Primer pair, primer set, kit and method for detecting kiwifruit chlorotic ringspot virus

Abstract

The present invention belongs to the technical field of virus detection, and specifically relates to a primer pair, a primer set, a kit and a method for detecting kiwifruit chlorotic ringspot virus. The primer pair RPA‑AcCRaV‑F / RPA‑AcCRaV‑R provided by the present invention can amplify the genomic RNA of kiwifruit chlorotic ringspot virus, has good specificity, and realizes the detection of kiwifruit chlorotic ringspot virus. The primer pair is used in combination with a probe to obtain a primer set for detecting kiwifruit chlorotic ringspot virus, which can directly perform RT‑RPA‑LFD detection on kiwifruit chlorotic ringspot virus, has a short detection time, and the results can be interpreted by the naked eye, which is more convenient, realizes rapid detection of samples to be tested, and has high sensitivity, good specificity, and a minimum detection limit of 10 ‑8 ng / μL.

Description

Technical Field

[0001] The invention belongs to the technical field of virus detection, and particularly relates to a primer pair, a primer set, a kit and a method for detecting kiwifruit chlorotic ringspot virus. Background Art

[0002] Kiwifruit is one of the most important horticultural products in the world. It is popular among the public because its flesh is rich in vitamin C, minerals and dietary fiber. Disease infection can affect the yield and quality of kiwifruit, and even affect the healthy development of the kiwifruit industry. Actinidia chlorotic ringspot-associated virus (AcCRaV) is a virus that specifically infects kiwifruit. The virus is common in kiwifruit producing areas and is usually co-infected with other viruses. When kiwifruit is infected with AcCRaV, it often shows symptoms such as leaf chlorosis, mottled and ringspotted, which seriously affects the yield and quality of kiwifruit.

[0003] The detection of fruit tree viruses is a key link in the prediction, forecasting and prevention of viral diseases. The currently reported AcCRaV detection method is mainly reverse transcription-PCR (RT-PCR), which requires sample collection, grinding, RNA extraction, reverse transcription, PCR, electrophoresis and other processes, and requires the configuration of professional equipment such as PCR instrument, electrophoresis instrument, gel imager, etc. The process is relatively cumbersome and costly, time-consuming and labor-intensive; in addition, due to the limited sensitivity of RT-PCR, false negative results are prone to occur when detecting materials with low virus content. Summary of the invention

[0004] The object of the present invention is to overcome the deficiencies of the prior art and provide a primer pair, a primer set, a kit and a method for detecting kiwifruit chlorotic ringspot virus, so as to improve the sensitivity, specificity and detection speed of kiwifruit chlorotic ringspot virus detection.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The invention provides a primer pair for detecting kiwifruit chlorotic ringspot virus by using RPA, comprising an upstream primer RPA-AcCRaV-F with a sequence shown in SEQ ID NO.1 and a downstream primer RPA-AcCRaV-R with a sequence shown in SEQ ID NO.2.

[0007] The present invention also provides a primer set for detecting kiwifruit chlorotic ringspot virus using RPA-LFD, comprising an upstream primer RPA-AcCRaV-F with a sequence shown in SEQ ID NO.1, a downstream primer RPA-AcCRaV-R with a sequence shown in SEQ ID NO.2, and a probe Ac CRaV-nfo-probe with a sequence shown in SEQ ID NO.3.

[0008] Preferably, Y in the probe AcCRaV-nfo-probe is replaced by [THF], a FITC label is added to the 5' end of the probe AcCRaV-nfo-probe, and a polymerase amplification blocking group is added to the 3' end.

[0009] The present invention also provides a detection kit for detecting kiwifruit chlorotic ringspot virus using RPA-LFD, comprising the primer set, reaction buffer and positive control described in the above technical solution.

[0010] Preferably, it also includes a reverse transcription reagent, a nucleic acid extraction reagent and an RNase inhibitor.

[0011] The present invention also provides a method for detecting kiwifruit chlorotic ringspot virus based on RT-RPA-LFD, comprising the following steps:

[0012] Extracting total RNA from a sample containing kiwifruit chlorotic ringspot virus;

[0013] Performing RT-RPA reaction on total RNA using the primer set described in the above technical solution to obtain RPA product;

[0014] The RPA product is detected using a lateral flow chromatography test strip to determine whether the kiwifruit sample to be tested contains kiwifruit chlorotic ringspot virus.

[0015] Preferably, when performing the RT-RPA reaction, based on a total system of 50 μL, 150 to 600 nM upstream primer RPA-AcCRaV-F, 150 to 600 nM downstream primer RPA-AcCRaV-R, 50 to 150 nM probe AcCRaV-nfo-probe, 29.5 μL Primer Free Rehydration buffer, 1 μL total RNA, 1 μL M-MLV reverse transcriptase, 1.4 μL RNase Inhibitor, 2.5 μL 280 mM magnesium acetate and the remainder RNase-free H2O are added to a dry powder reaction tube;

[0016] The dry powder reaction tube contains recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase.

[0017] Preferably, the temperature of the RT-RPA reaction is 35 to 40° C., and the reaction time is 10 to 30 min.

[0018] Preferably, the judgment method includes: after adding the RPA product dropwise to the sample application area of ​​the lateral flow chromatography test strip, inserting the test strip vertically into the analysis buffer MGCBB, incubating for 5 to 15 minutes, taking out the test strip and reading the result, if purple-red lines appear at both the quality control line and the detection line on the test strip, it is judged as a positive sample; if a purple-red line appears only at the quality control line on the test strip, it is judged as a negative sample.

[0019] Preferably, the assay buffer MGCBB comprises citrate phosphate buffer.

[0020] The present invention provides a primer pair for detecting kiwifruit chlorotic ringspot virus using RPA, comprising an upstream primer RPA-AcCRaV-F having a sequence shown in SEQ ID NO.1 and a downstream primer RPA-AcCRaV-R having a sequence shown in SEQ ID NO.2. The present invention designs an RPA primer pair and an nfo probe according to the conserved region of the AcCRaV coat protein gene sequence, can amplify the genomic RNA of kiwifruit chlorotic ringspot virus, has good specificity, and realizes the detection of kiwifruit chlorotic ringspot virus.

[0021] The present invention combines the primer pair for detecting kiwifruit chlorotic ringspot virus by RPA with the nfo probe to obtain a primer set for detecting kiwifruit chlorotic ringspot virus, which can directly perform RT-RPA-LFD detection on kiwifruit chlorotic ringspot virus, has a short detection time, and the results can be interpreted by the naked eye, which is more convenient, realizes rapid detection of samples to be tested, and has high sensitivity and good specificity, with a minimum detection limit of 10 -8 ng / μL. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below.

[0023] Figure 1 Schematic diagram of the positions of the upstream primer RPA-AcCRaV-F, the downstream primer RPA-AcCRaV-R and the probe AcCRaV-nfo-probe in the coat protein gene of kiwifruit chlorotic ringspot virus (AcCRaV) of the present invention, wherein the black underlined part is the position of the primer, and the purple box part is the position of the probe;

[0024] Figure 2 This is a graph showing the results of detecting AcCRaV using RT-RPA technology in Example 3;

[0025] Figure 3This is a graph showing the results of detecting AcCRaV using RT-RPA-LFD technology in Example 3;

[0026] Figure 4 The results of detecting AcCRaV at different RT-RPA reaction temperatures and times in Examples 3 to 12 are shown;

[0027] Figure 5 The size and integrity test results of the RNA transcripts in Example 13;

[0028] Figure 6 Example 13 is a graph showing the sensitivity of AcCRaV detection using RT-PCR technology;

[0029] Figure 7 This is a graph showing the sensitivity of AcCRaV detection using RT-RPA-LFD technology in Example 13;

[0030] Figure 8 This is a graph showing the sensitivity of AcCRaV detection using RT-qPCR technology in Example 13;

[0031] Fig. 9 This is a graph showing the results of detecting AcCRaV in a crude plant extract using RT-RPA-LFD technology in Example 14;

[0032] Fig.10 This is a flow chart of rapid detection of AcCRaV in the field in Example 15;

[0033] Fig.11 This is a graph showing the results of rapid field detection of AcCRaV in Example 15. DETAILED DESCRIPTION

[0034] The invention provides a primer pair for detecting kiwifruit chlorotic ringspot virus by using RPA, comprising an upstream primer RPA-AcCRaV-F with a sequence shown in SEQ ID NO.1 and a downstream primer RPA-AcCRaV-R with a sequence shown in SEQ ID NO.2.

[0035] The base sequences of the upstream primer and the downstream primer of the present invention are as follows from 5' to 3':

[0036] RPA-AcCRaV-F:TCATTTGTCCTGCAAGGCGATTTACTATAG;

[0037] RPA-AcCRaV-R:TTCTGATGGTTTCTTAGAGCTTCCAATAAG.

[0038] In the present invention, the size of the fragment amplified by the upstream primer RPA-AcCRaV-F and the downstream primer RPA-AcCRaV-R is 248 bp.

[0039] In the specific implementation process of the present invention, RPA primers and nfo probes were designed according to the conserved regions of the AcCRaV coat protein gene sequence (accession numbers MK900412.1, MH457054.1, NC_038772.1, MH557850.1, MK900438.1, MK900417.1, MH557851.1, MK900426.1H and MH457042.1), and it was found that RPA-AcCRaV-F / R can achieve the effect of detecting kiwifruit chlorotic ringspot virus. The primer pair provided by the present invention is for kiwifruit chlorotic ringspot virus, can specifically amplify a single, bright, amplified band that meets the expected size, and can be used to detect kiwifruit chlorotic ringspot virus.

[0040] The present invention also provides a primer set for detecting kiwifruit chlorotic ringspot virus using RPA-LFD, comprising an upstream primer RPA-AcCRaV-F with a sequence shown in SEQ ID NO.1, a downstream primer RPA-AcCRaV-R with a sequence shown in SEQ ID NO.2, and a probe AcCRaV-nfo-probe with a sequence shown in SEQ ID NO.3.

[0041] The base sequence of the probe of the present invention, from 5' to 3', is as follows:

[0042] AcCRaV-nfo-probe:

[0043] CAACTTCAACAGCTTTGAACTGTTCCCAATYATATTTTTCCATGAC, where Y is a null base.

[0044] When synthesizing the probe, the present invention preferably adds a FITC label to the 5' end of the probe, adds a polymerase amplification blocking group (C3-spacer) to the 3' end for blocking, and Y is replaced by [THF].

[0045] The present invention can directly use the above primer set to realize RPA-LFD detection of kiwifruit chlorotic ringspot virus. The RPA-LFD detection result of the present invention is positive, and the result can be interpreted by naked eyes, which is more convenient, and has high sensitivity and good specificity.

[0046] The present invention also provides a detection kit for detecting kiwifruit chlorotic ringspot virus using RPA-LFD, comprising the above-mentioned primer set, reaction buffer and positive control, and preferably also comprising a reverse transcription reagent, a nucleic acid extraction reagent and an RNase inhibitor.

[0047] In the present invention, the primer set contains three primers, namely, RPA-AcCRaV-F, RPA-AcCRaV-R and AcCRaV-nfo-probe, wherein the independent concentration of RPA-AcCRaV-F is preferably 10 μmol / L; the independent concentration of RPA-AcCRaV-R is preferably 10 μmol / L; the independent concentration of AcCRaV-nfo-probe is preferably 10 μmol / L. The primer set of the present invention can specifically identify kiwifruit chlorotic ringspot virus, has good amplification performance, and can quickly detect kiwifruit chlorotic ringspot virus.

[0048] The present invention has no strict requirements on the types of the positive control, reverse transcription reagent, nucleic acid extraction reagent and RNase inhibitor, and the reagents used in the conventional kiwifruit chlorotic ringspot virus detection process can be selected.

[0049] The present invention also provides a method for detecting kiwifruit chlorotic ringspot virus based on RT-RPA-LFD, comprising the following steps:

[0050] Extracting total RNA from a sample containing kiwifruit chlorotic ringspot virus;

[0051] Performing RT-RPA reaction on total RNA using the primer set described in the above technical solution to obtain RPA product;

[0052] The RPA product is tested using a lateral flow chromatography test strip (i.e., LFD) to determine whether the kiwifruit sample to be tested contains kiwifruit chlorotic ringspot virus.

[0053] The present invention has no strict requirements on the method of extracting total RNA from the sample to be tested containing kiwifruit chlorotic ringspot virus, and preferably uses the CTAB method for extraction.

[0054] After obtaining the total RNA, the present invention uses the total RNA as a template and uses the primer set described in the above technical solution to perform RT-RPA reaction on the total RNA to obtain an RPA product. When the present invention performs the RT-RPA reaction, based on a total system of 50 μL, preferably 150 to 600 nM upstream primer RPA-AcCRaV-F, 150 to 600 nM downstream primer RPA-AcCRaV-R, 50 to 150 nM probe AcCRaV-nfo-probe, 29.5 μL PrimerFree Rehydrationbuffer, 1 μL total RNA, 1 μL M-MLV reverse transcriptase, 1.4 μL RNase Inhibitor, 2.5 μL 280 mM magnesium acetate and the remainder RNase-free H2O are added to the dry powder reaction tube. In the specific implementation of the present invention, based on a total system of 50 μL, preferably 2.4 μL of 10 μmol / L upstream primer RPA-AcCRaV-F, 2.4 μL of 10 μmol / L downstream primer RPA-AcCRaV-R, 29.5 μL Primer Free Rehydration buffer, 1 μL total RNA, 1 μL M-MLV reverse transcriptase, 1.4 μL RNase Inhibitor, 0.6 μL of 10 μmol / L probe AcCRaV-nfo-probe, 2.5 μL 280 mM magnesium acetate and the remainder of RNase-free H2O are added to the dry powder reaction tube. In the specific implementation of the present invention, the total RNA is preferably diluted to 500-1000 ng / μL.

[0055] In the present invention, the dry powder reaction tube includes a recombinase, a single-stranded DNA binding protein and a strand displacement polymerase. The present invention does not limit the specific amount of the recombinase, single-stranded DNA binding protein (SSB) and strand displacement DNA polymerase in the dry powder reaction tube, and the above volume of components can be added to the lyophilized enzyme tube in the commercial kit. In the specific implementation process of the present invention, the dry powder reaction tube used was purchased from TwistDx.

[0056] In the present invention, the temperature of the RT-RPA reaction is preferably 35 to 40° C., more preferably 40° C.; the time of the RT-RPA reaction is preferably 10 to 30 min, more preferably 20 min. The present invention can improve the amplification effect and the detection speed by adjusting the temperature and time of the RPA-LFD reaction.

[0057] After obtaining the RPA product, the present invention uses a lateral flow chromatography test strip to detect the RPA product to determine whether the kiwifruit sample to be tested contains kiwifruit chlorotic ring spot virus. The judgment method of the present invention preferably includes: after the RPA product is dripped into the sample application area of ​​the lateral flow chromatography test strip, the lateral flow chromatography test strip is vertically inserted into the analysis buffer MGCBB, incubated for 5 to 15 minutes, and the test strip is taken out to read the result. If a purple-red line appears at both the quality control line and the detection line on the test strip, it is determined to be a positive sample; if a purple-red line appears only at the quality control line on the test strip, it is determined to be a negative sample. The analysis buffer MGCBB of the present invention preferably includes: citric acid phosphate buffer. In the specific implementation process of the present invention, the lateral flow chromatography test strip is purchased from Milenia Biotec. The present invention does not require purification treatment during the detection process, and the RPA product obtained can be directly detected using the lateral flow chromatography test strip.

[0058] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0059] Example 1

[0060] 1. Primer Design

[0061] The conserved regions of the AcCRaV coat protein gene sequences of accession numbers MK900412.1, MH457054.1, NC_038772.1, MH557850.1, MK900438.1, MK900417.1, MH557851.1, MK900426.1H and MH457042.1 were compared (e.g. Figure 1 ), according to the comparison results, 1 pair of RPA primers, 1 pair of PCR primers, and 1 pair of qPCR primers were designed. The nucleotide sequences of the specific primers were synthesized by Zhongke Yutong Biotechnology Co., Ltd. The specific sequences of the primers are shown in Table 1.

[0062] Table 1 Detection primer pairs

[0063]

[0064] 2. RNA Extraction

[0065] 2.1 Test materials

[0066] The tissue culture seedlings of big-seeded kiwifruit infected with AcCRaV were used as the experimental materials, the virus-free seedlings of big-seeded kiwifruit were used as the negative control, and water was used as the blank control.

[0067] 2.2 Plant total RNA extraction

[0068] The CTAB method was used to extract plant total RNA. The specific steps are as follows:

[0069] (1) Grind the large-seeded kiwifruit tissue culture seedling sample quickly in liquid nitrogen until it is powdery, then take 0.05-0.1 g and place it in a 1.5 mL RNase-free centrifuge tube (600 μL C CTAB and 40 μL β-mercaptoethanol were added to the RNase-free centrifuge tube in advance), and quickly vortex mix for 30 seconds;

[0070] (2) 65°C water bath for 10 min, shaking several times during the process;

[0071] (3) Add 600 μL of chloroform / isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1), vortex to mix, and centrifuge at 11,000 rpm for 10 min at 4°C;

[0072] (4) Take 500 μL of the supernatant and add an equal volume of chloroform / isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1), mix gently, and centrifuge at 11,000 rpm at 4°C for 10 min.

[0073] (5) Take 400 μL of supernatant and add 200 μL of 6 M LiCl, and precipitate at -20 °C for 2 to 3 h;

[0074] (6) Centrifuge at 12,000 rpm for 10 min at 4°C and discard the supernatant;

[0075] (7) Add 500 μL of 75% ethanol to wash the precipitate, centrifuge at 11,000 rpm for 30 s at 4°C, and remove the ethanol by aspiration;

[0076] (8) Add 400 μL of anhydrous ethanol for washing, centrifuge at 11,000 rpm for 30 s at 4°C, remove the ethanol, and invert the centrifuge tube on a clean bench to dry;

[0077] (9) Add 30 μL of DEPC water to dissolve, and measure its concentration and purity using a micro-UV spectrophotometer. The concentration is about 500 ng / μL, and the A260 / 280 is between 1.8 and 2.0, thus obtaining total RNA.

[0078] 3. cDNA Synthesis

[0079] cDNA reverse transcription kit (PrimeScript TM RT reagent Kit) for first-strand cDNA synthesis, the specific steps are as follows:

[0080] (1) Prepare the reaction system according to the ingredients in Table 2 on ice and remove genomic DNA (gDNA).

[0081] Table 2 Reaction system for removing genomic DNA.

[0082]

[0083] After gently mixing the components, incubate at 42°C for 2 min.

[0084] (2) Prepare the reverse transcription reaction on ice according to the ingredients in Table 3.

[0085] Table 3 Reaction system of reverse transcription reaction

[0086]

[0087] After gently mixing the components, reverse transcription reaction was immediately performed at 25°C for 10 min and at 50°C for 10 min.

[0088] (3) Inactivation

[0089] Heat the reaction solution in step (2) at 85°C for 5 seconds to inactivate 5×UscriptⅡRT SuperMix and gDNA Removal Mix to obtain cDNA, which is then stored in a -20°C refrigerator for later use.

[0090] Example 2

[0091] (1) Using the large-seeded kiwifruit tissue culture seedlings infected with AcCRaV as the test material, the total RNA was extracted according to step 2 of Example 1 as the template for the positive control group; water was used as the template for the blank control group; using the non-toxic large-seeded kiwifruit tissue culture seedlings as the test material, the total RNA was extracted according to step 2 of Example 1 as the template for the negative control group, and the RPA primer pairs designed in Table 1 were used as amplification primers to perform RT-RPA reaction. The RT-RPA reaction system is shown in Table 4.

[0092] Table 4 RT-RPA reaction system

[0093]

[0094] After briefly mixing, the components were transferred to a dry powder reaction tube and mixed by pipetting until the dry powder was completely dissolved. 2.5 μL of 280 mM magnesium acetate (MgOAc) was added to the lid of the reaction tube, which was centrifuged instantaneously until the reaction solution was incubated at 40°C for 30 min to obtain a reaction solution containing the RPA product.

[0095] (2) After the incubation in step (1), the RPA product was recovered and purified using the Cycle-pure Kit (refer to the instructions for specific operations, purchased from OMEGA), and the purified RPA product was detected by agarose gel electrophoresis. Figure 2 .in Figure 2From left to right are 100 bp Marker, 1 is the positive control (using total RNA of Actinidia chinensis infected with AcCRaV as template), 2 is the blank control group (using water as template), and N is the negative control group (using total RNA of Actinidia chinensis non-toxic as template).

[0096] according to Figure 2 It can be seen that the RPA primer pair (i.e., RPA-AcCRaV-F and RPA-AcCRaV-R) can amplify a single, bright band that meets the expected size. Therefore, the primer pair RPA-AcCRaV-F and RPA-AcCRaV-R of the present invention can achieve specific amplification.

[0097] Example 3

[0098] (1) The primer pair RPA-AcCRaV-F and RPA-AcCRaV-R in Example 1 were used as the RPA primers of the present invention, and the probe AcCRaV-nfo-probe (5'-CA ACTTCAACAGCTTTGAACTGTTCCCAATYATATTTTTCCATGAC-3') shown in SEQ ID NO.3 was designed, wherein Y is a null base. During the synthesis of the probe, a FITC label was added to the 5' end, a polymerase amplification blocking group (C3-spacer) was added to the 3' end for blocking, and the middle Y base was replaced with THF; a DIG label was added to the 5' end of RPA-AcCRaV-R1.

[0099] (2) The total RNA of big-seeded kiwifruit infected with AcCRaV extracted in step 2 of Example 1 was used as the template for the positive control group; the total RNA of big-seeded kiwifruit without toxicity was used as the template for the negative control group; water was used as the template for the blank control group, the primer pairs RPA-AcCRaV-F and RPA-AcCRaV-R of Example 1 were used as primers, and AcCRaV-nfo-probe was used as the probe for RT-RPA reaction. The reaction conditions and steps were the same as step (1) of Example 2. The reaction system of the RT-RPA reaction is shown in Table 5 below.

[0100] Table 5 Reaction system of RT-RPA reaction

[0101]

[0102] (3) After the reaction is completed, pipette 1 μL of the reaction solution containing the RPA product into 24 μL of analytical buffer (MGCBB), mix and dilute it 25 times. Pipette 10 μL of the diluted reaction solution containing the RPA product and add it dropwise to the sample application area of ​​the lateral flow chromatography test strip. Then insert the test strip vertically into a 1.5 mL centrifuge tube containing 80 μL MGCBB, incubate for 5 to 15 minutes, take out the test strip and read the result. The result judgment standard is: if the sample being tested carries AcCRaV, two purple-red lines will appear on the test strip (the upper one is the quality control line, and the lower one is the detection line). If the sample being tested does not carry AcCRaV, only a purple-red quality control line will appear on the upper part of the test strip. The specific results are as follows: Figure 3 As shown, Figure 3 In the middle, 1 is the test result of the positive control group (using the total RNA of large-seeded kiwifruit infected with AcCRaV as a template), 2 is the test result of the blank control group (using water as a template), and N is the test result of the negative control group (using the total RNA of non-toxic large-seeded kiwifruit as a template).

[0103] according to Figure 3 It can be seen that the amplification results of the positive control group have two purple-red lines, while the negative control group and the blank control group only have one purple-red line at the quality control line. When using lateral flow chromatography test strips (LFD) for detection, the combination of RPA-AcCRaV-F / RPA-AcCRaV-R as primers and AcCRaV-nfo-probe as probe can achieve specific detection of kiwifruit chlorotic ringspot virus.

[0104] Embodiments 4 to 12

[0105] The same as Example 3, all used the total RNA of Actinidia chinensis infected with AcCRaV as the template, the difference being that the reaction temperature and time were different during the RT-PRA reaction, as specifically listed in Table 6.

[0106] Table 6 Conditions of RT-PRA reaction in Examples 3 to 12

[0107] RT-PRA Temperature RT-PRA Time Example 3 40 30 Example 4 40 25 Example 5 40 20 Example 6 40 15 Example 7 40 10 Example 8 35 30 Example 9 35 25 Example 10 35 20 Embodiment 11 35 15 Example 12 35 10

[0108] Examples 3 to 12 LFD test results are as follows Figure 4 As shown, Figure 4 N in the figure indicates the test result of the negative control group (using non-toxic total RNA of Actinidia chinensis as template, RT-PRA temperature of 40℃, and time of 30min). Figure 4 It can be seen that when the reaction temperature is 40°C, the virus can be detected after only 10 minutes of reaction, but the band is weak; when the reaction temperature is 35°C, the virus can be detected after only 20 minutes of reaction, but the band is weak. The best reaction condition of the present invention is 40°C for 20 minutes.

[0109] Example 13

[0110] Comparison of sensitivity among RT-PRA, RT-PCR and RT-qPCR

[0111] (1) Using the cDNA synthesized in step 2 of Example 1 as a template, high-fidelity PCR was performed using primers AcCRaV-F for cloning the full-length AcCCRaV coat protein gene and T7-AcCRaV-R with a T7 promoter sequence added to the 5' end (the nucleotide sequence of AcCRaV-F is as shown in SEQ ID NO.8: 5'-GTGGAAGAACCACAATATT-3'; the nucleotide sequence of T7-AcCRaV-R is as shown in SEQ ID NO.9: 5'-TAATACGACTCACTATAGGGATGCCAAAGCCTATGCAAGG-3') to obtain DNA. The reaction system and conditions are shown in Table 7 below.

[0112] Table 7 High-fidelity PCR reaction system and conditions

[0113]

[0114] (2) Using the purified DNA obtained in step (1) as a template, an in vitro transcription experiment was performed using the TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific); the specific operation steps were referred to the instruction manual to obtain RNA transcripts.

[0115] (3) Using RNA Clean & Concentrator TM -5 kit (Zymo Research) to purify the RNA transcript obtained in step (2). For specific operation steps, refer to the instruction manual.

[0116] (4) Agarose gel electrophoresis is used to detect the size and integrity of the RNA transcripts purified in step (3).

[0117] a. Dilute the RNA transcript 20-40 times with DEPC water to a final concentration of 0.1-0.5 μg / μL.

[0118] b. Take 2-4 μL of diluted RNA transcript (0.5-1 μg) and mix it evenly with an equal volume of 2×RNALoading DyeSolution;

[0119] c. Heat at 70°C for 10 min (heating RiboRuler RNALadder and RNA transcripts in b simultaneously).

[0120] d. Ice bath for 3 min (RiboRuler RNALadder and RNA transcripts) and briefly mix before loading;

[0121] e. Take 1.5 μL RiboRuler RNALadder and 3 μL RNA transcripts and load them onto 1% agarose gel and run at 180V for 20 min. Then observe and record the size and integrity of RNA transcripts under an agarose gel imager. The results are as follows: Figure 5 As shown in the figure, M represents the marker and 1 represents the size of the synthesized RNA transcript. Figure 5 It can be seen that the size of the synthesized RNA transcript is 945 bp, which is consistent with the full length of the AcCRaV coat protein gene.

[0122] (5) 1 ng / μL AcCRaV coat protein RNA transcript was serially diluted 10-fold (i.e., from 1 ng / μL to 10 -10 ng / μL, specifically 1ng / μL, 10 -1 ng / μL, 10 -2 ng / μL, 10 -3 ng / μL, 10 -4 ng / μL, 10 -5 ng / μL, 10 -6 ng / μL, 10 -7 ng / μL, 10 -8 ng / μL, 10 -9 ng / μL, 10 -10 ng / μL). One-step RT-RPA-LFD, RT-PCR, and RT-qPCR were performed using serially diluted AcCRaV coat protein RNA transcripts as templates to compare the sensitivity of the three detection methods. The specific operation of one-step RT-RPA-LFD was the same as in Example 3; PCR-AcCRaV-F and PCR-AcCRaV-R in Table 1 were used as amplification primer pairs, and PrimeScript TM One-step RT-PCR was performed using One Step RT-PCR Kit Ver.2 (Takara). For specific operations, refer to the instructions. qPCR-AcCRaV-F and qPCR-AcCRaV-R in Table 1 were used as the amplification primer pair. One Step TB PrimeScript TM RT-PCR Kit II (Perfect Real Time) (Takara) was used for one-step RT-qPCR. For specific operation, please refer to the instruction manual. The test results of one-step RT-RPA-LFD, RT-PCR, and RT-qPCR are as follows: Figures 6 to 8 ,in Figure 6 For RT-PCR test results, Figure 7 is the RT-RPA-LFD test result. Figure 8 is the result of RT-qPCR detection, where Figures 6 to 8 N in the figure indicates the negative control group (using non-toxic Actinidia chinensis total RNA as template).

[0123] according to Figures 6 to 8 It can be seen that the detection limit of RT-RPA-LFD is 10 -8 ng / μL, the detection limit of RT-qPCR was 10 - 7 ng / μL, the detection limit of RT-PCR is 10 -6 ng / μL. That is, the sensitivity of the RT-RPA-LFD of the present invention is the highest, which is 10 times that of RT-qPCR and 100 times that of RT-PCR.

[0124] Embodiment 14

[0125] Detection of AcCRaV from crude plant extracts

[0126] The tissue culture seedlings of Actinidia chinensis infected with AcCRaV were used as the test material. The leaf disc with a diameter of about 0.5 cm was taken with the lid of a 1.5 mL centrifuge tube and placed in 300 μL of freshly prepared alkaline PEG buffer (6% PEG 200, 20 mM NaOH). After a brief vortex, the extract was incubated at room temperature for 3 to 5 min. The crude plant extract was regarded as a 1× dilution and further 10-fold serial dilutions were performed. A total of 4 concentration gradients were set, namely 1-fold dilution, 10-fold dilution, 100-fold dilution and 1000-fold dilution, which were recorded as 1, 10 ... 1 , 10 2 and 10 3 . Then, 1 μL of crude extracts of different concentrations were taken as templates for RT-RPA reaction. After the reaction, terminal detection was performed using lateral flow chromatography test strips. The specific operation was the same as in Example 3. The detection results were as follows: Fig. 9 As shown, Fig. 9 N in the middle represents the negative control group (using the non-toxic crude extract of Actinidia chinensis as a template).

[0127] according to Fig. 9 It can be seen that the detection method of RT-RPA-LED of the present invention can successfully detect AcCRaV in the crude extract, and can still be detected after the crude extract is diluted 100 times. The present invention has high compatibility with templates.

[0128] Embodiment 15

[0129] according to Fig.10The flowchart is used for the rapid detection of AcCRaV in the field. Specifically, randomly selected kiwifruit leaves suspected of being infected with AcCRaV and kiwifruit leaves without virus symptoms are used as samples. A leaf disc with a diameter of about 0.5 cm is taken with the lid of a 1.5 mL centrifuge tube and placed in 300 μL of freshly prepared alkaline PEG buffer (6% PEG 200, 20 mM NaOH), and simply ground with a grinding rod. Incubate at room temperature for 3 to 5 minutes, and freeze the corresponding leaf samples in liquid nitrogen for subsequent RT-PCR detection. The specific operation is the same as in Example 13. Then, 1 μL of the crude extract of the corresponding sample is taken as a template for RT-RPA reaction. After the reaction, a lateral flow chromatography test strip is used for terminal detection. The specific operation is the same as in Example 3. The test results are shown in FIG. Fig.11 As shown, Fig.11 (A) is the PT-PCR test result; (B) is the RT-RPA-LFD test result. In (A) and (B), P represents the positive control (using the total RNA or crude extract of large-seeded kiwifruit infected with AcCRaV as a template), N represents the negative control group (using the total RNA or crude extract of non-toxic large-seeded kiwifruit as a template), and 1 to 10 are the test results of randomly selected kiwifruit leaves suspected of being infected with AcCRaV and kiwifruit leaves without virus symptoms. Specifically, numbers 1, 2, 3, 6 and 8 are kiwifruit leaves suspected of being infected with AcCRaV; numbers 4, 5, 7, 9 and 10 are kiwifruit leaf samples without virus symptoms. According to Fig.11 It can be seen that the RT-RPA-LFD detection results are consistent with the RT-PCR detection results, indicating that the RT-RPA-LED detection method of the present invention can be used to detect kiwifruit chlorotic ringspot virus.

[0130] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer pair for detecting kiwifruit chlorotic ringspot virus using RPA, characterized in that: It includes an upstream primer RPA-AcCRaV-F whose sequence is shown in SEQ ID NO.1 and a downstream primer RPA-AcCRaV-R whose sequence is shown in SEQ ID NO.

2.

2. A primer set for detecting kiwifruit chlorotic ringspot virus using RPA-LFD, characterized in that: It includes an upstream primer RPA-AcCRaV-F whose sequence is shown in SEQ ID NO.1, a downstream primer RPA-AcCRaV-R whose sequence is shown in SEQ ID NO.2, and a probe Ac CRaV-nfo-probe whose sequence is shown in SEQ ID NO.3; The Y in the probe AcCRaV-nfo-probe is replaced by [THF], a FITC label is added to the 5' end of the probe AcCRaV-nfo-probe, and a polymerase amplification blocking group is added to the 3' end.

3. A detection kit for detecting kiwifruit chlorotic ringspot virus using RPA-LFD, characterized in that: The method comprises the primer set according to claim 2, a reaction buffer and a positive control.

4. The detection kit according to claim 3, characterized in that Also included are reverse transcription reagents, nucleic acid extraction reagents, and RNase inhibitors.

5. A method for detecting kiwifruit chlorotic ringspot virus based on RT-RPA-LFD, characterized in that: The steps include: Extracting total RNA from a sample containing kiwifruit chlorotic ringspot virus; Using the primer set described in claim 2 to perform RT-RPA reaction on total RNA to obtain RPA product; The RPA product is detected using a lateral flow chromatography test strip to determine whether the kiwifruit sample to be tested contains kiwifruit chlorotic ringspot virus.

6. The method according to claim 5, characterized in that When performing the RT-RPA reaction, based on a total system of 50 μL, 150-600 nM upstream primer RPA-AcCRaV-F, 150-600 nM downstream primer RPA-AcCRaV-R, 50-150 nM probe AcCRaV-nfo-probe, 29.5 μL Primer Free Rehydration buffer, 1 μL total RNA, 1 μL M-MLV reverse transcriptase, 1.4 μL RNase Inhibitor, 2.5 μL 280 mM magnesium acetate and the remainder RNase-free H2O were added to a dry powder reaction tube; The dry powder reaction tube contains recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase.

7. The method according to claim 6, characterized in that The temperature of the RT-RPA reaction is 35-40° C., and the reaction time is 10-30 min.

8. The method according to any one of claims 5 to 7, characterized in that: The judgment method comprises: after dropping the RPA product into the sample application area of ​​the lateral flow chromatography test strip, vertically inserting the test strip into the analysis buffer MGCBB, incubating for 5 to 15 minutes, taking out the test strip and reading the result, if purple-red lines appear at both the quality control line and the detection line on the test strip, it is judged as a positive sample; if only a purple-red line appears at the quality control line on the test strip, it is judged as a negative sample.

9. The method according to claim 8, characterized in that The assay buffer MGCBB comprises citrate phosphate buffer.

Images