Application of exogenous anti-apoptosis gene BIR1 in enhancing biocontrol efficacy of Coniothyrium minitans
By expressing the exogenous anti-apoptotic gene BIR1 in 文凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯凯
Patent Information
- Application Number
- CN202211126158.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-16
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2042-09-16
AI Technical Summary
The prior art is difficult to effectively improve the biodefense ability of schizophrenia, including growth rate, spore production ability, parasitic ability and stress resistance, resulting in its unstable effect in preventing and treating nucleophile diseases.
Expression of the BcBIR1 gene was achieved by expressing the exogenous anti-apoptotic gene BIR1, and recombinant vectors were constructed and integrated into the genome of the cystic strain by Agrobacterium-mediated transformation method.
It significantly improves the growth rate, spore production ability, parasitic ability and stress resistance of stenosis, thereby enhancing its bioprevention ability against stenosis.
Smart Images

Figure CN115992151B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of the exogenous anti-apoptotic gene BIR1 in enhancing the biocontrol effect of Coniothyrium minitans. Background Art
[0002] Sclerotinia sclerotiorum has a very wide host range. In addition to infecting cruciferous plants, it can also infect plants of 19 families such as Compositae, Leguminosae, Solanaceae, and Liliaceae, including many important cash crops. Due to its wide host range and the extremely strong stress resistance of the sclerotia it produces, which can survive in the soil for a long time, the prevention and control of sclerotinia rot caused by Sclerotinia sclerotiorum is extremely difficult. At present, the main methods for controlling sclerotinia rot of rapeseed are still chemical control and crop rotation. However, pesticide residues will pollute the environment and the control effect of crop rotation is also unstable. Therefore, biological control methods are being paid more and more attention.
[0003] Coniothyrium minitans is an important hyperparasitic fungus. Its host range is relatively narrow, mainly including fungi of the genus Sclerotinia and Sclerotinia minor, and it can also slightly parasitize fungi of the genus Botrytis. Coniothyrium minitans can effectively parasitize the hyphae and sclerotia of Sclerotinia sclerotiorum, causing the hyphae of Sclerotinia sclerotiorum to degrade and the sclerotia to rot. In addition, it can also inhibit the primary infection of ascospores of Sclerotinia sclerotiorum on rapeseed petals, thereby preventing the occurrence of sclerotinia rot of rapeseed. After spraying the spore suspension of Coniothyrium minitans on the rapeseed leaf surface, its spores can be stimulated by Sclerotinia sclerotiorum to germinate and parasitize and destroy the re-infecting hyphae of Sclerotinia sclerotiorum on the lesion, achieving the effect of controlling the re-infection of sclerotinia rot.
[0004] Studies have shown that continuously expressing a gene CmSIT1 related to siderophore-mediated iron transport in Coniothyrium minitans will result in a slower hyphal growth rate but enhanced antifungal ability; the homologous gene CmVps39 of Vam6p / Vps39p and the homologous gene CmpacC of PacC both play important roles in the hyperparasitism of Coniothyrium minitans on Sclerotinia sclerotiorum. CmVps39 can also regulate the vacuole morphology of Coniothyrium minitans hyphae, maintain osmosis and regulate pH and participate in autophagy of cells, affecting sporulation, spore germination, etc. of Coniothyrium minitans; CmpacC can prevent the degradation of oxalic acid and reduce the antifungal activity of Coniothyrium minitans; Cmoxdc1 and Cmoxdc2 are two key genes involved in oxalic acid degradation in Coniothyrium minitans. Among them, Cmoxdc1 is involved in degrading oxalic acid. After knocking out the Cmoxdc1 gene in Coniothyrium minitans, the hyperparasitic ability of Coniothyrium minitans on Sclerotinia sclerotiorum is weakened due to the accumulation of oxalic acid. Consistently, the Coniothyrium minitans Cmoxdc1 knockout mutant has enhanced ability to produce antifungal substances in the presence of oxalic acid. In addition, studies have shown that CmMR1 is related to melanin synthesis in Coniothyrium minitans. The mutant with CmMR1 knocked out has a decreased ability to resist ultraviolet rays, making it difficult to spray Coniothyrium minitans spores in the field to control sclerotinia rot. Therefore, it is extremely important to genetically improve Coniothyrium minitans to enhance its growth rate, ultraviolet resistance, ability to produce antibiotics, and hyperparasitic ability, etc. Summary of the Invention
[0005] The object of the present invention is to provide the application of the exogenous anti-apoptotic gene BIR1 in enhancing the biocontrol effect of Coniothyrium minitans. Expressing the exogenous gene BIR1 can improve the growth rate, sporulation ability, parasitic ability and stress resistance of the biocontrol fungus Coniothyrium minitans, thereby enhancing the biocontrol ability of Coniothyrium minitans against Sclerotinia sclerotiorum.
[0006] The present invention provides the application of the exogenous anti-apoptotic gene BIR1 in enhancing the biocontrol effect of Coniothyrium minitans.
[0007] Preferably, the exogenous anti-apoptotic gene BIR1 includes the anti-apoptotic gene BcBIR1 of Botrytis cinerea.
[0008] Preferably, enhancing the biocontrol effect of Coniothyrium minitans includes improving the growth rate, sporulation ability, parasitic ability and stress resistance of the biocontrol fungus Coniothyrium minitans.
[0009] The present invention also provides a recombinant vector containing the exogenous anti-apoptotic gene BIR1.
[0010] The present invention also provides a method for constructing the above recombinant vector, including the following steps: PCR amplifying the complete cDNA sequence of the anti-apoptotic gene BcBIR1 of Botrytis cinerea, and after digestion with Kpn1 enzyme, ligating the digested gene fragment to a basic vector to obtain the recombinant vector.
[0011] Preferably, the method of PCR amplification includes: extracting the RNA of Botrytis cinerea strain, reverse transcribing it into cDNA and using it as an amplification template for amplification.
[0012] Preferably, the primer pair used for PCR amplification includes Bcbir1-F and Bcbir1-R. The nucleotide sequence of Bcbir1-F is as shown in SEQ ID NO.1, and the nucleotide sequence of Bcbir1-R is as shown in SEQ ID NO.2.
[0013] The present invention also provides a method for constructing a recombinant Coniothyrium minitans expressing the exogenous anti-apoptotic gene BIR1, including the following steps: transferring the above recombinant vector into the conidia of Coniothyrium minitans strain by an Agrobacterium-mediated transformation method.
[0014] Preferably, after the transformation, screening is also included using a hygromycin resistance marker.
[0015] The present invention also provides a recombinant Coniothyrium minitans expressing the exogenous anti-apoptotic gene BIR1 obtained by the above construction method.
[0016] Beneficial effects: The present invention provides the application of exogenous anti-apoptosis gene BIR1 in enhancing the biocontrol effect of Coniothyrium minitans, specifically including PCR amplification to obtain the full sequence of BcBIR1 gene cDNA, constructing a vector containing the BcBIR1 gene, and integrating the vector into the Coniothyrium minitans genome by genetic transformation to obtain Coniothyrium minitans strains Bcbir1-12 and Bcbir1-17 expressing the BcBIR1 gene. A series of biological experiments confirm that expressing the BcBIR1 gene can improve the growth rate, sporulation ability, parasitic ability and stress resistance of the biocontrol fungus Coniothyrium minitans, thus significantly enhancing the biocontrol ability of Coniothyrium minitans. Brief Description of the Drawings
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0018] Figure 1 Expression pattern of BcBIR1 in Coniothyrium minitans, where A. Schematic diagram of the structure of BcBIR1; B. Schematic diagram of the overexpression of BcBIR1; C. Confirmation of single insertion of the BcBIR1 expression vector in transgenic strains Bcbir1-12 and Bcbir1-17 by Southern Blot; D. Detection of DNA and mRNA of actin, hygromycin resistance gene hph and BcBIR1 in Coniothyrium minitans strains; E. Specificity of qRT-PCR primer pairs; F. Dynamic expression of gene CmBIR1 in Coniothyrium minitans strains;
[0019] Figure 2 Colony morphology, growth rate, hyphal tips and sporulation of Coniothyrium minitans strains, where A. Colony morphology of strains ZS-1, Bcbir1-12 and Bcbir1-17 on PDA medium after inoculation for 10 days at 20°C; B. Colony diameters of strains ZS-1, Bcbir1-12 and Bcbir1-17 were measured on the 3rd and 10th days after inoculation respectively, and the growth rate of each strain was calculated; C. Hyphal tips of strains ZS-1, Bcbir1-12 and Bcbir1-17 were observed on PDA medium at 20°C after culturing for 4 days, scale bar = 500 μm; D. Biomass of strains ZS-1, Bcbir1-12 and Bcbir1-17; Each strain added 1 mL of conidial suspension (10 6Conidia / mL) were inoculated into 20 mL of potato dextrose broth (PDB) and cultured with shaking at 20 °C and 150 rpm. The mycelial weights of the strains were harvested, dried, and weighed at 4, 7, and 10 days, respectively; E. Conidial morphology of strains ZS-1, Bcbir1-12, and Bcbir1-17. Conidia of strains ZS-1, Bcbir1-12, and Bcbir1-17 were collected from PDA plates at 15 days and imaged. Scale bar = 5 μm; F. Strains ZS-1, Bcbir1-12, and Bcbir1-17 were cultured on PDA at 20 °C. Conidia were collected on the 4th, 8th, and 12th days, and the number of conidia per plate was determined. According to the least significant difference test, different letters at the top of each column represent significant differences in the means at the P < 0.05 confidence level; error bars represent standard deviations;
[0020] Figure 3 For the anti-apoptotic activity and stress resistance of Coniothyrium minitans strains, where A. Nuclear apoptosis rate. Blue fluorescence in the image represents the nucleus, and green fluorescence represents apoptotic nuclei that are positive for TUNEL staining. Scale bar = 20 μm; B. Nuclear apoptosis rate. The ratio of green nuclear signal to blue nuclear signal represents the apoptosis rate of fungal cells; C. Resistance of Coniothyrium minitans strains to ultraviolet light; D. Resistance of Coniothyrium minitans strains to nutrient deficiency; E. Mycelial growth rate of Coniothyrium minitans strains treated with different concentrations of H 2 O 2 treatment; F. Colony morphology of Coniothyrium minitans strains treated with different concentrations of H 2 O 2 treatment; G. Mycelial growth inhibition rate of Coniothyrium minitans strains treated with different concentrations of H 2 O 2 treatment; Error bars represent standard deviations. Columns labeled with different letters in each graph indicate significant differences by the least significant difference test (P < 0.05);
[0021] Figure 4 For the determination of the parasitism ability of Coniothyrium minitans on Sclerotinia sclerotiorum sclerotia, where A. The situation of Coniothyrium minitans conidia parasitizing sclerotia at 30 days; B. The situation of Coniothyrium minitans conidia parasitizing sclerotia at 60 days; C. Decay index of sclerotia treated with conidia of strains ZS-1, Bcbir1-12, and Bcbir1-17 at 30 days; Error bars represent standard deviations. Columns labeled with different letters in each graph indicate significant differences by the least significant difference test (P < 0.05); D. Decay index of sclerotia treated with conidia of strains ZS-1, Bcbir1-12, and Bcbir1-17 at 60 days. Each strain was repeated 4 times, and the experiment was repeated 2 times. Error bars represent standard deviations. Duncan's multiple range test, no significant difference (P > 0.05). Detailed implementation mode
[0022] The present invention provides an application of an exogenous anti-apoptotic gene BIR1 in enhancing the biocontrol effect of Coniothyrium minitans.
[0023] The exogenous anti-apoptotic gene BIR1 described in the present invention preferably includes the anti-apoptotic gene BcBIR1 of Botrytis cinerea, and more preferably the BcBIR1 gene in the wild-type Botrytis cinerea strain in the examples. The protein BcBIR1 (accession number: XP_024553431.1) is a type II apoptosis inhibitor in Botrytis cinerea, with a length of 600 amino acids and containing two typical BIR domains. The BcBIR1 can be successfully expressed in Coniothyrium minitans and does not affect the expression of the homologous gene CmBIR1 in the Coniothyrium minitans genome.
[0024] The enhancement of the biocontrol effect of Coniothyrium minitans described in the present invention preferably includes enhancing the growth rate, sporulation ability, parasitic ability and stress resistance of the biocontrol fungus Coniothyrium minitans.
[0025] The present invention also provides a recombinant vector containing the exogenous anti-apoptotic gene BIR1.
[0026] The recombinant vector described in the present invention preferably uses pCH-EF-1 as the basic vector (the article related to the disclosure of this plasmid is: Gao, Zhixiao; Wu, Junyan; Jiang, Daohong; Xie, Jiatao; Cheng, Jiasen; Lin, Yang*. ORF I of mycovirus SsNSRV-1 is associated with debilitating symptoms of Sclerotinia sclerotiorum. 2020, Viruses.).
[0027] The present invention also provides a method for constructing the above recombinant vector, including the following steps: PCR amplifying the complete cDNA sequence of the anti-apoptotic gene BcBIR1 of Botrytis cinerea, and after digestion with Kpn1 enzyme, ligating the digested gene fragment to the basic vector to obtain the recombinant vector.
[0028] The PCR amplification method of the present invention preferably includes: extracting the RNA of Botrytis cinerea strains, reverse transcribing it into cDNA as the amplification template, and then performing amplification. The present invention does not particularly limit the method for extracting the RNA and the method for reverse transcription, and any conventional RNA extraction and reverse transcription methods or kits in the art can be used. The primer pair used in the PCR amplification of the present invention preferably includes Bcbir1-F and Bcbir1-R. The nucleotide sequence of Bcbir1-F is shown in SEQ ID NO.1: GGGGTACCCGTGTTGCTACAATGGCT, and the nucleotide sequence of Bcbir1-R is shown in SEQ ID NO.2: GGGGTACCCAAGTTCAAACAATTTCCAT. The PCR amplification program of the present invention preferably includes pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 2 min, for 32 cycles; extension at 72°C for 5 min, and 2 min at 4°C.
[0029] The present invention also provides a method for constructing a recombinant Coniothyrium minitans expressing the exogenous anti-apoptosis gene BIR1, which includes the following steps: transferring the above recombinant vector into the conidia of Coniothyrium minitans strains by the Agrobacterium-mediated transformation method.
[0030] The transformation method of the present invention preferably includes the Agrobacterium-mediated transformation method, and after the transformation, it also includes screening using a hygromycin resistance marker. The screening of the present invention preferably includes transferring the colonies growing on the medium containing 50 μg / mL hygromycin to a fresh PDA plate containing hygromycin for cultivation.
[0031] The present invention also provides a recombinant Coniothyrium minitans expressing the exogenous anti-apoptosis gene BIR1 obtained by the above construction method.
[0032] In the examples of the present invention, a recombinant Coniothyrium minitans was constructed based on the wild-type strain ZS-1 (CCAM041057) of Coniothyrium minitans isolated from Hubei Province. After verification, the recombinant Coniothyrium minitans can significantly accelerate the mycelial growth, biomass accumulation and sporulation rate of Coniothyrium minitans, enhance the anti-apoptosis activity and resistance to various abiotic stresses, and at the same time enhance the parasitism of Coniothyrium minitans to the sclerotia of Sclerotinia sclerotiorum.
[0033] In order to further illustrate the present invention, the application of the exogenous anti-apoptosis gene BIR1 provided by the present invention in improving the biocontrol effect of Coniothyrium minitans will be described in detail below in conjunction with the drawings and examples, but they cannot be understood as limiting the protection scope of the present invention.
[0034] Unless otherwise specified, the reagents and strains used in the invention examples are all materials that can be routinely purchased in the art. In the invention examples, the wild-type strain ZS-1 (CCAM041057) of Coniothyrium minitans was isolated from Hubei Province. The Sclerotinia sclerotiorum strain 1980. The wild-type strain B05.10 of Botrytis cinerea. All strains were cultured on potato dextrose agar (PDA) plates at 20 °C. Bacteria used for molecular experiments were grown on Luria-Bertani (LB) medium. IM medium and Co-IM medium were used for Agrobacterium tumefaciens-mediated fungal transformation. The modified Czapek-Dox liquid medium (MCD) contains (1 L distilled water): D-glucose 40 g, L-alanine 2 g, KH 2 PO 4 1.0 g, MgSO 4 ·7H 2 O 0.5 g, KCl 0.5 g, ZnSO 4 ·7H 2 O 0.01 g, CuSO 4 ·5H 2 O 0.005 g, thiamine 100 μg, d-biotin 10 μg, and then sterilized at 121 °C and 103 kPa for 15 min.
[0035] When analyzing data, the experimental data was analyzed for the significance of data differences using one-way analysis of variance (ANOVA) with SPSS software.
[0036] Example 1
[0037] 1. Cloning of the BcBIR1 gene, construction of the vector, and Agrobacterium tumefaciens-mediated transformation
[0038] The mycelia of strain B05.10 were collected, total RNA was extracted, and complementary DNA (cDNA) was synthesized using a cDNA synthesis kit provided by TransGen Biotech (Beijing, China). Using the synthesized cDNA as a template, the BcBIR1 gene was amplified with the primer pair (Bcbir1-F / Bcbir1-R) and digested with Kpn1 enzyme. The digested gene fragment was ligated to the vector pCH-EF-1, such that the BcBIR1 gene was ligated downstream of the Sclerotinia sclerotiorum EF-1α promoter (as Figure 1 shown). The recombinant vector was transformed into the conidia of the wild-type strain ZS-1 by Agrobacterium tumefaciens-mediated transformation. The colonies growing on the medium containing 50 μg / mL hygromycin were transferred to fresh PDA plates containing hygromycin for culture.
[0039] 2. Verification of positive transformants
[0040] The Coniothyrium minitans strain was cultured on a PDA plate covered with cellophane. Mycelia were collected after culturing at 20 °C for 6 days. Genomic DNA was extracted using the CTAB method. To confirm the integration of the expression vector, Southern Blot analysis was performed.
[0041] Approximately 30 μg of genomic DNA from each strain was digested with the restriction enzyme SacⅠ. The probe was designed on the hygromycin B resistance gene cassette and amplified with the primer pair HYG-F (SEQ ID NO.3): TGTCCTGCGGGTAAATAGC / HYG-R (SEQ ID NO.4): CTTCTGCGGGCGATTTGT( Figure 1 )
[0042] To detect gene expression, conidia of each Coniothyrium minitans strain were collected and diluted to 10 8 conidia / mL. Then, 2 mL of the conidia suspension was spread on a PDA plate covered with cellophane. Mycelia were harvested at 4 important differentiation time points: conidia germination (24 h after inoculation), early mycelial growth (36 h after inoculation), mycelial growth (48 h after inoculation), and conidia formation (72 h after inoculation) stages, with three replicates for each strain.
[0043] Total RNA was extracted using TRIzol reagent (Diyue Biotechnology, Wuhan, China). The first-strand cDNA was synthesized using a cDNA synthesis kit. qRT-PCR was performed using the SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) kit, and the gene expression levels were detected by amplifying with the specific primers of BcBIR1 (QRT-Bcbir1-F (SEQ ID NO.5): CCGTAGATGCTGAGATGTT / QRT-Bcbir1-R (SEQ ID NO.6): TGACTTTCCGCTTTGGTTA) and CmBIR1 (QRT-Cmbir1-F (SEQ ID NO.7): CATCTATCCTGAACGAACTG / QRT-Cmbir1-R (SEQ ID NO.8): CTGATGCGTCTTGAACTG). The actin gene of Coniothyrium minitans (Actin-F (SEQ ID NO.9): GATTGGTATGGGTCAGAA / Actin-R (SEQ ID NO.10): ATCTGGGTCATCTTCTCA) was used as an internal control for normalization. Before performing qRT-PRC, the genomic DNAs of Coniothyrium minitans strain ZS-1 and Botrytis cinerea strain B05.10 were used as PCR templates respectively to confirm the specificity of the primer pairs for amplifying BcBIR1 and CmBIR1.
[0044] qRT-PCR was carried out using a reaction mixture with a total volume of 20 μL, which contained 10 μL of 2×SYBR Green Supermix, 1 μL of cDNA, 0.5 μL each of the forward and reverse primers, and 8 μL of DEPC-treated water. The PCR consisted of three steps: 95 °C for 3 min, followed by 42 cycles of 95 °C for 10 s, 56 °C for 10 s, and 72 °C for 25 s. Each sample was repeated in triplicate, and the experiment was independently repeated twice. The 2 -ΔΔCT method was used to calibrate the expression levels of the target genes.
[0045] 3. Phylogenetic analysis and expression of BcBIR1 gene in Coniothyrium minitans
[0046] The protein BcBIR1 (accession number: XP_024553431.1) is a type II apoptosis inhibitor in Botrytis cinerea, with a length of 600 amino acids and contains two typical BIR domains ( Figure 1In A), a homologous protein of BcBIR1 was identified in Coniothyrium minitans using BLASTx search and named CmBIR1 (accession number: KAF9741494.1). CmBIR1 has 22.83% identity with BcBIR1, consists of 631 amino acids, and contains two BIR domains. The cDNA of gene BcBIR1 was amplified from Botrytis cinerea strain B05.10 and cloned into vector pCH-EF-1( Figure 1 In B).
[0047] The BcBIR1 expression vector was integrated into the genome of the wild-type strain ZS-1 of Coniothyrium minitans by Agrobacterium-mediated transformation. After purification of conidia, the genomic DNA of each strain was digested with SacⅠ. Then the single copy of the expression vector in the positive transformants was confirmed by Southern blotting Figure 1 In C).
[0048] The expression of the hph hygromycin resistance gene and the BcBIR1 gene was verified by reverse transcription PCR (RT-PCR). Both the DNA and mRNA of BcBIR1 could be detected in the two positive transformants Figure 1 In D). Therefore, they were named transgenic strains Bcbir1-12 and Bcbir1-17.
[0049] Meanwhile, using the genomic DNA of Coniothyrium minitans strain ZS-1 and Botrytis cinerea strain B05.10 as PCR templates, the specificity of the qRT-PCR primer pairs used to amplify BcBIR1 and CmBIR1 was confirmed Figure 1 In E). To estimate the effect of BcBIR1 expression on the expression of the homologous gene CmBIR1 in Coniothyrium minitans, the expression level of CmBIR1 was studied at different stages Figure 1 In F). The relative expression level of CmBIR1 at the conidiation stage (72 h post inoculation (hpi)) was higher than that at the conidia germination (24 hpi), early mycelial growth (36 hpi), and mycelial growth (48 hpi) stages. The expression pattern and level of gene CmBIR1 in the transgenic strains were similar to those in the wild-type strain, indicating that the heterologous expression of gene BcBIR1 does not affect the expression of its homologous gene CmBIR1 in the transgenic strains.
[0050] Example 2
[0051] Biological verification was carried out on the two mutant strains obtained in Example 1
[0052] 2.1 Colony morphology and growth rate determination
[0053] The strains Bcbir1-12 and Bcbir1-17 and the wild-type strain ZS-1 were activated on PDA plates for 3-4 days. Then, mycelial plugs (5 mm in diameter) were punched from the colony edges using a sterile borer and transferred to the center of a quantitative (20 mL) PDA plate (90 mm in diameter) and cultured at 20 °C. The colony diameters were measured on the 3rd and 10th days, and the average growth rate of the strains was calculated. Each strain was repeated three times, and the independent experiment was repeated three times.
[0054] The mycelial growth rates of the transgenic strains Bcbir1-12 and Bcbir1-17 were 3.24 and 3.31 mm / d, respectively, which were 13-15% faster than that of strain ZS-1 (2.86 mm / d) ( Figure 2 in B).
[0055] 2.2 Observation of mycelial tips and conidia morphology
[0056] The transgenic strains Bcbir1-12 and Bcbir1-17 and the wild-type ZS-1 were activated and transferred to the center of fresh PDA plates and cultured at 20 °C for 4 days. The mycelial tips were imaged using a stereomicroscope. Conidia were collected from the PDA plates and observed and photographed using an optical microscope.
[0057] The morphology of the colonies and mycelial tips was observed on PDA. The colony diameters of the transgenic strains Bcbir1-12 and Bcbir1-17 were longer than that of the wild-type strain ZS-1 ( Figure 2 in A). Further observation of the colony edges under the microscope revealed that the mycelial tips of the two transgenic strains were denser than that of the wild-type ZS-1 ( Figure 2 in C). The conidia morphology of all strains was similar ( Figure 2 in E).
[0058] 2.3 Determination of conidia production
[0059] The activated strains were cultured on 20 mL PDA plates for 4, 8, and 12 days, respectively. The whole colony and agar were placed in a mortar containing 5 mL of distilled water and ground thoroughly, and then the liquid was passed through three layers of lens paper. The remaining conidia on the lens paper were rinsed again with 5 mL of distilled water, and all the liquid was centrifuged at 5,000 rpm for 10 minutes. The conidia precipitate was resuspended in 1 mL of distilled water, and the conidia concentration was calculated using a hemocytometer under an optical microscope, and then the conidia production of the whole colony was calculated. Three replicates of each strain were measured, and the experiment was repeated three times.
[0060] The number of conidia produced by the transgenic strains after 4 days of cultivation on PDA medium was approximately three times that of the wild-type strain ZS-1. As time extended, the number of conidia of all strains became comparable and did not increase anymore on the 8th day ( Figure 2 in F).
[0061] 2.4 Determination of biological yield
[0062] Conidia of the Coniothyrium minitans strains were collected after 15 days of cultivation on PDA plates, diluted and counted. 20 mL of PDB medium was added to 100 mL Erlenmeyer flasks, and 1 mL of conidia (10 6 conidia / mL) were inoculated respectively, and cultured at 20 °C and 180 rpm. At 4, 7 and 10 days of cultivation, the mycelia of the strains were collected, dried and weighed. Each strain had 3 replicates, and the whole experiment was independently repeated 3 times.
[0063] When shaken in potato dextrose broth (PDB), the biomass of the two transgenic strains reached the maximum at 7 days after inoculation, while the biomass of the wild-type strain reached the same level at 10 days after inoculation ( Figure 2 in D).
[0064] The above results indicate that the expression of BcBIR1 can significantly accelerate the mycelial growth, biomass accumulation and sporulation rate of Coniothyrium minitans.
[0065] 2.5 Apoptosis assay
[0066] To evaluate the anti-apoptosis ability of the Coniothyrium minitans strains, TUNEL staining was performed using an in situ cell death detection kit (Roche Applied Science, Indianapolis, IN). The sterilized cover slips were obliquely inserted into the PDA plates, and the Coniothyrium minitans strains were inoculated in front of the cover slips. After 5 days, the mycelia growing on the cover slips were treated with H at a final concentration of 16 mM 2 O 2Incubate in PDB for 4 hours. Then, fix the mycelium in 3.7% formaldehyde for 30 minutes and wash it three times with 1×PBS. Subsequently, incubate the coverslip with mycelium in the lysing enzyme (Sigma, USA) solution for 1.5 - 2 hours. After washing, treat the mycelium with the permeabilization solution (0.1% Triton X-100, 0.1% sodium citrate) on ice for 2 minutes and then wash it twice again. After air-drying, add the TUNEL reaction mixture and incubate it in a dark and humid chamber at 37°C for 1 hour. After washing three times, incubate the mycelium with DAPI in the dark at room temperature for 20 - 30 minutes and then wash it three times. Finally, place a drop of fluorescent anti-quenching agent on the stained mycelium sample. Observe the fluorescence signal under a confocal microscope Leica SP8 (Oskar-Barnack, Germany). The DAPI filter (excitation 405 nm, emission 450 nm) and the GFP filter (excitation 488 nm, emission 525 nm) are used to detect the fluorescence signal. The ratio of the green nuclear signal to the blue nuclear signal represents the apoptosis rate of fungal cells. For each sample, 200 cell nuclei are detected and three replicates are performed for each strain.
[0067] Apoptotic cell nuclei show green and blue fluorescence, while normal cell nuclei can only be stained blue with DAPI. The average apoptosis rates of strains Bcbir1-12 and Bcbir1-17 are 25.22% and 36.03% respectively, which are significantly lower than that of the wild-type strain ZS-1 (81.00%) ( Figure 3 in A and B). The results indicate that BcBIR1 can enhance the anti-apoptotic activity of Coniothyrium minitans.
[0068] 2.6 Tolerance of conidia to ultraviolet light
[0069] Collect conidia from the plates of the strains cultured for 15 days and dilute them with sterile water to obtain 10 5 conidia / mL. Spread the spore suspension (100 μL) on the PDA plate, air-dry it, and irradiate it under UV (20 J / cm 2 ) for 1 min and then culture for 36 hours, and count the number of germinated conidia under an optical microscope. Each strain has three replicates and this experiment is repeated three times.
[0070] To evaluate the resistance of Coniothyrium minitans strains to ultraviolet light, the germination rates of conidia treated or untreated with ultraviolet light were calculated. After inoculation on PDA plates for 36 hours, the conidial germination rates of strains Bcbir1-12 and Bcbir1-17 without ultraviolet light treatment were 94.08% and 97.02% respectively, showing no significant difference compared with the wild-type strain. However, after 1 minute of ultraviolet light irradiation, the conidial germination rates of Bcbir1-12 and Bcbir1-17 were 38.55 and 41.04% respectively, higher than that of the wild-type strain (27.57%) ( Figure 3 in C).
[0071] 2.7 Tolerance of strains to H 2 O 2
[0072] Strains Bcbir1-12 and Bcbir1-17 and the wild-type ZS-1 were activated on PDA plates for 3 - 4 days. Mycelial blocks were punched from the colony edge using a sterile punch (5 mm in diameter) and transferred to quantitative PDA plates (60 mm in diameter) containing different concentrations of H 2 O 2 . Cultivation was carried out at 20 °C. The colony diameter was measured on the 6th day, and the mycelial inhibition rate and growth rate were calculated. Each strain was repeated three times, and the experiment was repeated three times.
[0073] When treated with 8, 12, 16 or 20 mM of H 2 O 2 , the growth rates of all strains decreased with the increase in the concentration of H 2 O 2 ( Figure 3 in E and F). The mycelial growth inhibition rates of strains Bcbir1-12 and Bcbir1-17 were significantly lower than those of the wild-type strain at each concentration ( Figure 3 in G).
[0074] 2.8 Nutrient deficiency conditions
[0075] Strains Bcbir1-12 and Bcbir1-17 and the wild-type ZS-1 were activated on PDA plates for 3 - 4 days, and then mycelial blocks were punched from the colony edge using a sterile punch (5 mm in diameter) and transferred to the center of fresh 20 mL 1 / 8 PDA plates (90 mm in diameter) and cultivated at 20 °C. The colony diameter was measured on the 3rd and 9th days respectively, and the mycelial growth rate was calculated. Each strain was repeated three times, and the experiment was repeated three times.
[0076] When cultivated on 20 mL 1 / 8 PDA plates at 20 °C, the growth rates of strains ZS-1, Bcbir1-12 and Bcbir1-17 were 1.8, 2.3 and 2.2 mm / d respectively (Figure 3 In D). The mycelial growth inhibition rates of the transgenic strains Bcbir1-12 and Bcbir1-17 were 26.98% and 25.82%, respectively, while the mycelial growth inhibition rate of the wild-type strain ZS-1 under nutrient deficiency conditions was 34.89%, which was significantly higher than that of the transgenic strains.
[0077] This invention studied the effects of BcBIR1 expression on the response of Coniothyrium minitans to various stresses (such as ultraviolet irradiation, exogenous oxidants, and nutrient deficiency). These results indicate that BcBIR1 expression enhances the resistance of Coniothyrium minitans to multiple abiotic stresses.
[0078] 2.9 Determination of the ability to parasitize sclerotia
[0079] The sclerotia of the Sclerotinia sclerotiorum strain 1980 were surface-sterilized. Every 20 sclerotia were soaked in the conidial suspension (10 5 conidia / mL) of each Coniothyrium minitans strain for 30 minutes, and sterile water was used as a negative control. Then, the treated sclerotia were semi-buried and cultured in sterile wet sand for 30 or 60 days. Subsequently, the sclerotia were cut with a scalpel, and the decay index was observed and recorded on the cut surface. The sclerotial decay index = ∑(sclerotial decay grading numerical value × the number of sclerotia at each decay level) / (total number of treated sclerotia × the highest sclerotial decay index) × 100. Each strain had four replicates, and the experiment was repeated twice.
[0080] After incubation at 20 °C for 30 days, the sclerotia treated with Coniothyrium minitans conidia were covered with the mycelium and conidia of Coniothyrium minitans, showing typical parasitism ( Figure 4 in A). The average decay indices of the sclerotia treated with the conidial suspensions (10 5 conidia / mL) of the strains Bcbir1-12, Bcbir1-17, and ZS-1 were 54.42, 57.27, and 49.62, respectively. The results showed that the decay indices of the sclerotia treated with the conidia of Bcbir1-12 and Bcbir1-17 were significantly higher than those of the sclerotia treated with the conidia of the wild-type strain ( Figure 4 in C). As the inoculation time was extended to 60 days, the sclerotia were almost completely decayed. Therefore, there was no significant difference in the decay indices of the sclerotia treated with the conidia of the strains Bcbir1-12 and Bcbir1-17 and those treated with the conidia of the wild-type strain ( Figure 4 in D). These results indicate that the expression of BcBIR1 enhances the ability of Coniothyrium minitans to parasitize the sclerotia of Sclerotinia sclerotiorum.
[0081] In summary, the heterologous expression of BcBIR1 enhanced the vegetative growth, sporulation, abiotic stress resistance, and the ability to parasitize Sclerotinia sclerotiorum sclerotia of Coniothyrium minitans. Since the growth rate of Coniothyrium minitans is slow, the present invention can significantly increase the mycelial growth rate and sporulation rate, improve the ability of Coniothyrium minitans to compete for ecological niches as a biocontrol agent, and reduce the production cost of its biocontrol agent. Strains Bcbir1-12 and Bcbir1-17 showed strong tolerance to ultraviolet radiation, hydrogen peroxide, and nutrient deficiency. Therefore, the expression of BcBIR1 will improve the survival ability of Coniothyrium minitans in the field, thereby improving its efficiency in controlling Sclerotinia sclerotiorum.
[0082] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all belong to the protection scope of the present invention.
Claims
1. Application of expressing exogenous anti-apoptotic genes BIR1 in enhancing the biocontrol effect of Coniothyrium minitans It is characterized in that The exogenous anti-apoptosis gene BIR1 includes the anti-apoptosis gene of Botrytis cinerea BcBIR1 , accession number: XP_024553431.1 2. The application according to claim 1, It is characterized in that The improvement of the biocontrol effect of Coniothyrium minitans includes improving the growth rate, sporulation ability, parasitic ability and stress resistance of the biocontrol fungus Coniothyrium minitans.
3. A method for constructing a recombinant Coniothyrium minitans expressing an exogenous anti-apoptotic gene BIR1 It is characterized in that It includes the following steps: Transfer the recombinant vector containing the exogenous anti-apoptotic gene BIR1 into the conidia of Coniothyrium minitans strain by the Agrobacterium-mediated transformation method; the exogenous anti-apoptotic gene BIR1 includes the anti-apoptotic gene of Botrytis cinerea BcBIR1 , accession number: XP_024553431.
1.
4. The construction method according to claim 3, It is characterized in that The construction method of the recombinant vector comprises the following steps: PCR amplifying the complete cDNA sequence of the anti-apoptosis gene of Botrytis cinerea BcBIR1 After digestion with Kpn1 enzyme, the digested gene fragment is ligated to the basic vector to obtain the recombinant vector.
5. The construction method according to claim 4, It is characterized in that The method for PCR amplification includes: extracting the RNA of Botrytis cinerea strain, reverse transcribing it into cDNA and using it as an amplification template for amplification.
6. The construction method according to claim 4 or 5, It is characterized in that The primer pair used for PCR amplification includes Bcbir1-F and Bcbir1-R. The nucleotide sequence of Bcbir1-F is shown in SEQ ID NO.1, and the nucleotide sequence of Bcbir1-R is shown in SEQ ID NO.
2.
7. The construction method according to claim 3, It is characterized in that After the transformation, it further includes screening using a hygromycin resistance marker.
8. The recombinant Coniothyrium minitans expressing an exogenous anti-apoptotic gene obtained by the construction method according to claim 3 or 7 BIR1 .