MAD7-NLS fusion protein, vector and application thereof for rice gene editing

Abstract

The present invention discloses a MAD7-NLS fusion protein, a vector and an application thereof for rice gene editing. A nuclear localization signal peptide amino acid sequence is added to the N-terminus of the MAD7 protein, and a nuclear localization signal peptide amino acid sequence is added to the C-terminus to obtain a MAD7-NLS fusion protein. The crRNA expression cassette of the MAD7-NLS fusion protein includes a gene editing target, a promoter and two crRNA sequences of the MAD7 protein, which are 35nt-CrRNA and 21nt-CrRNA, respectively. The 3' end of the nucleotide sequence of the crRNA is connected to a tRNA sequence. Treating rice callus at 42°C for 4h in the rice genetic transformation screening stage can significantly improve the gene editing efficiency of the MAD7 nuclease, and most of the MAD7 mutation types are deletions of 6-50nt. The complete expression vector contains the above-mentioned crRNA expression cassette and the nucleotide sequence of the MAD7-NLS fusion protein, and the above-mentioned expression vector can efficiently achieve knockout editing of rice genes.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and in particular to a MAD7 protein for rice gene editing, an expression vector and an expression cassette thereof. Background Art

[0002] MAD7, a Type Va CRISPR-Cas protein developed by INSCRIPTA, is a protein discovered in Eubacterium rectale and has been widely used in gene editing in plants, animals, and microorganisms. MAD7 is a homologous gene from the same family as LbCpf1 from Lachnospiraceae bacteria, FnCpf1 from Francisella novicida, and AsCpf1 from Acidaminococcus sp. While MAD7 shares only 31% identity with AsCpf1, its PAM site recognition region is highly similar. MAD7 effectively recognizes the PAM site "YTTN." Its gene editing characteristics are similar to those of many Cas12a nucleases. Its PAM site recognition is primarily T / A-rich, and its crRNA is typically 21 nt. The cleavage site is distal to the PAM site, with sticky end cleavage. Genomic mutations are primarily deletions of 8 or more bp.

[0003] The MAD7 protein consists of 1263 amino acids and is approximately 148 kDa. This is smaller than the commonly used SpCas9 protein from Streptococcus pyogenes (which contains 1368 amino acids), making it more suitable for vector-based delivery. Developed by INSCRIPTA, MAD7 has been tested in Escherichia coli, Saccharomyces cerevisiae, and animal cell lines, demonstrating its effectiveness in gene editing applications.

[0004] In the prior art, the document "Expanding and understanding the CRISPR toolbox for Bacillus subtilis with MAD7 and dMAD7" (Price MA, Cruz R, Bryson J, et al) discloses the use of a MAD7-based gene editing method for gene editing in Bacillus subtilis, with an editing efficiency of over 90%. They also designed MAD7 inactivation mutants (dMAD7, D877A, E962A, and D1213A), created a dMAD7-based CRISPRi technology, and demonstrated significant effects in Bacillus subtilis tests. The paper "Genome editing in plants with MAD7 nuclease" (Lin Q, Zhu Z, Liu G, et al) disclosed the application of MAD7 in rice and wheat gene editing. The editing efficiency of this nuclease in plants is average, and the highest editing efficiency can only reach 65%. By fusing MAD7 variants and APOBEC3A, the researchers established MAD7-based ABE base editing technology and successfully applied it to the field of rice and wheat gene editing.

[0005] In summary, even though the application of MAD7 in rice has been reported, it is necessary to develop a more efficient gene editing system to meet the needs of rice genetic engineering and enrich the toolbox of rice gene editing. Summary of the Invention

[0006] In response to the above deficiencies in the prior art, the present invention provides a MAD7-NLS fusion protein with higher editing efficiency, its expression cassette, and complete expression vector, enriching the toolbox for rice gene editing.

[0007] Another object of the present invention is to provide the application of a complete expression vector of the MAD7-NLS fusion protein, including the steps of screening and treating resistant callus tissue, which significantly improves the efficiency of MAD7 in rice gene editing.

[0008] To achieve the above objectives, the present invention explores the application of MAD7 nuclease in rice gene editing systems. From optimizing the MAD7 nucleotide sequence based on rice codon preference to optimizing the structure of the expression vector and the conditions for rice genetic transformation, a comprehensive design is designed to improve the efficiency of MAD7 in plant gene editing and enhance its application in plant gene editing breeding. This is achieved specifically through the following technologies.

[0009] A MAD7 nuclease for rice gene editing, characterized in that its nucleotide sequence is shown in SEQ ID NO.1.

[0010] A MAD7-NLS fusion protein for rice gene editing is prepared by adding an SV40 nuclear localization signal peptide amino acid sequence to the N-terminus of the MAD7 amino acid sequence and adding a nucleoplasmin nuclear localization signal peptide amino acid sequence to the C-terminus.

[0011] Preferably, the above-mentioned MAD7-NLS fusion protein is further optimized based on the amino acid sequence of MAD7 and the preference of rice codons.

[0012] Preferably, the amino acid sequence of the MAD7 nuclease is shown as SEQ ID NO.2, and the nucleotide sequence of the MAD7-NLS fusion protein is shown as SEQ ID NO.3.

[0013] The present invention also provides a MAD7-NLS fusion protein expression vector for rice gene editing, which contains the nucleotide sequence of any of the above-mentioned MAD7-NLS fusion proteins and the CCDB sequence. This MAD7-NLS fusion protein expression vector can be assembled with the crRNA expression cassette of the MAD7-NLS fusion protein to obtain a complete expression vector of the corresponding MAD7-NLS fusion protein.

[0014] Preferably, the blank vector used is pEGOEPubi-H vector.

[0015] Furthermore, the steps for constructing the above-mentioned empty vector for MAD7-NLS fusion protein expression include:

[0016] S1. Using primers MAD7-F and MAD7-R, amplify the nucleotide sequence of the MAD7-NLS fusion protein, and then ligate the amplified sequence to the blank vector to obtain the pEGOEPubi-H-MAD7 vector;

[0017] S2. Use primers CCDB-F and CCDB-R to amplify the CCDB sequence, and then ligate the amplified sequence to the pEGOEPubi-H-MAD7 empty vector described in step S1 to obtain pEGMAD7Pubi-H empty vector.

[0018] Furthermore, the nucleotide sequence of the pEGMAD7Pubi-H empty vector is shown in SEQ ID NO.4.

[0019] The nucleotide sequences of the primers MAD7-F and MAD7-R used are:

[0020] MAD7-F:actagggtctcgcaccatgccgaagaagaagcgcaaggtgtc; (as shown in SEQ ID NO.10)

[0021] MAD7-R:actagggtctctcgcctcacttctttttcttagcctgtccggcctt; (as shown in SEQ ID NO.11)

[0022] The nucleotide sequences of primers CCDB-F and CCDB-R used are:

[0023] CCDB-F:gatcgggagcaccggtaagg aagcttctcgagagaccact; (as shown in SEQ ID NO.12)

[0024] CCDB-R:agtgccaagcttcactacgg ctgcagacgcgtcccggga; (as shown in SEQ ID NO. 13)

[0025] The above step S2 is to make the pEGMAD7Pubi-H empty and leave a tail that can infinitely assemble the crRNA expression box.

[0026] The present invention also provides a crRNA expression cassette of a MAD7-NLS fusion protein for rice gene editing, comprising an empty crRNA expression cassette and a gene editing target designed for a corresponding rice gene.

[0027] The crRNA expression cassette contains the 35nt-crRNA or 21nt-crRNA expressed by the above-mentioned MAD7-NLS fusion protein, and also includes a promoter for transcribing the corresponding rice gene editing target, and the 3' end of the 35nt-crRNA and the 21nt-crRNA is provided with a tRNA sequence.

[0028] The 35nt-crRNA or 21nt-crRNA expression cassette for the MAD7-NLS fusion protein is constructed by first designing a gene editing target sequence for the rice OsBEL gene, then assembling the promoter, 35nt-crRNA or 21nt-crRNA, and tRNA that transcribe the gene editing target into an empty crRNA expression cassette. The gene editing target and the empty crRNA expression cassette are then assembled and connected together. The gene editing target can be specifically designed based on the rice OsBEL gene. Alternatively, the rice OsU6a promoter can be used to transcribe the 35nt-crRNA or 21nt-crRNA for the MAD7-NLS fusion protein.

[0029] Furthermore, the purpose of providing a tRNA sequence at the 3' end of the 35nt-CrRNA and the 21nt-CrRNA is to improve the production efficiency of CrRNA in rice cells.

[0030] Preferably, the nucleotide sequence of the gene editing target is cttctagaagcacaagcgccgctcg; the nucleotide sequence of the 35nt-CrRNA of the MAD7-NLS fusion protein is shown in SEQ ID NO.5, and the nucleotide sequence of the 21nt-CrRNA of the MAD7-NLS fusion protein is shown in SEQ ID NO.6; the nucleoside sequence of the empty CrRNA expression cassette is shown in SEQ ID NO.7.

[0031] The steps of assembling the 35nt-CrRNA or 21nt-CrRNA expression cassette of the MAD7-NLS fusion protein are as follows:

[0032] P1 first round PCR: Primers BEL-F and Pgs-L were used to amplify the gene editing target sequence and tRNA sequence, and primers BEL-R and Pps-R were used to amplify the gene editing target sequence and OsU6a promoter;

[0033] P2 second round PCR: Using primers Pps-R and Pgs-L, the PCR product in step P1 was used as a template to amplify the complete crRNA expression cassette - OsU6a-p+crRNA+BEL-T+tRNA+polyT structure.

[0034] The nucleotide sequences of the primers used above are:

[0035] 35nt-BEL-F:ttctactcttgtagattagaagcacaagcgccgctcgaacaaagcaccagtggtc; (as shown in SEQ ID NO.14)

[0036] 35nt-BEL-R:ctaatctacaagagtagaaattccaaaggtcttttgacggcagccaagccagcac; (as shown in SEQ ID NO.15)

[0037] 21nt-BEL-F:cttgtagattagaagcacaagcgccgctcgaacaaagcaccagtggtc; (as shown in SEQ ID NO. 16)

[0038] 21nt-BEL-R:gtgcttctaatctacaagagtagaaattccggcagccaagccagcacc; (as shown in SEQ ID NO. 17)

[0039] Pps-R:tagaggtctctaccgactagtatggaatcggcagcaaagg; (as shown in SEQ ID NO.18)

[0040] Pgs-L: agtgggtctcgctcgacgcgtatccatccactccaagctc. (as shown in SEQ ID NO. 19)

[0041] The present invention also provides a complete expression vector of a MAD7-NLS fusion protein for rice gene editing, wherein the complete expression vector of the MAD7-NLS fusion protein is connected to an empty expression vector of the above-mentioned MAD7-NLS fusion protein and is also connected to a crRNA expression cassette of the above-mentioned MAD7-NLS fusion protein.

[0042] Preferably, the above-mentioned complete expression vectors of MAD7-NLS fusion protein are respectively vector pEGMAD7Pubi-H-35ntCrRNA-BEL and vector pEGMAD7Pubi-H-21ntCrRNA-BEL, the nucleotide sequence of the vector pEGMAD7Pubi-H-35ntCrRNA-BEL is shown in SEQ ID NO.8, and the nucleotide sequence of the vector pEGMAD7Pubi-H-21ntCrRNA-BEL is shown in SEQ ID NO.9.

[0043] The present invention also provides the application of the two complete expression vectors of MAD7-NLS fusion proteins, specifically: firstly, the complete expression vector of MAD7-NLS fusion protein is transferred into the strain and co-cultured with callus tissue, then resistant callus tissue is screened, and finally, the resistant callus tissue is treated.

[0044] Furthermore, the resistant callus tissue was treated at 30-42°C for 4 hours and then at 28°C for 20 hours for 7 consecutive days.

[0045] Preferably, the resistant callus is treated at 42° C. for 4 hours and then at 28° C. for 20 hours for 7 consecutive days.

[0046] The purpose of the above experimental group first treating with high temperature of 30-42°C for 4h is to improve the editing efficiency of MAD7-NLS fusion protein on rice OsBEL gene.

[0047] Compared with the prior art, the present invention is beneficial in that: the present invention provides a MAD7 fusion protein for rice gene editing, and based on the MAD7 fusion protein, obtains a MAD7 fusion protein expression vector and a CrRNA expression cassette, as well as a MAD7 fusion protein complete expression vector obtained by assembling the MAD7 fusion protein expression vector and the CrRNA expression cassette. After the complete expression vector is transferred into Agrobacterium and the treatment temperature of the resistant callus is adjusted, the editing efficiency of the rice OsBEL gene by the MAD7 fusion protein can be significantly improved, enriching the toolbox for rice gene editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is the pEGMAD7Pubi-H empty load map in the examples;

[0049] Figure 2 This is a diagram of the complete expression box structure of 35ntCrRNA-BEL in the embodiment;

[0050] Figure 3 This is a diagram of the complete expression box structure of 21ntCrRNA-BEL in the embodiment;

[0051] Figure 4 This is the gel run of the results of the second round of PCR of P2 in the embodiment:

[0052] Figure 5 This is a map of the complete expression vector pEGMAD7Pubi-H-35ntCrRNA-BEL in the examples;

[0053] Figure 6 This is a map of the complete expression vector pEGMAD7Pubi-H-21ntCrRNA-BEL in the examples;

[0054] Figure 7 This is a result diagram showing the specific types of bases deleted in the gene editing mutation in the application example. DETAILED DESCRIPTION

[0055] The technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments obtained by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0056] Example

[0057] In this example, the OsBEL gene (LOC_Os03g55240) of rice was selected as the research object for the experiment. The specific experimental steps are as follows:

[0058] 1. Construction of a gene-edited plant expression vector based on MAD7-NLS fusion protein

[0059] Based on rice gene editing experiments, literature, and experience, we selected the maize ubiquitin UBI promoter to drive the MAD7 gene, which has relatively efficient transcription and translation in rice. The construction process of the MAD7-NLS fusion protein expression vector pEGMAD7Pubi-H is as follows:

[0060] (1) Construction of the first step of MAD7-NLS fusion protein expression vector

[0061] The primers used are as follows:

[0062] MAD7-F:actagggtctcgcaccatgccgaagaagaagcgcaaggtgtc; (as shown in SEQ ID NO.10);

[0063] MAD7-R:actagggtctctcgcctcacttctttttcttagcctgtccggcctt; (as shown in SEQ ID NO. 11);

[0064] Primers MAD7-F and MAD7-R were used to amplify the complete sequence of the MAD7-NLS fusion protein. The template was synthesized from the entire gene according to the nucleotide sequence of the MAD7-NLS fusion protein (shown in SEQ ID NO.3). The amplified sequence was ligated into the pEGOEPubi-H empty vector, which was provided by Wuhan Aidijing Biotechnology Co., Ltd. The original empty vector is a plant expression vector empty vector containing the UBI promoter and NOS terminator elements, which can effectively express the MAD7 gene in plants. The amplification system is as follows:

[0065]

[0066] PCR reaction parameters:

[0067]

[0068] Then, the above fragments were recovered using a gel recovery kit and enzyme-digested and ligated using the Golden Gate method: 100 ng MAD7 fragment, 100 ng pEGOEPubi-H, 1 μL 10×CutSmart Buffer, 35 U T4 DNA ligase, 10 U BsaI restriction endonuclease, and sterile water were mixed to form a 10 μL system. The reaction was carried out in a 37°C incubator for 1 hour. The ligated mixture was transformed into DH5α Escherichia coli peptide-sensitive cells, and then subjected to bacterial testing and sequencing confirmation to form the final pEGOEPubi-H-MAD7 vector.

[0069] (2) Construction of the second step of MAD7-NLS fusion protein expression vector

[0070] The primers used are as follows:

[0071] CCDB-F:gatcgggagcaccggtaaggaagcttctcgagagaccact; (as shown in SEQ ID NO. 12);

[0072] CCDB-R: agtgccaagcttcactacggctgcagacgcgtcccggga; (as shown in SEQ ID NO. 13);

[0073] Using primers CCDB-F and CCDB-R, the CCDB sequence template was the pYLCRISPR / Cas9Pubi-H vector (a gift from the laboratory of South China Agricultural University); the amplified CCDB sequence was ligated to the pEGOEPubi-H-MAD7 empty vector, leaving a tail on the vector that can infinitely assemble the crRNA expression cassette based on Golden Gate technology, leaving the entire empty pEGMAD7Pubi-H (sequence shown in SEQ ID NO. 4). The amplification system is as follows:

[0074]

[0075] PCR reaction parameters:

[0076]

[0077] Then, the amplified CCDB fragment was recovered using a gel recovery kit; the pEGMAD7Pubi-H empty vector was constructed using the Gibson assembly method; the reaction system was: 5 μL Gibson assembly mix, 50 ng of the pEGOEPubi-H-MAD7 vector after enzyme digestion, 50 ng of the CCDB recovered fragment, and water was added to 10 μL. The reaction was carried out on a PCR instrument at 50°C for 30 minutes. The reaction solution was then transformed into DB3.1 Escherichia coli peptide-sensitive cells, and then after bacterial testing and sequencing confirmation, the pEGMAD7Pubi-H empty vector was finally constructed. The empty vector map is shown below. Figure 1 shown.

[0078] 2. Construction of 35nt-CrRNA or 21nt-CrRNA expression cassettes for MAD7-NLS fusion protein for rice gene editing

[0079] (1) Design of OsBEL gene editing target: cttctagaagcacaagcgccgctcg, PAM site is cttc, target sequence is tagagaagcacaagcgccgctcg. The present invention tests the small promoter that starts crRNA as OsU6a promoter, and tests two crRNAs of MAD7, namely:

[0080] 35nt-CrRNA:5'-gtcaaaagacctttggaatttctactcttgtagatnnnnnnnnnnnnnnnnnnnnn-3'; (as shown in SEQ ID NO. 6);

[0081] 21nt-crRNA: 5'-ggaatttctactcttgtagatnnnnnnnnnnnnnnnnnnnn-3'; (as shown in SEQ ID NO.7); the base N in the two crRNAs is any one of the bases A, T, G, and C;

[0082] (2) Assemble the target site using overlapping PCR to assemble 35nt-CrRNA or 21nt-CrRNA expression cassette:

[0083] P1, first round of PCR: primers BEL-F and Pgs-L were used to amplify the gene editing target sequence and tRNA sequence, and primers BEL-R and Pps-R were used to amplify the gene editing target sequence and OsU6a promoter;

[0084] P2, second round of PCR: using primers Pps-R and Pgs-L, the PCR product in step P1 was used as a template to amplify the complete crRNA expression cassette - OsU6a-p + crRNA + BEL-T + tRNA + polyT structure. The obtained 35nt crRNA-BEL and 21nt crRNA-BEL complete expression cassette structures are shown in the figure. Figure 2 、 3 As shown, the second round of PCR amplification results are shown in the gel diagram. Figure 4 shown.

[0085] The primers used were:

[0086] 35nt-BEL-F:ttctactcttgtagattagaagcacaagcgccgctcgaacaaagcaccagtggtc; (as shown in SEQ ID NO.14);

[0087] 35nt-BEL-R:ctaatctacaagagtagaaattccaaaggtcttttgacggcagccaagccagcac; (as shown in SEQ ID NO.15);

[0088] 21nt-BEL-F:cttgtagattagaagcacaagcgccgctcgaacaaagcaccagtggtc; (as shown in SEQ ID NO. 16);

[0089] 21nt-BEL-R:gtgcttctaatctacaagagtagaaattccggcagccaagccagcacc; (as shown in SEQ ID NO. 17);

[0090] Pps-R:tagaggtctctaccgactagtatggaatcggcagcaaagg; (as shown in SEQ ID NO.18);

[0091] Pgs-L: agtgggtctcgctcgacgcgtatccatccactccaagctc; (as shown in SEQ ID NO. 19);

[0092] The first round of PCR system is as follows:

[0093]

[0094]

[0095] In the second round of PCR system:

[0096] PCR reaction parameters:

[0097]

[0098] 3. Construction of a complete expression vector for MAD7-NLS fusion protein for rice gene editing

[0099] The amplified 35ntCrRNA-BEL and 21ntCrRNA-BEL fragments were recovered using a gel recovery kit, and then the 35ntCrRNA-BEL and 21ntCrRNA-BEL of the crRNA expression box were ligated with pEGMAD7Pubi-H empty vector using BsaI and T4 DNA ligase. The ligation was performed using the Golden Gate method to construct two complete expression vectors of MAD7-NLS fusion proteins, pEGMAD7Pubi-H-35ntCrRNA-BEL (as shown in SEQ ID NO.8) and pEGMAD7Pubi-H-21ntCrRNA-BEL (as shown in SEQ ID NO.9). The specific map is shown in FIG. Figure 5 、 6 shown.

[0100] Application Examples

[0101] The process of applying the complete expression vectors pEGMAD7Pubi-H-35ntCrRNA-BEL and pEGMAD7Pubi-H-21ntCrRNA-BEL constructed in the above embodiment to rice gene editing specifically includes:

[0102] 1. Rice genetic transformation process

[0103] (1) Induction of rice callus

[0104] Complete rice seeds were shelled, sterilized, washed, and dried on filter paper. An appropriate amount of seeds were inoculated into NB culture medium and cultured under light at 28-30°C for 8-10 days to induce callus tissue.

[0105] (2) Pre-culture of callus tissue

[0106] The rice calli induced in step (1) are selected to have dense structure, bright color and granular shape, and are transferred into pre-culture medium, and cultured under light at 28-30° C. for 3 days for transformation.

[0107] (3) Agrobacterium culture and Agrobacterium-mediated transformation

[0108] The pEGMAD7Pubi-H-35ntCrRNA-BEL and pEGMAD7Pubi-H-21ntCrRNA-BEL vectors were transformed into the Agrobacterium strain EHA105 by electroporation, positive bacteria were identified and cultured, and the bacteria were shaken. A certain amount of bacteria were collected and suspended in the Agrobacterium infection solution. The rice callus cultured under light for 3 days in step (2) was immersed in the above-mentioned Agrobacterium infection solution and shaken on a shaker at 150 rpm and 28°C for 10 minutes.

[0109] (4) Co-culture of Agrobacterium and callus

[0110] The rice callus after the infiltration in step (3) was placed on sterile filter paper and air-dried, and then the callus was transferred to the co-culture medium and cultured in the dark at 28° C. for 3 days.

[0111] (5) Screening of resistant callus

[0112] The callus tissue after 3 days of co-cultivation in step (4) was washed 4-5 times, then washed with carbenicillin solution, dried with filter paper, and inoculated on a screening medium containing hygromycin for screening. The culture conditions were 28° C. and light culture for 20-22 days, with one subculture in the middle until resistant callus tissue grew.

[0113] (6) Treatment of resistant callus

[0114] The resistant calli of the two vectors obtained after the screening in step (5) were divided into two parts; one part was the control group CK, and the callus screening was performed normally; the other part was the experimental group EG, which was treated at 42°C, 4h / 28°C, 20h for 7 days. The callus tissue was taken after 7 days and its genomic DNA was extracted.

[0115] 2. Detection of mutation types of rice gene OsBEL

[0116] The present invention detects the type of gene editing mutation using a higher-throughput, more flexible and easy-to-use detection method and analysis software HiDecode based on second-generation sequencing. The detection method is based on PCR library construction using Illumina sequencing. First, a pair of specific primers are designed to amplify bands 200-250bp before and after the target site. A bridging sequence is added to the 5' end of the primer to amplify the target sequence in the first round. In the second round, the bridging sequence from the first round is used with universal library construction adapters: forward / reverse primers pos-N / plate-N (N = number): pos-N contains a 6-nt position-barcode indicating the 96 well positions (A1 to H12) corresponding to each sample on the PCR plate, a total of 96; plate-N contains a 6-nt plate-barcode indicating the PCR plate number. Universal amplification primers 2P-F / 2P-R are used: 2P-R contains an 8-nt barcode to mark the sample of the custom library. This is used to distinguish the custom library and inform the sequencing company so that they can split the custom library data according to the barcode. Finally, analysis with HiDecode software can obtain the mutation type of each target sequence in each sample.

[0117] The results of the rice OsBEL gene mutation type detection are shown in Table 1, and the specific deletion base type of the MAD7-NLS fusion protein gene editing mutation is shown in Table 1. Figure 7 :

[0118] Table 1 Results of rice OsBEL gene mutation types

[0119] Number of test samples Number of mutation samples Editing efficiency 35nt-CrRNA-CK 44 10 22.73％ 35nt-CrRNA-EG 67 43 64.18％ 21nt-CrRNA-CK 58 28 48.28％ 21nt-CrRNA-EG 57 41 71.93％

[0120] Note: CK is the control group; EG is the high temperature treatment group.

[0121] 3. Conclusion

[0122] The experimental results of the present invention show that the editing mutation results of the rice OsBEL gene by the experimental MAD7 nuclease are analyzed. The editing efficiency of the 21nt CrRNA assembly target is higher than that of the 35nt CrRNA assembly target. It is designed to use a temperature of 42°C to treat rice callus tissue in the rice genetic transformation screening stage. The test results show that treating rice callus tissue at 42°C can significantly improve the efficiency of MAD7 in rice OsBEL gene editing. Cas12a nucleases cut genomic DNA mostly with sticky ends, and the mutation type is mainly fragment deletion. The mutation types of the above 122 mutant samples were analyzed, of which deletions within 10bp accounted for 37.50%, deletions within 11-50bp accounted for 40%, and deletions above 50bp accounted for 22.51%. The results reflect that when using MAD7 nuclease for gene editing, nearly 80% of the mutation types are deletions within 50bp.

[0123] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details of the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

Claims

1. A complete expression vector of MAD7-NLS fusion protein for rice gene editing, characterized in that: Includes an empty MAD7-NLS fusion protein expression vector and a crRNA expression cassette; The MAD7-NLS fusion protein expression vector is an empty vector with the nucleotide sequence of the MAD7-NLS fusion protein connected to the blank vector, and also contains a CCDB sequence; the MAD7-NLS fusion protein is a MAD7 nuclease with an SV40 nuclear localization signal peptide added to the N-terminus and a nucleoplasmin nuclear localization signal peptide added to the C-terminus; the nucleotide sequence of the MAD7 nuclease is shown in SEQ ID NO.1; the amino acid sequence of the MAD7 nuclease is shown in SEQ ID NO.2, and the nucleotide sequence of the MAD7-NLS fusion protein is shown in SEQ ID NO.3; The crRNA expression cassette includes an empty crRNA expression cassette and a gene editing target designed for a specific rice gene; the empty crRNA expression cassette includes 35nt-crRNA or 21nt-crRNA for expressing the MAD7-NLS fusion protein, and also includes a promoter for transcribing a specific rice gene editing target; the nucleotide sequence of the 35nt-crRNA is shown in SEQ ID NO.5, and the nucleotide sequence of the 21nt-crRNA is shown in SEQ ID NO.6; the gene editing target is cttctagaagcacaagcgccgctcg, the PAM site is cttc, and the target sequence is tagaagcacaagcgccgctcg.

2. The complete expression vector of MAD7-NLS fusion protein for rice gene editing according to claim 1, characterized in that: The nucleoside sequence of the empty crRNA expression cassette is shown in SEQ ID NO.

7.

3. The complete expression vector of MAD7-NLS fusion protein for rice gene editing according to claim 1, characterized in that: The complete expression vector of the MAD7-NLS fusion protein is the vector pEGMAD7Pubi-H-35ntCrRNA-BEL or the vector pEGMAD7Pubi-H-21ntCrRNA-BEL, the nucleotide sequence of the vector pEGMAD7Pubi-H-35ntCrRNA-BEL is shown in SEQ ID NO.8, and the nucleotide sequence of the vector pEGMAD7Pubi-H-21ntCrRNA-BEL is shown in SEQ ID NO.

9.

4. A method for rice gene editing using the complete expression vector of the MAD7-NLS fusion protein according to any one of claims 1 to 3, characterized in that: First, the complete expression vector of the MAD7-NLS fusion protein is transferred into the strain and co-cultured with the callus tissue, then the resistant callus tissue is screened, and finally the resistant callus tissue is treated; The resistant callus tissue was treated by first treating it at 42° C. for 4 hours and then treating it at 28° C. for 20 hours every day for 7 consecutive days.

Images