A method of detecting a target

By conjugating antibodies to an immobilized vector and binding them to aptamers, followed by PCR amplification, the problem of insufficient protein detection sensitivity was solved, achieving highly sensitive quantitative detection, simplifying the process and reducing equipment requirements.

CN116103367BActive Publication Date: 2025-12-23HANGZHOU BAICHEN MEDICAL LAB CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211415755.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-11
Publication Date
2025-12-23
Estimated Expiration
2042-11-11

AI Technical Summary

Technical Problem

Existing protein detection methods are not sensitive enough, and traditional methods are complex, require high-precision equipment, and are costly, which hinders their widespread application in scientific research and medical diagnostics.

Method used

Antibodies are conjugated to a fixed vector to bind aptamers and targets. The specifically bound aptamers are amplified by PCR technology to amplify the signal, and ultra-high sensitivity quantitative detection is achieved using simple sample processing.

Benefits of technology

It achieves a sensitivity improvement of 2-4 orders of magnitude, reaching a detection capability at the 1pg/mL level, simplifies the detection process, reduces the requirements for instruments, and is suitable for market promotion.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116103367B_ABST
    Figure CN116103367B_ABST
Patent Text Reader

Abstract

The present disclosure provides a method for detecting a target object, comprising coupling an antibody to a fixed carrier and blocking the fixed carrier using a blocking solution; incubating a pretreated sample with the blocked fixed carrier, washing, and further incubating with an aptamer; washing the fixed carrier after the washing step using washing buffer II; eluting the fixed carrier, and detecting the aptamer by PCR.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and in particular, relates to a method for detecting a target and a kit for detecting a target. BACKGROUND

[0002] A biomarker is a common biochemical indicator of a certain characteristic in a physiological or pathological or therapeutic process that can be objectively measured and evaluated. By measuring it, the current progress of the organism in the biological process can be known. Checking a disease-specific biomarker has important guiding significance for disease identification, early diagnosis and prevention, and monitoring during treatment. Generally, these biomarkers, such as proteins, have low content in the early stage of disease occurrence, and traditional methods are difficult to achieve accurate and effective detection. To achieve early and accurate detection of biomarkers, an ultra-high sensitivity quantitative detection method is needed.

[0003] Protein detection technology based on the principle of antigen-antibody immunization, such as enzyme-linked immunosorbent assay (ELISA), is a commonly used protein detection method in clinical practice. Its detection principle is: through the enrichment of the target to be detected by the antibody, and then through the detection of the optical signal, the relationship between the optical signal intensity and the concentration of the captured target is established, and then quantitative detection is realized. However, due to the limitations of detection technology, there is a certain background signal, when the concentration of the target molecule in the liquid is lower than a certain value, the detection signal will be overwhelmed by the background signal, resulting in a large deviation in the detection signal in the low concentration range, making it difficult to achieve accurate quantification. The sensitivity of classical enzyme-linked immunosorbent assay technology can only reach pg / mL level, and it is often difficult to detect ultra-low abundance proteins.

[0004] Single molecule detection methods are different from traditional detection methods. The molecules to be detected can be directly or indirectly labeled (such as enzyme labeling, fluorescent dye labeling, metal particle labeling, etc.), and the light, electrical, etc. signals can be detected by using precise instruments. Since it is necessary to recognize the signals of several or even single molecules, the requirements for instruments and equipment are extremely high, and the cost of equipment is often extremely high, which seriously hinders the popularization and application of these technologies in scientific research and medical diagnosis markets. In addition, the extremely weak single molecule signal can be amplified to a level that can be easily detected by the device through signal amplification. For example, for the detection of nucleic acid molecules, the nucleic acid molecules to be detected are directly amplified by polymerase chain reaction, and the fluorescence signal is amplified, and the current digital PCR technology can achieve single molecule level detection.

[0005] Compared with the amplification of nucleic acid molecules, the sensitivity of existing protein detection methods is not high enough. Detection techniques based on direct or indirect signal labeling often require precise instruments, which are expensive. There is an urgent need to develop a simple and effective, low-cost detection method that can achieve ultra-high sensitivity quantitative detection of protein markers through simple sample processing.

[0006] The existing low-abundance protein marker detection technology has many defects such as complex detection system, high precision requirement of detection equipment, poor stability and high cost. These problems greatly hinder the popularization and application of protein marker detection in the market of scientific research and medical diagnosis. SUMMARY

[0007] In one aspect, the present disclosure provides a method for detecting a target, comprising the following steps:

[0008] 1) coupling an antibody to a fixed carrier and blocking the fixed carrier with a blocking solution, and then optionally washing with a buffer solution;

[0009] 2) incubating the pretreated sample with the fixed carrier obtained in step 1), and the antibody binds to the target;

[0010] 3) washing the fixed carrier obtained in step 2) with a buffer solution;

[0011] 4) incubating an aptamer with the fixed carrier obtained in step 3), and the aptamer binds to the target; wherein the aptamer is dissolved in a buffer solution containing 0 mg / mL to 0.1 mg / mL salmon sperm DNA;

[0012] 5) washing the fixed carrier obtained in step 4) with a buffer solution; wherein the buffer solution comprises salmon sperm DNA with a final concentration ranging from greater than 0 mg / mL to 0.1 mg / mL and DxSO4 with a final concentration ranging from 20 μM to 40 μM;

[0013] 6) adding an eluent to the fixed carrier obtained in step 5), collecting the eluent, and detecting the aptamer by PCR.

[0014] In one embodiment, the fixed carrier is selected from magnetic beads, microspheres, enzyme-labeled plates or centrifuge tubes, and preferably is magnetic beads. Those skilled in the art should understand that as long as the antibody can be coupled to the carrier of the solid-state medium, it is called a fixed carrier. In a specific embodiment, the surface of the fixed carrier is modified with chemical groups such as hydroxyl, carboxyl, amino or sulfonyl, or with streptavidin. Preferably, the coupling is covalent coupling. For example, the modified group on the fixed carrier can be covalently coupled with the antibody. Alternatively, the streptavidin (SA) on the fixed carrier is coupled with the biotin-modified antibody.

[0015] The antibody in the present disclosure refers to a protein capable of recognizing and binding to the target in the sample, which can be a complete antibody or an antigen-binding fragment. The antibody can be a monoclonal antibody, a diabody or a multibody, and can also be a single-chain antibody, a nanobody, etc.

[0016] In one embodiment, the target is selected from one or more of a protein, a polysaccharide, a biologically active small molecule, and a complex of a small molecule and a protein.

[0017] In one embodiment, in step 1), after blocking, further comprises washing the immobilization support with a buffer.

[0018] In one embodiment, the blocking solution is selected from BSA, skim milk, casein, salmon sperm DNA, herring sperm DNA, yeast tRNA, or Tween-20, preferably BSA. In one embodiment, the blocking solution is at a concentration of 0.05% to 20%; preferably, the blocking solution is at a concentration of 0.1% to 10%, more preferably 3% to 10%. The blocking time is more than 15 seconds, such as 15 seconds, 30 seconds, 1 minute, 5 minutes, 10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, or 24 hours. The blocking temperature is room temperature or 37°C.

[0019] In one embodiment, in step 4), the final concentration of the aptamer is 1 pM to 100 nM, preferably 1 nM to 50 nM, more preferably 1 nM (the amount of aptamer is 0.1 pmol), and the amount of the immobilization support is 10 μg to 100 μg, more preferably 50 μg. In one specific embodiment, the aptamer is a specific binding nucleic acid sequence that can bind to the target. It can bind to the target through a second antigen epitope, which is different from the antibody binding site. The binding force includes hydrogen bond, van der Waals force, ionic force, hydrophobic interaction, etc. Alternatively, the incubation is performed at room temperature for 10 to 90 minutes, preferably 30 to 60 minutes.

[0020] In one embodiment, in step 4), the pretreated sample is a sample that has been subjected to serum or plasma separation. The sample can be prepared after dilution. The sample can be diluted using a washing buffer I. In one embodiment, the incubation temperature of the sample with the antibody-coupled immobilization support is between 10-50°C, preferably between 20-40°C, most preferably 25°C; the incubation time is preferably between 20-90 minutes, preferably between 30-60 minutes; and the incubation can be performed with rotation.

[0021] In one embodiment, the buffer used in step 1) or 3) comprises a buffer salt, such as PBS or DPBS.

[0022] In one embodiment, the buffer used in step 5) comprises 0.1 mg / mL salmon sperm DNA, 20 μM to 40 μM of DxSO4, and a buffer salt; preferably, the concentration of DxSO4 is 20 μM.

[0023] In one embodiment, the PBS can consist of 135 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8 mM K2HPO4, and the buffer can further contain 0.2% BSA (bovine serum albumin) and 0.05% TW-20, and the buffer pH is 7.4; the DPBS can consist of 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2, and the buffer can further contain 0.2% BSA (bovine serum albumin) and 0.05% TW-20, and the buffer pH is 7.4. It is understood by one skilled in the art that the specific composition and concentration of the phosphate in the buffer can be adjusted as appropriate as long as the ability to buffer the pH is maintained, and thus, in various embodiments, it is understood by one skilled in the art that the specific composition and concentration of the phosphate is not necessarily limited to the values in the examples.

[0024] In one embodiment, the method of detecting the aptamer can be fluorescent PCR, and the qPCR amplification can be detected by a fluorescent dye method, such as SYBR Green or a Taqman probe method. The Taqman probe is an aptamer sequence-specific probe, one end of which is labeled with a fluorescent group, such as FAM, VIC, HEX, CY5, etc., and the other end is labeled with a quenching group, such as BHQ1, BHQ2, etc.

[0025] In another aspect, the present disclosure provides a buffer solution comprising salmon sperm DNA at a final concentration ranging from greater than 0 mg / mL to 0.1 mg / mL, DxSO4 at a final concentration ranging from 20 μM to 40 μM, and a buffer salt. Preferably, the buffer is a phosphate buffer, such as PBS or DPBS.

[0026] The present disclosure provides the use of the above-mentioned buffer solution in the preparation of a kit for detecting a target. Preferably, the target is selected from one or more of a protein, a polysaccharide, a biologically active small molecule, and a complex of a small molecule and a protein. The target can be multiple components, and the aptamer can also be multiple sequences.

[0027] In a specific embodiment of the present disclosure, the steps of the method include:

[0028] In step 1), after the capture antibody is bound to the solid phase carrier, the surface of the solid phase carrier is blocked with a blocking agent selected from BSA, skim milk, casein, salmon sperm DNA, herring sperm DNA, yeast tRNA or Tween-20, preferably BSA. The concentration of BSA is 0.05% to 20%, preferably 3% to 10%, and the blocking time is 1 hour. After the blocking is completed, 200 μL of washing buffer I (DPBS pH 7.4: 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2; 0.2% BSA, 0.05% Tw-20) is used for washing 1 to 5 times.

[0029] In step 2), the incubation temperature of the sample with the capture antibody is 10 to 50°C, preferably 20 to 40°C, and most preferably 25°C; the incubation time is preferably 20 to 90 minutes, preferably 30 to 60 minutes, and the rotation incubation is performed. After the incubation is completed, in step 3), 200 μL of binding & washing buffer I (DPBS pH 7.4: 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2; 0.05% Tw-20) is used for washing 3 times, 200 μL each time.

[0030] In step 4), 100 μL of aptamer solution is added to the magnetic beads bound with the target, the aptamer is dissolved in a binding & washing buffer II (DPBS pH 7.4: 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2; 0.2% BSA, 0.1 mg / mL salmon sperm DNA, 0.05% Tw-20), and the concentration is 1 pM to 100 nM, preferably 1 nM to 50 nM, and more preferably 1 nM. The rotation incubation is performed at room temperature for 10 to 90 minutes, preferably 30 to 60 minutes. After the incubation is completed, 200 μL of washing buffer II (DPBS pH 7.4: 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2; 0.2% BSA, 0.1 mg / mL salmon sperm DNA, 10 to 40 μM, preferably 20 μM of DxSO4, 0.05% Tw-20) is used for washing 3 times, and the binding & washing buffer II is used for washing once to remove the aptamer sequence not bound with the target.

[0031] After the washing is completed, 50 μM 2 mM NaOH is added to the above system, and the rotation incubation is performed for 10 minutes to elute the DNA specifically bound with the target.

[0032] Take 2 μL of supernatant as a template for qPCR amplification. qPCR amplification can be detected by fluorescent dye method, such as SYBR Green or taqman probe method. Taqman probe is an aptamer sequence specific probe, one end of which is labeled with a fluorescent group, such as FAM, VIC, HEX, CY5, etc., and the other end is labeled with a quenching group, such as BHQ1, BHQ2, etc.

[0033] The fluorescent PCR reaction system by probe method is as follows: 1 U DNA polymerase, 1X PCR Buffer, 0.2 mM dNTP, 0.1 to 1 μM forward primer, 0.1 to 1 μM reverse primer, 0.05 to 0.5 μM Taqman probe, 2 μL template DNA, and the final reaction system is 25 μL.

[0034] PCR reaction program: 95℃ for 5 minutes, 94℃ for 30 seconds, 50-60℃ for 30 seconds and collect fluorescence signal, 72℃ for 30 seconds, a total of 50 cycles, 72℃ for 30 seconds, 25℃ for 5 minutes. After the reaction, the data is analyzed according to the software of the PCR instrument, and the Ct value of the amplification curve is recorded.

[0035] Beneficial effects

[0036] The method in some specific embodiments of the present disclosure is based on the specific binding of aptamer to target and the amplifiable nature. By PCR technology, the aptamer specifically bound to the target to be detected is amplified, the signal is amplified, and the quantitative detection of trace target is realized. At the same time, specific probes are designed according to the different sequences of different target aptamers, and the simultaneous detection of multiple targets is realized.

[0037] Through the method, the antibody and the aptamer have dual-specific recognition to the target, which increases the specificity of the method; the aptamer specifically bound to the target to be detected is subjected to fluorescent PCR amplification, the signal is amplified, and the trace target is detected through the relationship between the content of the aptamer and the target to be detected. Compared with the traditional detection method, the sensitivity can be improved by 2-4 orders of magnitude. The present application finds that, in some embodiments, the sensitivity reaches 1 pg / mL, and in other embodiments, the sensitivity can reach the level of 0.1 pg / mL at most.

[0038] In addition, compared with the prior art, the present application has lower requirements for instruments, simpler detection process, easier implementation, and is more conducive to market promotion and popularization. BRIEF DESCRIPTION OF DRAWINGS

[0039] The present application can be more fully understood with reference to the following drawings.

[0040] Figure 1 A flow chart of the aptamer protein detection process is shown.

[0041] Figure 2 Aptamer PCR amplification curves at different IGFBP3 concentrations are shown.

[0042] Figure 3 Aptamer PCR amplification curves at different PDGF-BB concentrations are shown.

[0043] Figure 4 Comparison of magnetic beads non-specific adsorption of aptamers after blocking magnetic beads with different concentrations of BSA is shown.

[0044] Figure 5 Optimization of different aptamer concentrations is shown.

[0045] Figure 6 Aptamer amplification curves in single target detection and multiplex detection are shown. DETAILED DESCRIPTION

[0046] DEFINITIONS

[0047] The term "antibody" in the present application refers to a protein capable of recognizing and binding to a target in a sample, which can be a complete antibody or an antigen-binding fragment. The antibody can be a monoclonal antibody, a diabody or a multibody, and can also be a single-chain antibody, a nanobody, etc.

[0048] The term "immobilized carrier" in the present application refers to a carrier that can couple an antibody to its solid-state medium, and is referred to as an immobilized carrier. The immobilized carrier includes but is not limited to magnetic beads, microspheres, enzyme-labeled plates or centrifuge tubes. Those skilled in the art will understand that the surface of the immobilized carrier is modified with chemical groups such as hydroxyl, carboxyl, amino or sulfonyl, or with streptavidin. Preferably, the coupling is covalent coupling; or, the modified group on the immobilized carrier is capable of covalent coupling with the antibody. Alternatively, streptavidin (SA) on the immobilized carrier is coupled with biotin-modified antibody.

[0049] The term "buffer" in the present application refers to a solution with the ability to buffer pH value, and those skilled in the art will understand that the specific components and concentrations of various salts in the buffer can be appropriately adjusted and do not necessarily have to be limited to the specific values in the examples.

[0050] In the present disclosure, washing buffer I, binding & washing buffer I, washing buffer II and binding & washing buffer II are used. The specific components and concentrations of various salts can be appropriately adjusted and do not necessarily have to be limited to the specific values in the examples.

[0051] In one specific embodiment, the buffer formula can be shown in Table 1 without special instructions:

[0052] Table 1. Buffer formulations

[0053]

[0054]

[0055] For better understanding of the present application by those skilled in the art, the technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only a part of the embodiments of the present application, but not all the embodiments.

[0056] Method for detecting target in Example 1

[0057] 1. Covalent coupling of magnetic beads and capture antibody

[0058] (1) Take an appropriate amount of toluenesulfonyl activated M280 magnetic beads into a centrifuge tube, and add PBS for washing 2-3 times and finally make up to 30 mg / mL;

[0059] (2) Take 165 μL of the above magnetic beads into a new centrifuge tube, and use a magnet to adsorb for 1 minute, and remove the supernatant;

[0060] (3) 100 μg of capture antibody is diluted with 150 μL of 10 mM PBS buffer and added to the above centrifuge tube, mixed well, 100 μL of buffer C (3M ammonium sulfate dissolved in 100 mM PBS, pH 7.4) is added, vortexed and mixed, and incubated at 37°C for 12 to 18 hours;

[0061] (4) Place the centrifuge tube on a magnetic stand, stand for 2 minutes, remove the supernatant, wash with 100 mM PBS for 5 times, and add 1 mL of buffer D (0.5% BSA dissolved in 10 mM PBS, pH 7.4) for blocking. Mix well at 37°C for 1 hour;

[0062] (5) Wash with 10 mM PBS for 5 times, and use 500 μL of buffer E (0.1% (w / v) dissolved in 10 mM PBS, pH 7.4) for storage.

[0063] 2. Target binding

[0064] (1) Take 50 μg of antibody-coupled magnetic beads, remove the supernatant and incubate with 3% BSA blocking solution (DPBS pH 7.4: 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2; 3% BSA and 0.05% TW-20) for 1 hour, then wash with 200 μL of wash buffer I (Table 1) for 3 times, and reserve for use;

[0065] (2) Dissolve the target in the binding & washing buffer I (Table 1), and prepare solutions containing different concentrations of the target (1 nM, 100 pM, 10 pM, 1 pM, 100 fM, 10 fM);

[0066] (3) Add 100 μL of the diluted target solution to the centrifuge tube, and incubate at room temperature for 30 minutes;

[0067] (4) After the incubation, discard the supernatant, and wash the magnetic beads with 200 μL of the binding & washing buffer I (Table 1) for 3 times.

[0068] 3. Aptamer binding and elution

[0069] (1) Dissolve the aptamer (e.g. IGFBP3-Apt or PDGF-BB-Apt) in the binding & washing buffer II (Table 1), and add 100 μL of the dissolved aptamer (1 nM) to the magnetic beads, and incubate at room temperature for 30 minutes;

[0070] (2) After the incubation, wash the magnetic beads with 200 μL of the washing buffer II containing dextran sulfate (20 μM) for 3 times, and wash with the binding & washing buffer II once, and discard the supernatant;

[0071] (3) Add 30 μL of the eluent (2 mM NaOH, pH 11.0) to the magnetic beads, and vortex for 10 minutes, and collect the supernatant for PCR detection.

[0072] 4. PCR amplification

[0073] Take 2 μL of the supernatant as the template for qPCR amplification. Design a specific Taqman probe according to the sequence of the aptamer.

[0074] The reaction system is as follows: 1 U of DNA polymerase, 1 X PCR Buffer, 0.2 mM of dNTP, 0.1-1 μM of forward primer, 0.1-1 μM of reverse primer, 0.05-0.5 μM of Taqman probe, 2 μL of template DNA, and the final reaction system is 25 μL.

[0075] The PCR reaction program is as follows: 95 °C for 5 minutes, 94 °C for 30 seconds, 50-60 °C for 30 seconds and collect the fluorescence signal, 72 °C for 30 seconds, a total of 50 cycles, 72 °C for 30 seconds, and 25 °C for 5 minutes. After the reaction, analyze the data according to the software of the PCR instrument, and record the Ct value of the amplification curve. Calculate the Ct difference between the sample and the negative control without the target. Figure 2 、 3 ).

[0076] Effect of different concentrations of BSA blocking on removal of non-specific adsorption of magnetic beads

[0077] To remove the non-specific adsorption of magnetic beads to aptamers and improve the detection ability of the method for low-concentration proteins, the blocking effects of different concentrations of BSA were compared.

[0078] Take 50 μg of antibody-coupled magnetic beads and add them to a new 1.5 mL centrifuge tube. Remove the supernatant and wash three times with 200 μL of washing buffer I. Then add different concentrations of BSA (DPBS pH 7.4: 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2; 0.5%, 3%, or 10% BSA, 0.05% TW-20) and rotate for 1 hour at room temperature. After the blocking is complete, wash three times with 200 μL of washing buffer I (Table 1).

[0079] Add 100 μL of IGFBP3 aptamer (1 nM) dissolved in binding & washing buffer II (Table 1) to the above magnetic beads and rotate for 30 minutes at room temperature. After the incubation is complete, wash the magnetic beads three times with 200 μL of washing buffer II containing dextran sulfate (20 μM) and once with binding & washing buffer II, and remove the supernatant.

[0080] Add 30 μL of eluent (2 mM NaOH, pH 11.0) to the above magnetic beads and vortex for 10 minutes. Collect the supernatant for PCR detection.

[0081] From the above results, it can be seen that, within a certain range, the amount of aptamer bound to the magnetic beads gradually decreases as the concentration of BSA increases. However, when the concentration of BSA reaches 10%, the blocking effect is not as good as that of 3% BSA. Therefore, 3% BSA is selected as the blocking agent for blocking. Figure 4

[0082] Example 3: Optimization of aptamer amount

[0083] The experimental steps are the same as described in the example. After 50 μg of antibody magnetic beads are blocked with 3% BSA, add 100 μL of IGFBP3 standard solution (dissolved in binding & washing buffer I shown in Table 1, with a concentration of 10 pg / mL of IGFBP3), and at the same time, add an equal amount of binding & washing buffer I (Table 1) without target to the control group. Rotate and incubate for 30 minutes at room temperature. Discard the supernatant and wash three times with 200 μL of binding & washing buffer I (Table 1).

[0084] ​Add 100 μL of IGFBP3 aptamers (100 nM, 10 nM, and 1 nM, respectively) dissolved in the binding and washing buffer II shown in Table 1 to the magnetic beads, and incubate by rotation at room temperature for 30 minutes. After incubation, wash the magnetic beads three times with 200 μL of washing buffer II containing 20 μM dextran sulfate (Table 1) and wash once with binding and washing buffer II, then discard the supernatant.

[0085] Add 30 μL of elution buffer (2 mM NaOH, pH 11.0) to the magnetic beads, vortex for 10 minutes, and collect the supernatant for PCR detection.

[0086] Experimental results are as follows Figure 5 As shown, with increasing aptamer concentration, the amount of aptamer eluted from the magnetic beads gradually increases, while the Ct difference between the aptamer and the target-free control group gradually decreases. This indicates that excessive aptamer concentration increases non-specific adsorption of the magnetic beads, leading to increased background values ​​and hindering target detection. In this test, with a fixed target concentration, 1 nM aptamer (0.1 pmol of aptamer) achieved the maximum Ct difference (ΔCt = 2.22).

[0087] Example 4: Detergent Optimization

[0088] Following the procedure in Experiment 2, 50 μg of antibody magnetic beads captured 1 pg of IGFBP3 (100 μL). After washing, 100 μL of aptamer (1 nM) was added for incubation. Different concentrations of salmon sperm DNA (DPBS pH 7.4: 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 0.2% BSA; 0 or 0.1 mg / ml salmon sperm DNA, 0.05% TW-20) were added to this binding & washing buffer II.

[0089] After incubation, the DNA was washed three times with 200 μL of washing buffer II (DPBS pH 7.4: 1.5 mM KH2PO4, 8 mM Na2HPO4, 137 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 0.2% BSA, 0.1 mg / mL salmon sperm DNA, 0, 20, 40, or 80 μM DxSO4, 0.05% Tw-20) and once with binding & washing buffer II (0.1 mg / mL salmon sperm DNA, Table 1) to remove aptamer sequences that did not bind to the target.

[0090] After the experiment, 30 μΐ, of eluent (2 mM NaOH, pH 11.0) was added to the mixture and vortexed for 10 min. The supernatant was collected for PCR detection. A blank control without target was set for each experimental group. The Ct value difference between the experimental group (with target) and the blank control was compared.

[0091] IGFBP3 aptamer sequence and primer information:

[0092] IGFBP3-Apt: 5'-GGGACCAGCACACGCATAACCCTCACGGTATGTGCTGTATGTTCCTGTTGCC-3'

[0093] GGGACCAGCACACGCATAACCCTCACGGTATGTGCTGTATGTTCCTGTTGCCCTCCGGACCAGCACACGCATAACG

[0094] IGFBP3-F: GGGACCAGCACACGCATAAC

[0095] IGFBP3-R: CGTTATGCGTGTGCTGGTCC

[0096] IGFBP3-P: FAM-TATGTGCTGTATGTTCCTGTTGCC-BHQ1

[0097] PDGF-BB aptamer and primer information:

[0098] PDGF-BB-Apt: 5'-AGCAGCACAGAGGTCAGATGCACAGGCTACGGCACGTAGAGCATC ACCATGATCCTGTGTCCTATGCGTGCTACCGTGAA-3'

[0099] PDGF-BB-F: AGCAGCACAGAGGTCAGATG

[0100] PDGF-BB-R: TTCACGGTAGCACGCATAGG

[0101] PDGF-BB-P: VIC-ACGGCACGTAGAGCATCACCA-BHQ1

[0102] Table 2 shows the Ct value difference between the experimental group and the control group under different combinations of incubation and washing conditions. As shown in the table, the addition of a certain concentration (e.g. 0.1 mg / mL) of salmon sperm DNA in the incubation system and the addition of DxS04(20 μΜ) in the washing solution are conducive to reducing the non-specifically adsorbed aptamer on the magnetic beads and reducing the background value of the detection system. However, when the concentration of DxS04is too high, the aptamer specifically bound to the target may also be washed down, reducing the detection sensitivity.

[0103] Table 2 Ct difference between experimental group and control group under different incubation and washing condition combination

[0104]

[0105] Example 5 Multiplex detection

[0106] To illustrate the feasibility of the method for multi-target detection, the experiment was tested by directly fixing the target.

[0107] First, equal molar amounts of targets were coupled to magnetic beads, respectively, and then the magnetic beads coupled with IGFBP3 and PDGF-BB were mixed in equal amounts (50 μg). After blocking with 3% BSA, 100 μL of IGFBP3 aptamer, PDGF-BB aptamer or a mixture of two target aptamers (1 nM) was added, respectively. The incubation, washing and elution were performed according to the above optimization method, and then PCR detection was performed. In this method, two aptamer probes were labeled with different fluorescent signals, respectively, so that two aptamers can be detected in the same system.

[0108] The experimental results are shown in Table 3. Figure 6 As shown in Table 3, the results of multiplex detection are similar to those of single detection and have little difference, which illustrates that the method has feasibility in multiplex detection.

[0109] incorporated by reference

[0110] The entire contents of each patent and scientific document referred to herein is incorporated by reference for all purposes.

[0111] equivalents

[0112] The present application can be embodied in other specific forms without departing from the spirit or essential characteristics thereof. Accordingly, the above described embodiments are to be considered in all respects only as illustrative and not restrictive, the scope of the application being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

1. A method for detecting a target, comprising the following steps: 1) coupling an antibody to a fixed carrier and blocking the fixed carrier with a blocking solution, and then optionally washing with a buffer solution; 2) incubating a pretreated sample containing the target with the fixed carrier obtained in step 1), the antibody binding to the target; 3) washing the fixed carrier obtained in step 2) with a buffer solution; 4) incubating an aptamer with the fixed carrier obtained in step 3), the aptamer binding to the target; wherein the aptamer is dissolved in a buffer solution containing 0.1 mg / mL salmon sperm DNA; 5) washing the fixed carrier obtained in step 4) with a buffer solution; wherein the buffer solution is a buffer solution containing a final concentration of 0.1 mg / mL salmon sperm DNA and a final concentration of 20 μM to 40 μM DxSO4; 6) adding an elution solution to the fixed carrier obtained in step 5), collecting the elution solution, and detecting the aptamer by PCR.

2. The method of claim 1, wherein, The fixed carrier is selected from magnetic beads, microspheres, enzyme-labeled plates, or centrifuge tubes.

3. The method of claim 1, wherein the fixed carrier is magnetic beads.

4. The method of claim 2, wherein, The surface of the fixed carrier is modified with a chemical group.

5. The method of claim 4, wherein the chemical group is selected from a hydroxyl group, a carboxyl group, an amino group, or a sulfonyl group, or is modified with streptavidin, and the coupling is covalent coupling.

6. The method of claim 1, wherein, The target is selected from one or more of a protein, a polysaccharide, a small molecule with biological activity, and a complex of a small molecule and a protein.

7. The method of claim 1, wherein, The blocking solution is selected from BSA (bovine serum albumin), skim milk powder, casein, salmon sperm DNA, herring sperm DNA, yeast tRNA, or TW-20.

8. The method of claim 1, wherein the blocking solution is BSA.

9. The method of claim 1, wherein, The concentration of the blocking solution is 0.05% to 20%.

10. The method of claim 1, wherein the concentration of the blocking solution is 3%.

11. The method of claim 1, wherein, In step 2), the pretreated sample containing the target is a sample that has been separated by serum or plasma, and is optionally diluted.

12. The method of claim 1, wherein, In step 4), the amount of the aptamer is 0.1 pmol, and the amount of the fixed carrier is 10 μg to 100 μg.

13. The method of claim 1, wherein in step 4), the amount of the fixed carrier is 50 μg.

14. The method of claim 1, wherein, The buffer solution used in step 1) or 3) contains a buffer salt.

15. The method of claim 14, wherein the buffer salt is PBS or DPBS.

Citation Information

Patent Citations

  • Aptamer-based multiplexed assays

    CN108614102A