Preparation method and application of a biosensor based on graphene oxide and fluorescent carbon dot-functionalized DNA
By functionalizing DNA with graphene oxide, quenching fluorescence and chain replacement reactions, the stability and biocompatibility problems of traditional fluorescent biosensors are solved, and high sensitivity detection of miRNA let-7a is achieved, suitable for early cancer diagnosis and clinical analysis.
Patent Information
- Application Number
- CN202210985650.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-08-16
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2042-08-16
AI Technical Summary
In traditional fluorescent biosensors, the fluorescent luminescence performance of heavy metal quantum dots and organic dyes is unstable, has low fluorescence yield, is easy to photobleach, has low biocompatibility, is large in cytotoxicity, is high in synthesis cost, and is complex in the process, making it difficult to achieve high sensitivity and selective miRNA detection.
The fluorescent carbon dot functionalized DNA is used, combined with graphene oxide quenching fluorescence and chain displacement reaction, and signal cycle amplification is achieved through fluorescence resonance energy transfer. It is simple to prepare, has high biocompatibility, low cytotoxicity, and is easy to detect and operate.
The rapid, sensitive and quantitative detection of miRNA let-7a is achieved, with good sensitivity and selectivity, and is suitable for early cancer diagnosis and clinical analysis.
Smart Images

Figure CN115980008B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biosensors, and specifically relates to a biosensor for detecting miRNA let-7a by using fluorescent carbon dot-functionalized Fuel DNA as an energy donor and a molecular recognition probe, graphene oxide as an acceptor for resonance energy transfer and a fluorescence quencher, and realizing signal cycle amplification and detection of fluorescence recovery intensity change by using a strand displacement reaction, and a preparation method and application thereof. Background Art
[0002] Nucleic acids are a class of biological macromolecules with a relative molecular mass that can reach hundreds of thousands or even millions. The basic unit of nucleic acids is nucleotides, which are composed of a nitrogen-containing base, a molecule of phosphoric acid, and a molecule of pentose sugar. According to the different pentose sugars of the nucleotides that make up nucleic acids, nucleic acids can be divided into deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). They carry and transmit important life genetic information and play important roles in cell proliferation, differentiation, apoptosis, and metabolism. Abnormal expression of nucleic acid substances often causes some genetic diseases, gene defects, and cancers, etc. Detecting the abnormal expression of some cancer-related genes at the cellular level earlier can help people understand the pathogenic mechanism of cancer more deeply. Therefore, the detection of miRNA is of great significance for biological research and disease diagnosis.
[0003] Biosensors have biological recognition and detection functions and are mainly composed of a biological recognition unit and a signal converter. The signal converter converts the signal generated between the target and the biological recognition element into a signal that is easier to read out, and after signal amplification, signal processing and other conversion processes, it is finally output in the form of a measurable electrical signal and further read out by a signal detector, so as to realize the sensitive detection of biological active units such as enzymes, antibodies, nucleic acids, and cells. Fluorescent biosensors have become a research hotspot among biosensors because of their high sensitivity, non-destructiveness to samples, simple operation, and fast signal response speed. Fluorescent substances are the basis of fluorescent biosensors. The fluorescent substances in traditional fluorescent biosensors are mainly some inorganic semiconductor quantum dots and organic small molecule fluorescent substances, but their poor water solubility and high biological toxicity in actual applications often limit their development. Emerging fluorescent biosensors tend to use some new fluorescent nanomaterials with good biocompatibility, green non-toxicity, and simple preparation, such as carbon quantum dots and metal nanoclusters, to expand their application fields.
[0004] Graphene oxide (GO), a two-dimensional honeycomb carbon material, has attracted widespread attention due to its excellent dispersibility in water, ease of synthesis, good colloidal stability, and good biocompatibility. Another advantage of GO is its very large surface area to volume ratio, which allows it to interact with many biomolecules, such as certain nucleic acids, proteins, metal ions, and small molecules.
[0005] Carbon dots (CDs), a newly emerging nanomaterial following fullerenes, carbon nanotubes, and graphene, are nearly spherical, zero-dimensional nanomaterials. Due to their stable optical properties, good water solubility, low cytotoxicity, and excellent biocompatibility, CDs have been widely used in applications such as metal ion detection, photocatalysis, and cell imaging. Specific surface modifications can be made to obtain CDs with varying fluorescence yields and luminescence properties. CDs are typically synthesized via either top-down or bottom-up approaches. However, most top-down approaches have drawbacks, such as expensive equipment, demanding synthesis conditions, and cumbersome processes, which increase the cost of large-scale CD production. In contrast, bottom-up approaches, such as the commonly used microwave and hydrothermal methods, are simpler, more cost-effective, and environmentally friendly, making them amenable to large-scale production. Low-toxicity CDs overcome some of the shortcomings of traditional quantum dots and are widely used in bioimaging and drug delivery, making them the most promising fluorescent nanomaterials for disease detection. Summary of the Invention
[0006] The present invention constructs a method for preparing a biosensor based on graphene oxide and fluorescent carbon dots functionalized DNA, and uses it in the biomedical field. In order to solve the problems of some traditional heavy metal-based quantum dots and organic dyes, such as unstable fluorescence performance, low fluorescence yield, easy photobleaching, low biocompatibility, high cytotoxicity, high synthesis cost, and complex process, the present invention provides a method for synthesizing carbon dots with stable fluorescence performance, high fluorescence yield, not easy photobleaching, high biocompatibility, low cytotoxicity, low synthesis cost, and simple process. The method functionalizes the carbon dots at the end of single-stranded DNA, combines graphene oxide to quench fluorescence and chain displacement reaction to achieve signal cyclic amplification and fluorescence recovery intensity change, and is actually applied to the quantitative detection of miRNA let-7a.
[0007] The present invention synthesizes fluorescent carbon dots (CDs) using citric acid as a raw material, and replaces traditional small-molecule fluorescent dyes for functional modification at the end of Fuel single-stranded DNA. Based on GO quenching fluorescence and two strand displacement reactions (TSDRs), a miRNA let-7a detection system is established. The Fuel DNA labeled with CDs serves as an energy donor and a molecular recognition probe, and GO serves as a fluorescence resonance energy transfer (FRET) acceptor and a fluorescence quencher. When the target miRNA let-7a is present, two TSDRs are triggered in sequence, the target can be recycled, and a large amount of adsorbed Fuel DNA (modified with CDs) is desorbed from the surface of GO, and the fluorescence of CDs is restored. The fluorescence recovery value is proportional to the concentration of miRNA let-7a. Compared with traditional organic dye-labeled DNA, the probe synthesized by labeling DNA with CDs has stronger biocompatibility and lower toxicity. This method has good sensitivity and selectivity for the detection of miRNA let-7a. This method is easy to operate, provides a new idea for the detection of miRNA let-7a, and has great application potential in early cancer diagnosis and clinical analysis.
[0008] The present invention is realized through the following technical solutions:
[0009] A preparation method of a fluorescent biosensor for detecting miRNA let-7a, including probes: RecognitionDNA, Hairpin DNA, Fuel DNA, miRNA let-7a, composite probe dsDNA-AuNPs;
[0010] The composite probe dsDNA-AuNPs is formed by connecting Recognition DNA to gold nanoparticles through gold-sulfur bonds and then hybridizing with Hairpin DNA to form a double strand;
[0011] The base sequences used are as follows:
[0012] The base sequence of Recognition DNA is shown in SEQ No.1; specifically: 5’-(SH)-AAAAAAAAAAACTATACAACCTACTACCTCATAGGTAC-3’;
[0013] The base sequence of Hairpin DNA is shown in SEQ No.2; specifically: 5’-ACAACCTATGAGGTAGTAGGTTGT-3’;
[0014] The base sequence of Fuel DNA is shown in SEQ No. 3; specifically: 5’-NH2--G*T*A*CCTATGAGGTAGTAGGT*T*G*-3’; (*: phosphorothioate bonds). The base sequence of miRNA let-7a is shown in SEQ No. 4; specifically: 5’-UGAGGUAGUAGGUUGUAUAGUU-3’.
[0015] The preparation method of the above biosensor includes the following steps:
[0016] (1) Prepare a homogeneous solution of GO by ultrasonic dispersion;
[0017] (2) Prepare a dsDNA-AuNPs fluorescent probe using Recognition DNA, Hairpin DNA, and AuNPs;
[0018] (3) Prepare fluorescent carbon dots (CDs) by hydrothermal method, and dehydrate and condense the carboxyl group-modified carbon dots on the surface and the amino group-terminated Fuel DNA together to form a Fuel DNA-CDs complex;
[0019] (4) Add the Fuel DNA-CDs solution to the GO solution for a fluorescence quenching reaction;
[0020] (5) After complete fluorescence quenching, add dsDNA-AuNPs and miRNA let-7a, and perform two strand displacement reactions to detect the fluorescence recovery value.
[0021] The process of step (1) is as follows: Add 5 - 30 mg of GO flakes to 5 - 30 mL of deionized water, and then place the solution in an ice bath and ultrasonically treat it for 1 - 4 h; finally, collect a uniform GO yellowish-brown solution and store it at room temperature for further use.
[0022] The preparation of the dsDNA-AuNPs fluorescent probe in step (2) is as follows: the thiol-modified oligonucleotide recognition DNA is reduced with TCEP at a molar ratio of (1-5): (100-500) for 0.5-3 hours to prevent the formation of disulfide bonds; then the recognition DNA and hairpin DNA (HP DNA) are mixed in a phosphate buffer at a molar ratio of (1-3): (1.2-3.6); the mixture is heated to 60-80°C for 5-20 minutes and slowly cooled to room temperature to hybridize to obtain dsDNA; 10-30 nM AuNPs solution is added to the mixture; the mixture solution is then treated at room temperature overnight, the solution is centrifuged at a speed of 10,000-14,000 rpm / min for 10-30 minutes, and the supernatant is skimmed to remove unbound AuNPs. s Finally, the resulting solution was washed twice and stored in PBS solution at 0-10°C in the dark.
[0023] The process of step (3) is as follows: 1-5 g of citric acid and 1-2.5 mL of ethylenediamine are dissolved in 10-50 mL of distilled water; the solution is then transferred to a polytetrafluoroethylene autoclave and heated at 100-150° C. for 2.5-5 h; the obtained solution is dialyzed against double distilled water to retain a molecular weight of 3500-5500 Da; 25-50 mg of the prepared CDs are then dispersed in 25-50 mL of an aqueous solution containing 1-5 g of NaOH and 1-5 g of ClCH2COONa, followed by ultrasonic treatment for 2-3 h; after these treatments, the generated CD-COONa is neutralized with HCl and dialyzed again to obtain CDs containing surface carboxyl groups; the prepared CDs are dissolved in 10-100 mM PBS, pH = 7.0-7.5 to obtain 1-2 mg·mL -1 CDs solution; then 1-3 mL, 1-2 mg mL -1 Add 1-5 mL of 50-100 mM NHS and 1-5 mL of 500 mM EDC to the CDs solution and sonicate for 1-3 hours. Add Fuel DNA and incubate at 0-10°C for 12-36 hours. Excess CDs not attached to the ends of the Fuel DNA are removed using a dialysis bag. The retained molecular weight is 8,000-10,000 Da.
[0024] The process of step (4) is as follows: add 10-50nM Fuel DNA solution to 10-30μg·mL -1 The fluorescence in the GO solution was quenched for 1–8 min.
[0025] The process of step (5) is as follows: Add 20 - 40 nM dsDNA-AuNPs solution to the mixture, and finally add target miRNA let-7a at different concentrations, and incubate at 24 - 37 °C for 10 - 30 min. Record the fluorescence of the mixture with an FL-8500 fluorescence spectrophotometer.
[0026] Application of the biosensor prepared by the above method for detecting miRNA let-7a in disease diagnosis.
[0027] A total of 4 DNA strands are used in the present invention, and their sequences are as follows:
[0028] Recognition DNA: 5’-(SH)-AAAAAAAAAAACTAT ACAACCTACTACCTCATAGGT AC-3’;
[0029] Hairpin DNA: 5’-ACA ACCTATGAGGTAGTAGGTTGT -3’;
[0030] Fuel DNA: 5’-NH2-G*T*A*CCTATGAGGTAGTAGGT*T*G*-3’; (*: phosphorothioate bonds)
[0031] miRNA let-7a: 5’-UGAGGUAGUAGGUUGUAUAGUU-3’;
[0032] Among them, the thiol - HS modified at the end of Recognition DNA can be connected to the gold nanoparticles through Au - S bonds. The underlined part of Recognition DNA is complementary to the underlined part of Hairpin DNA, thus forming a composite structure of dsDNA - AuNPs. The bold part of Recognition DNA is complementary to the bold part of miRNA let-7a, and the italic part of Recognition DNA is complementary to the italic part of Fuel DNA. In the presence of the target miRNA let-7a, the first strand displacement reaction TSDR1 occurs, displacing Hairpin DNA from Recognition DNA. The exposed base region causes the second strand displacement reaction TSDR2 to occur. Fuel DNA further displaces miRNA let-7a from Recognition DNA. The double-stranded Fuel DNA will desorb from graphene oxide, resulting in fluorescence recovery. miRNA let-7a continues the next round of cyclic amplification reaction as the trigger strand.
[0033] The detection method of the present invention is to detect miRNA let-7a by fluorescence. The fluorescence of the Fuel DNA labeled with CDs is quenched by fluorescence resonance energy transfer to GO. In the presence of the target miRNA let-7a, through two successive strand displacement reactions (TSDRs) occurring on dsDNA-AuNPs, the Fuel DNA is desorbed from the GO surface and the fluorescence is restored. During this process, the target is recycled and the signal is further amplified. The concentration of the target miRNA let-7a is proportional to the fluorescence recovery value.
[0034] The biosensor of the present invention is based on graphene oxide and fluorescent carbon dots functionalized DNA. This sensor has the advantages of simple preparation of fluorescent carbon dots, stable fluorescence emission performance, high biocompatibility, low cytotoxicity, simple detection operation, fast detection speed, low detection limit, and good detection selectivity, realizing rapid and sensitive quantitative detection of miRNA let-7a.
[0035] Compared with the prior art, the present invention has the following beneficial effects:
[0036] (1) Graphene oxide acts as an energy resonance energy transfer acceptor and a fluorescence quencher, with a high fluorescence quenching rate and a fast quenching speed, which can reduce the fluorescence background signal value.
[0037] (2) The Fuel DNA functionalized with CDs acts as an energy donor and a molecular recognition probe. Compared with the traditional organic dye-labeled DNA, the probe synthesized by labeling DNA with CDs has stronger biocompatibility and smaller toxicity.
[0038] (3) Using AuNPs as a carrier, multiple probes can be loaded on it, which can not only improve the hybridization efficiency, introduce multiple signal molecules at the same time, but also play a role in signal amplification. In addition, modifying DNA on the surface of AuNPs can make the probe more stable in a complex environment and increase the repeatability of the experiment.
[0039] (4) When miRNA let-7a is present, two strand displacement reactions are triggered. Finally, the Fuel DNA forms a double-stranded structure of dsDNA-AuNPs, resulting in the detachment of the Fuel DNA labeled with CDs from the GO surface and the restoration of fluorescence. The two strand displacement reactions can recycle the target miRNA let-7a and further amplify the signal, thereby improving the sensitivity of the sensor and reducing the detection limit. Description of the Drawings
[0040] Figure 1 This is the schematic diagram of the experiment.
[0041] Figure 2 This is the physical picture of the synthesized carbon dots.
[0042] Figure 3 Transmission electron microscopy image of the synthesized carbon dots.
[0043] Figure 4 Infrared spectrum of the synthesized carbon dots.
[0044] Figure 5 Fluorescence emission spectrum of the synthesized carbon dots.
[0045] Figure 6 UV-vis characterization diagrams of AuNPs, dsDNA-AuNPs, and dsDNA.
[0046] Figure 7 Detection diagram of the condition optimization of graphene oxide.
[0047] Figure 8 Detection result diagram of the optimization of the concentrations of dsDNA-AuNPs and Fuel DNA.
[0048] Figure 9 Standard curve detected by this sensor.
[0049] Figure 10 Selective detection result diagram detected by this sensor. Detailed implementation mode
[0050] The following further illustrates the specific implementation of the present invention in conjunction with the accompanying drawings and examples, but the implementation and protection of the present invention are not limited thereto. It should be noted that for the processes not specifically described in detail below, those skilled in the art can implement or understand them with reference to the prior art. The reagents or instruments used without indicating the manufacturer are regarded as conventional products that can be obtained through commercial purchase.
[0051] Example 1
[0052] (1) Add 10 mg of GO flakes to 10 mL of deionized water, and then place the solution in an ice bath and sonicate it for 3 h. Finally, a uniform GO yellowish-brown solution is collected and stored at room temperature for further use.
[0053] (2) dsDNA-AuNPs are bound through gold-sulfur bonds. First, the thiolated oligonucleotide (Recognition DNA) was reduced with TCEP at a molar ratio of 1:100 for 1 h to prevent the formation of disulfide bonds. Then, Recognition DNA and Hairpin DNA (HP DNA) were mixed at a molar ratio of 1:1.2 in phosphate buffer (PBS: 137 mM NaCl, 10 mM phosphate, 2.7 mM KCl, pH = 7.4). The mixture was heated to 75 °C for 10 min and slowly cooled to room temperature for hybridization to obtain dsDNA. The AuNPs solution (20 nM) was added to the mixture. Then, the mixture solution was incubated overnight at room temperature, centrifuged at 13000 rpm / min for 20 min, and the supernatant was discarded to remove the DNA that did not bind to AuNPs. Finally, the obtained solution was washed twice and stored in PBS solution at 4 °C in the dark.
[0054] (3) Citric acid (3.0 g) and ethylenediamine (1.875 mL) were dissolved in distilled water (30 mL). Then the solution was transferred to a polytetrafluoroethylene autoclave (50 mL) and heated at 150 °C for 5 h. The prepared solution was dialyzed with secondary distilled water (retention molecular weight: 3500 Da). Then, 50.0 mg of the prepared CDs were dispersed in 50.0 mL of an aqueous solution containing 2.5 g of NaOH and 2.5 g of ClCH2COONa, and then sonicated for 3 h. After these treatments, the generated CD-COONa was neutralized with HCl and dialyzed again to obtain CDs with carboxyl groups on the surface. The prepared CDs were dissolved in 10 mM PBS (pH = 7.5) to obtain a CDs solution of 2.0 mg·mL -1 . Then, 1 mL of the 2.0 mg·mL -1 CDs solution was added with 50 mM NHS (1 mL) and 500 mM EDC (1 mL), and sonicated for 2 h. Then Fuel DNA was added, and further incubated at 4 °C for 24 h. The excess CDs that were not linked to the end of Fuel DNA were removed using a dialysis bag (retention molecular weight: 8000 Da). As Figure 3 shown, the average particle size of the carbon dot particles was 10 nm. (4) The fluorescence detection method for miRNA let-7a is as follows. 50 nM Fuel DNA solution was added to different concentrations of GO solution (0 - 40 μg·mL -1 ) for fluorescence quenching for 2 min, and the fluorescence of the mixture was recorded by an FL-8500 fluorescence spectrophotometer. As Figure 1, in the absence of miRNA let-7a, GO binds to the carbon dot-labeled Fuel DNA through hydrophobic interactions and π-π stacking interactions, and completely quenches the fluorescence of the carbon dots through FRET.
[0055] After detection, as Figure 7 , the detected fluorescence signal intensity gradually decreased and then remained basically unchanged, indicating that the optimal GO quenching concentration was 30 μg·mL -1 .
[0056] Example 2
[0057] (1) Add 10 mg of GO flakes to 10 mL of deionized water, and then place the solution in an ice bath and sonicate for 3 h. Finally, a uniform GO brown-yellow solution was collected and stored at room temperature for further use.
[0058] (2) dsDNA-AuNPs are bound through gold-sulfur bonds. First, the thiolated oligonucleotide (Recognition DNA) was reduced with TCEP for 1 h at a molar ratio of 1:100 to prevent the formation of disulfide bonds. Then, Recognition DNA and Hairpin DNA (HP DNA) were mixed at a molar ratio of 1:1.2 in phosphate buffer (PBS: 137 mM NaCl, 10 mM phosphate, 2.7 mM KCl, pH = 7.4). The mixture was heated to 75 °C for 10 min and slowly cooled to room temperature for hybridization to obtain dsDNA. Add AuNPs solution (20 nM) to the mixture. Then the mixture solution was treated overnight at room temperature, and the solution was centrifuged at 13000 rpm / min for 20 min, and the supernatant was discarded to remove the DNA that did not bind to AuNPs. Finally, the obtained solution was washed twice and stored in PBS solution at 4 °C in the dark.
[0059] (3) Dissolve citric acid (3.0 g) and ethylenediamine (1.875 mL) in distilled water (30 mL). Then transfer the solution to a polytetrafluoroethylene autoclave (50 mL) and heat at 150 °C for 5 h. The prepared solution was dialyzed with secondary distilled water (retention molecular weight: 3500 Da). Then, 50.0 mg of the prepared CDs were dispersed in 50.0 mL of an aqueous solution containing 2.5 g of NaOH and 2.5 g of ClCH2COONa, and then sonicated for 3 h. After these treatments, the generated CD-COONa was neutralized with HCl and dialyzed again to obtain CDs with carboxyl groups on the surface. The prepared CDs were dissolved in 10 mM PBS (pH = 7.5) to obtain a 2.0 mg·mL -1 CDs solution. Then 1 mL, 2.0 mg·mL-1 50 mM NHS (1 mL) and 500 mM EDC (1 mL) were added to the CDs solution, and the mixture was sonicated for 2 h. Then, Fuel DNA was added, and the mixture was further incubated at 4 °C for 24 h. The excess CDs that were not linked to the ends of Fuel DNA were removed using a dialysis bag (retention molecular weight: 8000 Da).
[0060] (4) The fluorescence detection method for miRNA let-7a is as follows. A 50 nM Fuel DNA solution was added to 30 μg·mL - 1 GO solution for fluorescence quenching for 2 min. As Figure 1 , in the absence of miRNA let-7a, GO binds to the carbon dot-labeled Fuel DNA through hydrophobic interaction and π-π stacking, and completely quenches the fluorescence of the carbon dots through FRET. Then, dsDNA-AuNPs solutions with different concentrations (0 nM - 40 nM) were added to the mixture, and finally 1 nM of the target miRNA let-7a was added, and the mixture was incubated at 37 °C for 25 min. The fluorescence of the mixture was recorded using an FL-8500 fluorescence spectrophotometer. In the presence of miRNA let-7a, the first cascade strand displacement reaction (TSDR1) was triggered. miRNA let-7a binds to Recognition DNA and displaces HP DNA through TSDR1. In addition, it releases HP DNA and exposes the second toehold region, thus triggering the occurrence of the second cascade strand displacement reaction (TSDR2). Fuel DNA binds to Recognition DNA and displaces miRNA let-7a through toehold-mediated strand migration in a similar manner. As a result, the target miRNA let-7a is recycled, Fuel DNA detaches from the GO surface, and the fluorescence of the CDs is restored. Since the dsDNA attached to the AuNPs is negatively charged and there is an electrostatic repulsive force between dsDNA and GO, when the target is present, it causes Fuel DNA to move away from the GO surface and results in fluorescence recovery. The concentration of miRNA let-7a is proportional to the fluorescence recovery value. As detected, as Figure 8 (a), the detected fluorescence signal intensity first gradually increases and then basically remains unchanged as the concentration of dsDNA-AuNPs is in the range of 0 nM - 40 nM. When the concentration of dsDNA-AuNPs is 30 nM, the fluorescence intensity reaches the maximum value. Therefore, the optimal concentration of the dsDNA-AuNPs chain is 30 nM.
[0061] Example 3
[0062] (1) 10 mg of GO flakes were added to 10 mL of deionized water, and then the solution was placed in an ice bath and sonicated for 3 h. Finally, a homogeneous GO yellowish-brown solution was collected and stored at room temperature for further use.
[0063] (2) dsDNA-AuNPs were bound through gold-sulfur bonds. First, the thiolated oligonucleotide (Recognition DNA) was reduced with TCEP for 1 h at a molar ratio of 1:100 to prevent the formation of disulfide bonds. Then, Recognition DNA and Hairpin DNA (HP DNA) were mixed at a molar ratio of 1:1.2 in phosphate buffer (PBS: 137 mM NaCl, 10 mM phosphate, 2.7 mM KCl, pH = 7.4). The mixture was heated to 75 °C for 10 min and slowly cooled to room temperature for hybridization to obtain dsDNA. AuNPs solution (20 nM) was added to the mixture. Then the mixture solution was incubated overnight at room temperature, and the solution was centrifuged at 13000 rpm / min for 20 min, and the supernatant was discarded to remove the DNA that did not bind to AuNPs. Finally, the obtained solution was washed twice and stored in PBS solution at 4 °C in the dark.
[0064] (3) Citric acid (3.0 g) and ethylenediamine (1.875 mL) were dissolved in distilled water (30 mL). Then the solution was transferred to a polytetrafluoroethylene autoclave (50 mL) and heated at 150 °C for 5 h. The prepared solution was dialyzed with secondary distilled water (retention molecular weight: 3500 Da). Then, 50.0 mg of the prepared CDs were dispersed in 50.0 mL of an aqueous solution containing 2.5 g of NaOH and 2.5 g of ClCH2COONa, and then sonicated for 3 h. After these treatments, the generated CD-COONa was neutralized with HCl and dialyzed again to obtain CDs with carboxyl groups on the surface. The prepared CDs were dissolved in 10 mM PBS (pH = 7.5) to obtain a 2.0 mg·mL -1 CDs solution. Then, 1 mL of the 2.0 mg·mL -1 CDs solution was added with 50 mM NHS (1 mL) and 500 mM EDC (1 mL), and sonicated for 2 h. Then Fuel DNA was added, and further incubated at 4 °C for 24 h. The excess CDs that were not linked to the ends of Fuel DNA were removed using a dialysis bag (retention molecular weight: 8000 Da).
[0065] (4) The fluorescence detection method for miRNA let-7a is as follows. Different concentrations of Fuel DNA solutions (0 nM - 70 nM) were added to 30 μg·mL -1Quench the fluorescence in the GO solution for 2 min, then add the 30 nM dsDNA-AuNPs solution to the mixture, and finally add 1 nM of the target miRNA let-7a and incubate at 37 °C for 25 min. Record the fluorescence of the mixture with an FL-8500 fluorescence spectrophotometer.
[0066] As detected, as Figure 8 (b), the intensity of the detected fluorescence signal first gradually increases and then gradually decreases as the concentration of Fuel DNA is in the range of 0 nM - 70 nM. When the concentration of Fuel DNA is 50 nM, the fluorescence intensity value reaches the maximum. Therefore, the optimal concentration of Fuel DNA is 50 nM.
[0067] Example 4
[0068] (1) Add 10 mg of GO flakes to 10 mL of deionized water, and then place the solution in an ice bath and sonicate for 3 h. Finally, collect a uniform GO yellowish-brown solution and store it at room temperature for further use.
[0069] (2) dsDNA-AuNPs are bound through gold-sulfur bonds. First, reduce the thiolated oligonucleotide (Recognition DNA) with TCEP at a molar ratio of 1:100 for 1 h to prevent the formation of disulfide bonds. Then mix Recognition DNA and Hairpin DNA (HP DNA) at a molar ratio of 1:1.2 in phosphate buffer (PBS: 137 mM NaCl, 10 mM phosphate, 2.7 mM KCl, pH = 7.4). Heat the mixture to 75 °C for 10 min and slowly cool it to room temperature for hybridization to obtain dsDNA. Add the AuNPs solution (20 nM) to the mixture. Then treat the mixture solution overnight at room temperature, centrifuge the solution at 13000 rpm / min for 20 min, and discard the supernatant to remove the DNA that has not bound to AuNPs. Finally, wash the obtained solution twice and store it in PBS solution at 4 °C in the dark.
[0070] (3) Dissolve citric acid (3.0 g) and ethylenediamine (1.875 mL) in distilled water (30 mL). Then transfer the solution to a polytetrafluoroethylene autoclave (50 mL) and heat it at 150 °C for 5 h. The prepared solution is dialyzed against double-distilled water (retention molecular weight: 3500 Da). Then, disperse 50.0 mg of the prepared CDs in 50.0 mL of an aqueous solution containing 2.5 g of NaOH and 2.5 g of C1CH2COONa, and then sonicate for 3 h. After these treatments, the resulting CD-COONa is neutralized with HCl and dialyzed again to obtain CDs with carboxyl groups on the surface. Dissolve the prepared CDs in 10 mM PBS (pH = 7.5) to obtain a CDs solution of 2.0 mg·mL -1 Then, add 1 mL of the 2.0 mg·mL -1 CDs solution to 50 mM NHS (1 mL) and 500 mM EDC (1 mL), and sonicate for 2 h. Then add Fuel DNA and further incubate at 4 °C for 24 h. The excess CDs not linked to the ends of Fuel DNA are removed using a dialysis bag (retention molecular weight: 8000 Da).
[0071] (4) The fluorescence detection method for miRNA let-7a is as follows. Add 50 nM fuel DNA solution to 30 μg·mL - 1 GO solution to quench the fluorescence for 2 min, then add 30 nM dsDNA-AuNPs solution to the mixture, and finally add different concentrations of the target miRNA let-7a (0 - 1 nM), and incubate at 37 °C for 25 min. Record the fluorescence of the mixture using an FL-8500 fluorescence spectrophotometer.
[0072] After detection, as Figure 9 , the detected fluorescence signal intensity gradually increases with the increase in the concentration of miRNA let-7a.
[0073] Figure 1 is the schematic diagram of the experiment obtained in Example 1.
[0074] Figure 2 is the physical picture of the carbon dots obtained in Example 1, indicating that the carbon dots have obvious visible fluorescence under light irradiation in a specific wavelength range.
[0075] Figure 3 is the transmission electron microscopy image of the carbon dots obtained in Example 1, indicating that their average particle size is 10 nm.
[0076] Figure 4The infrared spectrum of the carbon dots obtained in Example 1 indicates that carboxyl groups are successfully modified on the surface of the carbon dots, enabling them to have good water solubility while being able to couple with Fuel DNA.
[0077] Figure 5 The fluorescence emission spectrum of the carbon dots obtained in Example 1 shows that the synthesized carbon dots have a stable emission peak at 543 nm under 488 nm light excitation.
[0078] Figure 6 The UV-vis characterization diagrams of AuNPs, dsDNA-AuNPs, and dsDNA obtained in Example 2 are used to verify the formation of the dsDNA-AuNPs composite structure.
[0079] Figure 7 The condition optimization diagram of the concentration of graphene oxide GO for the experimental conditions obtained in Example 1 shows that the optimal GO concentration is 30 μg·mL -1 .
[0080] Figure 8 The condition optimization diagrams of the concentrations of dsDNA-AuNPs and Fuel DNA for the experimental conditions obtained in Examples 2 and 3 show that the optimal dsDNA-AuNPs concentration is 30 nM and the optimal Fuel DNA concentration is 50 nM.
[0081] Figure 9 The fluorescence recovery diagram of different target concentrations miRNA let-7a (0 pM - 1 nM) obtained in Example 4 and the linear relationship diagram between the concentration of target let-7a and fluorescence intensity show that the fluorescence recovery value is proportional to the target concentration.
[0082] Figure 10 The analysis of the selectivity of the system obtained in Example 4 shows that different miRNAs, including single-base mismatched miRNA (M1) and non-complementary random miRNA (R), are selected as interfering substances under the same experimental conditions. The results show that the fluorescence recovery rate of the target microRNA let-7a (T) is significantly higher than that of M1, R, and the blank group. The test results indicate that even if one base is mismatched, the fluorescence recovery value is very low, so this method can also be applied to single-base mismatch recognition.
[0083] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. A preparation method of a biosensor based on graphene oxide and fluorescent carbon dot-functionalized DNA, characterized in that, It includes the following steps: (1) Prepare a homogeneous solution of graphene oxide by ultrasonic dispersion; (2) Prepare a dsDNA-AuNPs fluorescent probe using Recognition DNA, Hairpin DNA, and AuNPs; (3) Prepare fluorescent carbon dots CDs by hydrothermal method, and dehydrate and condense the carbon dots modified with carboxyl groups on the surface and Fuel DNA modified with amino groups at the end to form a Fuel DNA-CDs complex; (4) Add the Fuel DNA-CDs complex solution to the graphene oxide solution for a fluorescence quenching reaction; (5) After complete fluorescence quenching, add dsDNA-AuNPs and miRNA let-7a, and perform two chain displacement reactions to detect the fluorescence recovery value; The specific steps of step (1) are as follows: Add 5-30 mg of graphene oxide flakes to 5-30 mL of deionized water, and then place the solution in an ice bath and ultrasonically treat it for 1-4 h; Finally, collect a uniform light brown solution of graphene oxide and store it at room temperature for further use; In step (2), for the preparation of the dsDNA-AuNPs fluorescent probe, the method is as follows: Reduce thiolated oligonucleotide Recognition DNA with TCEP for 0.5-3 h at a molar ratio of (1-5):(100-500) to prevent the formation of disulfide bonds; Then mix Recognition DNA and Hairpin DNA at a molar ratio of (1-3):(1.2-3.6) in phosphate buffer; Heat the mixture to 60-80 °C and keep it for 5-20 min, and slowly cool it to room temperature for hybridization to obtain dsDNA; Add 10-30 nM AuNPs solution to the mixture; Then let the mixture solution stand overnight at room temperature, centrifuge the solution at 10000-14000 rpm / min for 10-30 min, and discard the supernatant to remove the DNA that has not bound to AuNPs. Finally, wash the obtained solution twice and store it in PBS solution at 0-10 °C in the dark to obtain it; The specific steps of step (3) are as follows: Dissolve 1 - 5 g of citric acid and 1 - 2.5 mL of ethylenediamine in 10 - 50 mL of distilled water; then transfer the solution to a polytetrafluoroethylene autoclave and heat it at 100 - 150 °C for 2.5 - 5 h; the prepared solution is dialyzed with double-distilled water, retaining a molecular weight of 3500 - 5500 Da; then, 25 - 50 mg of the prepared CDs are dispersed in 25 - 50 mL of an aqueous solution containing 1 - 5 g of NaOH and 1 - 5 g of ClCH2COONa, and then sonicated for 2 - 3 h; after these treatments, the generated CD-COONa is neutralized with HCl and dialyzed again to obtain CDs with carboxyl groups on the surface; dissolve the prepared CDs in 10 - 100 mM PBS, pH = 7.0 - 7.5 to obtain a CDs solution of 1 - 2 mg·mL -1 ; then, add 50 - 100 mM NHS, 1 - 5 mL and 500 mM EDC, 1 - 5 mL to 1 - 3 mL, 1 - 2 mg·mL -1 of the CDs solution, and sonicate for 1 - 3 h; then add Fuel DNA and further incubate at 0 - 10 °C for 12 - 36 h, and the excess CDs not connected to the ends of Fuel DNA are removed using a dialysis bag, retaining a molecular weight of 8000 - 10000 Da; The base sequence of the Recognition DNA is: 5’-(SH)-AAAAAAAAAAACTATA CAACCTACTACCTC ATAGGTAC -3’; The base sequence of the said Hairpin DNA is: 5’-ACAACCTATGAGGTAGTAGGTTGT-3’; The base sequence of the shown Fuel DNA is: 5’-NH2- G*T*A*CCTATGAGGTAGTAGGT*T*G* -3’; The base sequence of the said miRNA let-7a is: 5’-UGAGGUAGUAGGUUGUAUAGUU-3’.
2. The preparation method according to claim 1, characterized in that, The said phosphate buffer is: PBS: 100-150 mM NaCl, 10-30 mM phosphate, 2-5 mM KCl, pH = 7-7.
5.
3. The preparation method according to claim 1, characterized in that, The process of step (4) is as follows: Add 10 - 50 nM Fuel DNA-CDs solution to 10 - 30 μg·mL -1 graphene oxide solution for fluorescence quenching for 1 - 8 min.
4. The preparation method according to claim 1, characterized in that, The process of the said step (5) is as follows: Add 20 - 40 nM dsDNA-AuNPs solution to the mixture, and finally add target miRNA let-7a with different concentrations, and incubate at 24 - 37 °C for 10 - 30 min, and record the fluorescence of the mixture by using an FL-8500 fluorescence spectrophotometer.
5. The preparation method according to claim 4, characterized in that, The detection range value of the said target miRNA let-7a with different concentrations is 0 pM - 1 nM.
6. A biosensor based on graphene oxide and fluorescent carbon dot-functionalized DNA prepared by the preparation method according to any one of claims 1 - 5.
7. Application of the biosensor based on graphene oxide and fluorescent carbon dot-functionalized DNA according to claim 6 in detecting miRNA let-7a.
Citation Information
Patent Citations
Preparation method of fluorescence probe and applications of the fluorescence probe
CN103834727A
Method and kit for detecting triphosadenine through strand displacement signal amplification fluorescence sensor based on aptamer and carbon dot
CN109001167A