A centromere-specific repeat sequence of sweet potato and its closely related species and its application

Abstract

The invention discloses a sweet potato and its closely related species centromere-specific repeat sequence and its application. The sweet potato is sequenced by second-generation sequencing and third-generation sequencing technology, and the sweet potato centromere-specific repeat sequence is obtained by analysis. After comparative analysis, identification and optimization, the tandem repeat sequence unique to the sweet potato centromere is obtained. After the sequence is designed, the fluorescent signal is marked and converted into a centromere probe, which proves that it can generate clear and bright centromere region hybridization signals in the FISH experiment of sweet potato and closely related species, and accurately display the position of the centromere on the chromosome. By counting the number of centromere signals, the accurate counting of the chromosomes of sweet potato and closely related species can be achieved.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a sweet potato and its closely related species centromere-specific repeat sequence and application thereof. Background Art

[0002] Sweet potato (Ipomoea batatas Lam., 2n=6X=90) is an annual or perennial vine herbaceous plant of the genus Ipomoea in the family Convolvulaceae. It is an important food, feed and industrial raw material crop in the world. At present, more than 600 sweet potato relatives have been found in the genus Ipomoea, which have excellent genes such as disease and insect resistance, high dry rate, and stress resistance.

[0003] Most of the sweet potato plants have extremely small chromosomes, less than 2μm in length, and many in number. Chromosomes have different ploidies such as diploid, tetraploid, and hexaploid. Diploids have 30 chromosomes, tetraploids have 60 chromosomes, and hexaploids have 90 chromosomes. Cultivated sweet potatoes are hexaploid crops with many chromosomes, a large genome, and high heterozygosity. The cytoplasm of sweet potato plants is dense, and the affinity of chromosomes to dyes is weaker than that of other species, making it difficult to obtain clear and beautiful chromosome preparations. For a long time, the basic research on chromosomes of sweet potatoes and related species has been weak, far behind other crops such as rice and wheat. At present, research mainly focuses on chromosome counting and observation of chromosome behavior in meiosis, as well as the use of repetitive sequences such as nuclear rDNA (45S and 5S, etc.) and tandem repeat sequences to locate and distinguish chromosomes. Due to the small and numerous chromosomes of sweet potatoes and related species, easy to entangle and difficult to disperse, it is still difficult to accurately count the chromosomes of sweet potatoes and related species. Currently, fluorescence in situ hybridization (FISH) technology is mainly used to hybridize probes with labeled signals onto chromosomes. By observing their presence, position differences, and signal intensity differences on chromosomes, preliminary research on chromosome differentiation is carried out.

[0004] At present, chromosome analysis of sweet potato and its related species mainly uses the positioning of repetitive sequences such as nuclear rDNA (45S and 5S, etc.) and tandem repeat sequence probes to distinguish chromosomes. These probes can only show fluorescent signals on a part of the chromosomes, and the signal positions of the probes on different chromosomes are also unstable. Only preliminary chromosome analysis can be performed using these probes, and there is no probe that can display all chromosomes in sweet potato and its related species.

[0005] Centromere is an important component of eukaryotic chromosomes and plays an important role in pulling chromosome separation during cell division. Plant centromere DNA is mainly composed of tandem repeats, retrotransposons and low-copy sequences. Among them, tandem repeats are composed of repeating units with different copy numbers, and are often distributed alternately with centromere-specific retrotransposons in the centromere region. Chromatin immunoprecipitation technology is currently widely used to separate centromere DNA that interacts with centromere-specific histone CENH3. With the rapid development of sequencing technology, genome sequencing technology has also been applied to the study of discovering centromere DNA sequences. Centromere tandem repeats are usually highly species-specific, and the similarity between different species is extremely low. By comparing the centromere sequences of different species, it was found that the tandem repeats on the centromere have extremely low homology, and even the interspecies materials with close kinship have huge differences in centromere tandem repeats. The study found that the chromosomes of diploid sweet potato relatives are composed of metacentromere and submetacentromere chromosomes, while the hexaploid sweet potato chromosomes are small, similar in length, and numerous, so the location of chromosome centromere is difficult to determine. According to our literature search results, the centromere tandem repeat sequences of sweet potato and its relatives and the probe sequences that can accurately display their centromere regions have not been reported.

[0006] The genus Ipomoea batatas includes many species, and there is a high degree of variation in chromosome number both within and between species. Clarifying the chromosome number and centromere region-related sequences of sweet potato and its closely related species and developing usable probes are of great importance to sweet potato cell genetics research and breeding practice. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a method for preparing chromosome probes based on the centromere-specific repeat sequence of sweet potato and closely related species.

[0008] The technical scheme of the present invention is: a centromere-specific repeat sequence of sweet potato and its closely related species, and the nucleotide sequence is shown as SEQ ID No.1.

[0009] A probe based on the above-mentioned specific repeating sequence, the probe is composed of a fluorescent group at the 5' end and two or more repeating units of the specific repeating sequence shown in SEQ ID No. 1.

[0010] Furthermore, the nucleotide sequence of the probe is shown in SEQ ID No.2.

[0011] A kit comprising the probe described above.

[0012] The application of the above-mentioned specific repeat sequence or probe or kit in chromosome counting or germplasm identification of sweet potato and its closely related species.

[0013] When chromosome probes are hybridized, as long as 90% of the probe sequences can match the chromosomes, the probes can bind to the chromosomes and show hybridization signals. Therefore:

[0014] 1. The core repeating units of the centromeric tandem repeat sequences may have a few base differences, which are all part of the present invention.

[0015] 2. When designing centromere probes, the probes can be designed based on the core centromere region repeating units by changing a few bases, or changing the number and length of repeating units contained in the probes, all of which belong to the content of the present invention.

[0016] 3. The application scope of the probe of the present invention is not only the sweet potato related species written in this patent, but also can be applied to other species that can hybridize with this probe to display the centromere region. In addition to chromosome counting and centromere region display, this sequence and probe can also be used in the study of distinguishing sweet potato related species and evolution, which all belong to the application scope of the centromere probe developed by the present invention.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. The present invention uses genome sequencing and bioinformatics analysis to obtain tandem repeat sequences in the centromere region. After comparative analysis and experimental verification, the sequence is successfully developed into a probe. Through FISH experiments, bright signals can be generated in the centromere region of all chromosomes of sweet potatoes and related species, accurately showing the position of the centromere on the chromosome; at the same time, all chromosomes can be counted quickly and accurately by counting the number of signals.

[0019] 2. The present invention develops centromere probes to accurately locate the position of centromeres on chromosomes, and counts the number of chromosomes through the centromere signals, which greatly reduces the requirements for chromosome preparation of multi-chromosomal species. Even if the chromosomes overlap or the chromosome morphology is poor, the number of chromosomes can be accurately counted, effectively reducing the counting errors caused by chromosome overlap and breakage.

[0020] 3. The present invention can be used not only for the cultivation of sweet potatoes, but also for the cytological counting and centromere position determination of sweet potato closely related species, such as I. triloba and I. trifida of different ploidy types. It is also applicable to other species with similar centromere repeat sequences, and has wide application value in cytology and genetic evolution research. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1When one core repeat unit is used as a probe, the hybridization signal of sweet potato chromosomes is not strong, and the signal of some chromosomes cannot be distinguished. a is a sweet potato chromosome in metaphase; b is the centromere position signal obtained by hybridizing sweet potato with one core repeat unit as a probe.

[0022] Figure 2 When two core repeating units are used as probes, the chromosome hybridization signal is strong, and all chromosomes have clear and bright hybridization signals. a is a metaphase chromosome of sweet potato; b is a centromere position signal obtained by hybridizing sweet potato with two core repeating units as probes.

[0023] Figure 3 When the three core repeating units are used as probes, the chromosome hybridization signal is strong, and all chromosomes have clear and bright hybridization signals. a is a metaphase chromosome of sweet potato; b is the centromere position signal obtained by hybridizing sweet potato with the three core repeating units as probes.

[0024] Figure 4 When the four core repeating units are used as probes, the chromosome hybridization signal is strong, and all chromosomes have clear and bright hybridization signals. a is a metaphase chromosome of sweet potato; b is the centromere position signal obtained by hybridizing sweet potato with the four core repeating units as probes.

[0025] Figure 5 The invention uses the centromere repeat sequence SHS-cents-374-UF probe of sweet potato and its closely related species to hybridize hexaploid cultivated sweet potato (I. batatas). a is the mitotic metaphase chromosome of cultivated sweet potato (I. batatas); b is the centromere position signal obtained by hybridizing cultivated sweet potato (I. batatas) with the centromere repeat sequence SHS-cents-374-UF probe of sweet potato (I. batatas) and its closely related species.

[0026] Figure 6 The invention uses the sweet potato and its closely related species centromere repeat sequence SHS-cents-374-UF probe to hybridize the hexaploid sweet potato closely related wild species trilobed morning glory (I. trifida (6X)). a is the mitotic metaphase chromosome of the hexaploid sweet potato closely related wild species trilobed morning glory (I. trifida (6X)); b is the centromere position signal obtained by hybridizing the sweet potato and its closely related species centromere repeat sequence SHS-cents-374-UF probe to hybridize the hexaploid sweet potato closely related wild species trilobed morning glory (I. trifida (6X)).

[0027] Figure 7The present invention uses the sweet potato and related species centromere repeat sequence SHS-cents-374-UF probe to hybridize the diploid sweet potato related wild species trilobed morning glory (I. trifida (2X)). a is the mitotic metaphase chromosome of the diploid sweet potato related wild species trilobed morning glory (I. trifida (2X)); b is the centromere position signal obtained by hybridizing the sweet potato and related species centromere repeat sequence SHS-cents-374-UF probe to the diploid sweet potato related wild species trilobed morning glory (I. trifida (2X)).

[0028] Figure 8 The present invention uses the sweet potato and related species centromere repeat sequence SHS-cents-374-UF probe to hybridize the diploid sweet potato closely related wild species I. triloba (2X). a is the mitotic metaphase chromosome of the diploid sweet potato closely related wild species I. triloba (2X); b is the centromere position signal obtained by hybridizing the sweet potato and related species centromere repeat sequence SHS-cents-374-UF probe to the diploid sweet potato closely related wild species I. triloba (2X).

[0029] Fig. 9 The invention uses the sweet potato and closely related species centromere repeat sequence SHS-cents-374-UF probe to hybridize morning glory (I.nil (2X)). a is the metaphase chromosome of morning glory (I.nil (2X)); b is the centromere position signal obtained by hybridizing morning glory (I.nil (2X)) with the sweet potato and closely related species centromere repeat sequence SHS-cents-374-UF probe. DETAILED DESCRIPTION

[0030] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from commercial channels unless otherwise specified.

[0031] Example 1: Mining of sweet potato centromere tandem repeat sequence SHS-cents-374

[0032] (1) Using sweet potato germplasm material Nanrui Tiao (current conventional cultivar) as research material, high-quality genomic DNA was extracted and sequenced by second-generation (Illumina sequencing) and third-generation (PacBio sequencing) to obtain 160Gb of second-generation paired-end sequencing data and 243Gb of third-generation long-fragment sequencing data. The second-generation sequencing data was filtered to retain high-quality sequencing data.

[0033] (2) MECAT2 (https: / / github.com / xiaochuanle / MECAT2, v20190314) was used to preliminarily assemble the third-generation sequencing data. On this basis, NextPolish (https: / / github.com / Nextomics / NextPolish, v1.3.0) was used to further calibrate the assembly results using the second-generation sequencing data to obtain a preliminary genome assembly.

[0034] (3) TR-toolkit (https: / / gitee.com / lhtk / TR-toolkit, v1.0) was used to discover and remove redundancy in the tandem repeat sequences in the genome, and then the tandem arrays with unit length greater than 10 bp were extracted for clustering to obtain a classification statistical information table of non-SSR tandem repeat sequences.

[0035] (4) From the classification statistics table, we screened out the repeat types with a total copy number greater than 10,000. We used B2DSC (https: / / gitee.com / lhtk / b2dsc) to align the representative sequences of these repeat types to the genome, observed the genomic distribution of each type of repeat, screened the types of tandem repeat sequences that could stably appear in all chromosome sequences, and excluded the types that were scattered throughout the chromosome and significantly enriched only in individual chromosomes. We obtained the candidate centromere tandem repeat sequences of sweet potato and related species, with a repeat unit length of 19 to 22 bp, most of which were 21 bp. The sequence was named SHS-cents-374, and its representative repeat unit sequence was TCACAGGGGTAATCAACCCAA (as shown in SEQ ID No. 1). After comparing this repeat sequence with the centromere repeat sequences of other species reported previously, it was found that this was a new type of centromere repeat sequence.

[0036] Example 2: Application of centromere repeat sequence SHS-cents-374 on chromosomes of sweet potato and related species

[0037] The SHS-cents-374 centromere repeat sequence repeat unit was used as the core and designed as a probe. Probes with 1 core unit, 2 core units, 3 core units, and 4 core units were developed and used for FISH hybridization experiments with Nanrui Tiao. The results showed that when the probe only included 1 core repeat unit, the chromosome hybridization signal was not strong, and the signal could not be distinguished for some chromosomes ( Figure 1 When the probe includes 2, 3, or 4 core repeating units, the chromosome hybridization signal is strong, and all chromosomes have clear and bright hybridization signals ( Figure 2, 3, 4). Considering the cost of probe synthesis and hybridization effect, more than two repeating units were determined as probes, which could show clear and stable signals on all chromosomes of sweet potato. The centromere position of chromosomes and the position of centromere probe signal were basically repeated, which confirmed that SHS-cents-374 repeat sequence was a centromere repeat sequence.

[0038] Example 3: Application of SHS-cents-374 centromere repeat sequence on chromosomes of sweet potato and related species

[0039] Using two repeating units as a probe, named SHS-cents-374-UF, the probe sequence is: UF-TCACAGGGGTAATCAACCCAATCACAGGGGTAATCAACCCAA (UF is the fluorescent group at the 5-end) (such as SEQ ID No. 2), in situ hybridization analysis (FISH) was performed on I. batatas, sweet potato, southern sweet potato and its closely related wild species I. triloba (2X), three-lobed wild morning glory I. trif ida (6X), three-lobed wild morning glory I. trifida (2X) and morning glory I. nil (2X).

[0040] The results of FISH hybridization of sweet potato (I. batatas) are shown in Figure 5 The results showed that SHS-cents-374-UF had obvious hybridization signals in the centromere regions of all 90 chromosomes, and no hybridization signals were found in other locations outside the centromere regions of chromosomes. The centromere regions of different chromosomes can be identified by the signals. For overlapping chromosomes, it can help count.

[0041] The results of FISH hybridization of I. trifida (6X) are shown in Figure 6 The results showed that SHS-cents-374-UF had obvious hybridization signals in the centromere regions of all 90 chromosomes, and no hybridization signals were found in other locations outside the centromere regions of chromosomes. The centromere regions of different chromosomes can be identified by the signals. For overlapping chromosomes, it can help count.

[0042] The results of FISH hybridization of I. trifida (2X) are shown in Figure 7 The results showed that SHS-cents-374-UF had obvious hybridization signals in the centromere regions of all 30 chromosomes, and no hybridization signals were found in other locations outside the centromere regions of chromosomes. The centromere regions of different chromosomes can be identified by the signals. For overlapping chromosomes, it can help count.

[0043] The results of FISH hybridization of I. triloba (2X) are shown in Figure 8 The results showed that SHS-cents-374-UF had obvious hybridization signals in the centromere regions of all 30 chromosomes, and no hybridization signals were found in other locations outside the centromere regions of chromosomes. The centromere regions of different chromosomes can be identified by the signals. For overlapping chromosomes, it can help count.

[0044] The results of FISH hybridization of I. nil (2X) are shown in Fig. 9 The results showed that SHS-cents-374-UF had no hybridization signals in the centromere regions of all 30 chromosomes. In comparison, I. batatas is more closely related to I. triloba (2X), I. trifida (6X), and I. trifida (2X), and more distantly related to I. nil (2X). Therefore, the presence or absence of hybridization signals in the centromere region of SHS-cents-374-UF can be used to preliminarily determine the closeness of the relationship between sweet potato and its closely related species.

Claims

1. A probe, characterized in that: The probe is composed of a fluorescent group at the 5' end and two or more repeating units of a specific repeating sequence shown in SEQ ID No.

1.

2. The probe according to claim 1, characterized in that The nucleotide sequence of the probe is shown in SEQ ID No.

2.

3. A kit comprising the probe according to claim 1 or 2.

4. Use of the probe according to claim 1 or 2 or the kit according to claim 3 in chromosome counting or germplasm identification of sweet potato and its closely related species.

Images