level × the disease level index) / (total number of plants investigated × the highest level index)] × 100, and the prevention effect = (disease index of the control group - disease index of the treated area) / disease index of the control group × 100%.

[0056] Bacterial wilt survey grading standards (in units):

[0057] Level 0: The whole plant is disease-free;

[0058] Level 1: There are occasional chlorotic spots on the stem, or less than half of the leaves on the diseased side wilt;

[0059] Level 3: There are black streaks on the stem, but not exceeding half of the stem height, or one-half to two-thirds of the leaves on the diseased side wilt;

[0060] Level 5: The black streaks on the stem exceed half of the stem height but do not reach the top of the stem, or more than two-thirds of the leaves on the diseased side wilt;

[0061] Level 7: Black streaks on the stem reach the top of the stem, or all leaves of the diseased plant wilt;

[0062] Level 9: The diseased plants are basically dead.

[0063] As can be seen from Table 1, compared with the control group CK1 without any control measures, the death valley bacillus SSB-10 extracted in the present invention has a control effect of 70.00% on tobacco bacterial wilt, and compared with the traditional pesticide control method, the control effect is increased by 68.22 percentage points.

[0064] The above description is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. For any person skilled in the art, the present invention may have various changes and modifications. Any simple equivalent changes and modifications made according to the scope of protection of the present invention and the contents of the specification should be included in the scope of protection of the present invention.

Claims

1. A strain of Death Valley Bacillus SSB-10, characterized in that The death valley bacillus ( Bacillus vallismortis )SSB-10 was deposited in the China Center for Type Culture Collection on July 8, 2022, with the deposit number CCTCC NO: M20221063.

2. A microbial agent containing the Death Valley Bacillus SSB-10 according to claim 1.

3. The Bacillus of Death Valley SSB-10 according to claim 1 or the microbial agent according to claim 2 is effective in preventing and controlling Ralstonia solanacearum ( Ralstonia solanacearum ) in applications.

4. The use according to claim 3, characterized in that: The death valley bacillus SSB-10 or the microbial agent is used to prevent and control tobacco bacterial wilt caused by Ralstonia solanacearum.

5. The use according to claim 4, characterized in that: The method for using the Death Valley Bacillus SSB-10 to prevent and treat tobacco bacterial wilt is as follows: The Death Valley Bacillus SSB-10 was fermented to obtain a fermentation broth, and the fermentation broth was diluted with water to prepare a broth containing 1×10 8 CFU / mL of bacterial solution; when transplanting tobacco seedlings in the field, 200 mL of the bacterial solution was irrigated into the roots of each tobacco seedling.

6. The use according to claim 5, characterized in that: The method for fermenting and culturing the Death Valley Bacillus SSB-10 comprises the following steps: streaking the Death Valley Bacillus SSB-10 on an LB plate and culturing overnight at 37°C; picking a single colony of the freshly streaked strain, inoculating it in an LB liquid culture medium, and culturing it overnight at 37°C and 180 r / min; inoculating the bacterial liquid in a solid culture medium, fully mixing it, and culturing it at 37°C for 7 to 9 days; the main components of the solid culture medium, based on the volume of the added water, include 40g / L brown sugar, 1000g / L vermiculite, and 1000g / L corn starch.

Images