A molecular marker for cross-resistance of citrus psyllid to insecticides and its application and detection method

Abstract

The present invention discloses a molecular marker of cross-resistance of citrus psyllid to flupyralid, avermectin and bifenthrin, and its application and detection method, wherein the molecular marker is a carboxylesterase gene DcitCCE17. The expression amount of the carboxylesterase gene DcitCCE17 of the citrus psyllid to be tested is detected. If the expression amount of the DcitCCE17 gene of the citrus psyllid to be tested is significantly higher than that of the sensitive population of citrus psyllid, it can be judged that the citrus psyllid to be tested has cross-resistance to flupyralid, avermectin and bifenthrin. The present invention is conducive to the early monitoring of the pesticide resistance of citrus psyllid in the field, and has important significance for the continuous and effective control of the pesticide resistance of citrus psyllid and the sustainable development of the citrus industry.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and relates to a molecular marker of insect resistance to pesticides, in particular to a molecular marker of the cross-resistance of citrus psyllid to three pesticides: bifenthrin, flupyralid and avermectin, and an application and detection method thereof. Background Art

[0002] Huanglongbing is a devastating disease in the citrus industry. It can cause citrus leaves to turn green, branches to die, fruit to fall, small deformed fruits, and low internal quality of fruits, eventually leading to the death of trees. The citrus psyllid (Diaphorina citriKuwayama, Hemiptera: Psyllidae) is the medium that spreads Huanglongbing. Currently, there is no cure for Huanglongbing. In production, the spread of Huanglongbing is mainly prevented by controlling the damage caused by citrus psyllid.

[0003] Chemical control is the main way to control citrus psyllids. Pyrethroids, carbamates, avermectins and flupyralidone are the main agents registered for the control of citrus psyllids in my country. However, the long-term and large-scale use of chemical agents has led to the occurrence of high-level resistance in citrus psyllids, which affects the efficient control of citrus psyllids and poses serious challenges to the sustainable development of the citrus industry. Resistance monitoring is an important way to guide scientific use of pesticides and delay the development of resistance in citrus psyllids. Traditional resistance monitoring is mainly carried out through bioassays, which are labor-intensive and time-consuming. It is necessary to invent new methods for monitoring citrus psyllid resistance. In view of this, we compared the resistance differences of different citrus psyllid populations in the field, identified resistance-related genes and conducted functional analysis, clarified the molecular mechanism of citrus psyllid resistance to commonly used insecticides, and on this basis established a molecular marker technology for citrus psyllid resistance to multiple insecticides. Summary of the invention

[0004] The inventor's laboratory collected a citrus psyllid resistant strain in a citrus orchard in Nanning, Guangxi. The strain was tested for its resistance to flupyradifurone, avermectins, and bifenthrin (chemical formula: C 23 H 22ClF3O2) has cross-resistance. Further studies have shown that compared with indoor sensitive strains, the carboxylesterase gene DcitCCE17 of the cross-resistant strain is significantly upregulated. Esterase, as a key phase I metabolic detoxification enzyme of pests, is involved in the metabolism of a variety of pesticides. The upregulation of gene expression indicates that the enzyme is involved in the detoxification metabolism of pesticides. After further research, the inventors confirmed that the citrus psyllid DcitCCE17 can metabolize three agents: flupyrazone, avermectin, and cypermethrin. The upregulation of DcitCCE17 expression can be used as a molecular marker gene for the cross-resistance of citrus psyllid to flupyrazone, avermectin, and cypermethrin. Based on this, the present application protects the following technical solutions:

[0005] A molecular marker for the cross-resistance of citrus psyllid to multiple pesticides. The molecular marker is a carboxylesterase gene DcitCCE17, whose nucleotide sequence is shown in SEQ ID NO.3. The multiple pesticides are bifenthrin, flupyralidone and avermectin.

[0006] A primer pair for detecting the above molecular marker, the primer sequence of the primer pair is:

[0007] qPCR-1F:5'-AGCCTTGTGCCTACTGTGGA-3';

[0008] qPCR-1R:5'-TGAGGAAGCCCTCGTGAGATA-3'.

[0009] The application of the above-mentioned molecular markers in the classification of sensitive and resistant populations of citrus psyllid to bifenthrin, flupyralidone and avermectin.

[0010] In the above-mentioned application technology scheme, the expression level of the carboxylesterase gene DcitCCE17 of the citrus psyllid to be tested is detected. If the expression level of the DcitCCE17 gene of the citrus psyllid to be tested is significantly higher than the expression level of the DcitCCE17 gene of the sensitive population, it can be judged that the citrus psyllid to be tested has cross-resistance to cypermethrin, flupyradone and avermectin. If there is no significant difference in the expression level of the DcitCCE17 gene between the citrus psyllid to be tested and the sensitive population, it cannot be judged that the citrus psyllid to be tested has cross-resistance.

[0011] A detection method for the above-mentioned molecular markers, taking a population sensitive to citrus psyllid agents as a control, detects the expression level of the carboxylesterase gene DcitCCE17 of the citrus psyllid to be tested. If the expression level of the DcitCCE17 gene of the citrus psyllid to be tested is significantly higher than that of the sensitive population, it can be determined that the citrus psyllid to be tested has cross-resistance to bifenthrin, flupyradone and avermectin; if there is no significant difference in the expression level of the DcitCCE17 gene between the citrus psyllid to be tested and the sensitive population, it cannot be determined that the citrus psyllid to be tested has cross-resistance.

[0012] The detection method of the above-mentioned molecular marker includes the following steps: extracting the total RNA of the citrus psyllid to be tested, reversing it into cDNA, performing qPCR amplification using the cDNA as a template, using the sensitive population as a control, and determining the expression level of the DcitCCE17 gene in the object to be tested. When the expression level of the DcitCCE17 gene in the object to be tested is significantly higher than that in the sensitive population, it can be determined that the object to be tested has cross-resistance to bifenthrin, flupyradone and avermectin.

[0013] For the detection method of the above molecular markers, the primer sequences for qPCR amplification are:

[0014] Upstream primer qPCR-1F: 5′-AGCCTTTGTGCCTACTGTGGA-3′;

[0015] Downstream primer qPCR-1R: 5'-TGAGGAAGCCCTCGTGAGATA-3'.

[0016] For the detection method of the above molecular markers, the qPCR amplification reaction system is: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix, 0.4 μL of each forward and reverse primer with a concentration of 10 μM, 4 μL of cDNA template of the population to be tested, and ddH2O supplemented to 20 μL.

[0017] The detection method of the above molecular markers, the qPCR amplification conditions are: 95°C pre-denaturation for 30 seconds; 95°C denaturation for 10 seconds, 60°C annealing for 10 seconds, 40 cycles; the final melting curve reaction conditions: 95°C reaction for 15 seconds, 60°C reaction for 60 seconds, 95°C reaction for 15 seconds.

[0018] The beneficial effects of the present invention are:

[0019] 1) The present invention locates the molecular marker of cross-resistance of citrus psyllid to flupyralid, avermectin and bifenthrin. The marker has strong specificity and high stability. By analyzing the molecular marker of the citrus psyllid population to be tested, it can be confirmed whether the population has cross-resistance to flupyralid, avermectin and bifenthrin. It is conducive to the early monitoring of the pesticide resistance of citrus psyllid in the field, the continuous and effective control of the pesticide resistance of citrus psyllid, and the sustainable development of the citrus industry.

[0020] 2) The present invention provides specific forward and reverse primers for molecular markers of cross-resistance of citrus psyllid to flupyralid, avermectin and bifenthrin, and also provides an optimized PCR detection system and amplification program, which can successfully and quickly detect the expression level of the citrus psyllid esterase DcitCCE17 gene. The gene expression level is significantly higher than that of the sensitive population of citrus psyllid, which can be judged as the citrus psyllid to be tested has cross-resistance to flupyralid, avermectin and bifenthrin. The detection method of the present invention is simple and quick to operate, and has strong detection specificity and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the resistance multiple of RS population to different agents.

[0022] Figure 2 This is the protein electrophoresis and Western blotting assay of DcitCCE17. In the figure, M: three-color pre-stained protein marker, 1: pcoldII vector supernatant, 2: DcitCCE17 precipitate, 3: DcitCCE17 supernatant, 4: DcitCCE17 Western Blotting.

[0023] Figure 3 These are the enzyme activity results of DcitCCE17 supernatant and after purification and concentration.

[0024] Figure 4 It is the result of pesticide metabolism by the recombinant DcitCCE17 protein of citrus psyllid.

[0025] Figure 5 These are the results of gene expression analysis of DcitCCE17 in the field test population of citrus psyllid. DETAILED DESCRIPTION

[0026] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0027] The experimental methods in the following examples are all conventional methods unless otherwise specified; the chemical and biological reagents and materials used are all conventional reagents and materials in the art and are commercially available unless otherwise specified.

[0028] Example 1. Acquisition of cross-resistant strains of citrus psyllid and confirmation of resistance molecular marker gene DcitCCE17 1. Materials and methods

[0029] 1.1 Citrus psyllid population

[0030] The pesticide-sensitive population of citrus psyllid (code: SS) was collected from a citrus orchard that had been abandoned for many years in Guilin, Guangxi. It was reared and propagated in insect cages using Murraya exotica without any contact with any chemical agents.

[0031] The pesticide-resistant population of citrus psyllid (code: RS) was collected from a citrus orchard in Nanning, Guangxi. The orchard has been sprayed with psyllid control agents for a long time, and the control effect has shown a significant decline recently, and a resistance phenotype is suspected.

[0032] 1.2 Indoor bioassay of common pesticides against Psyllids

[0033] In order to evaluate the degree and type of resistance of RS population, indoor bioassay was carried out on SS and RS populations using the drug film method, and the half-lethal concentration (LC50) of each drug to the two populations was calculated. 50 ), the calculation method of the resistance multiple (R0) of RS population to the drug is: R0 = RS population LC 50 Value / SS population LC 50 value.

[0034] The common citrus psyllid control agents used in the field are chlorpyrifos (CAS No.: 2921-88-2), thiamethoxam (CAS No.: 153719-23-4), bifenthrin (CAS No.: 82657-04-3), sulfoxaflor (CAS No.: 946578-00-3), avermectin (CAS No.: 71751-41-2), flupyralidone (CAS No.: 951659-40-8) and spirotetramat (CAS No.: 203313-25-1). Referring to the lethal doses of different agents in the public literature, each of the above agents is diluted into 5 to 7 different concentration gradients with acetone, and the concentration lethality is preferably guaranteed to be between 20% and 75%. Take 200 μL of the diluted agent and add it to the bottom of a flat-bottomed glass tube (inner diameter 15 mm, height 80 mm) with one end open. Lay the glass tube flat, and then roll it quickly and evenly so that the liquid is evenly distributed on the inner wall of the glass tube, and after the acetone evaporates, a uniform agent film is formed on the inner wall of the tube. Place 50 adult citrus psyllids in each test tube, seal it with a nylon mesh (pore size 0.4 mm), and place it in a tray in a light incubator at 27°C ± 1°C with a photoperiod of 16h / 8h (light / dark). Acetone without the agent was used as a blank control, and each treatment was repeated three times. The mortality rate of citrus psyllids at each agent concentration was counted, and the LC was calculated using the pesticide indoor bioassay data processing system software (V2006.5) 50 value.

[0035] 1.3 Study on the molecular mechanism of drug resistance of RS population

[0036] 1.3.1 Screening of key metabolic detoxification enzymes in RS populations using differential gene expression profiling sequencing RNA-Seq

[0037] 100 adults of RS and SS populations were collected and placed in 1.5 mL enzyme-free EP tubes, and the collection was repeated three times. Total RNA of the above populations was extracted using a total RNA extraction kit (Omega, USA), and the purity and concentration of RNA were detected by ultraviolet spectrophotometer. After the quality was qualified, transcriptome sequencing, gene assembly and annotation were performed on the Illumina2500 sequencing platform. The differentially expressed genes between the two populations were analyzed by DESeq2 for differential expression between sample groups to obtain the differentially expressed gene set between the two conditions; in the screening process, FDR less than 0.01 and the difference multiple FC (Fold Change) greater than or equal to 2 were used as screening criteria. Among them, FC represents the ratio of expression between two samples (groups). In the obtained differentially expressed gene annotation set, the upregulated gene set was selected to screen the key genes of metabolic detoxification enzymes (P450s, esterases, GST, UGTs, etc.) to obtain candidate metabolic detoxification enzyme genes.

[0038] 1.3.2 Functional verification of candidate metabolic gene DcitCCE17

[0039] The above steps screened a metabolic detoxification enzyme gene, which was subsequently identified as a carboxylesterase gene. Our laboratory named it DcitCCE17 gene, and the method for verifying its metabolic function is as follows:

[0040] In vitro expression of DcitCCE17 enzyme: The prokaryotic expression primers of DcitCCE17 were designed based on the gene sequences in the genome and transcriptome, and PCR amplification of the target gene was performed using the cDNA of the citrus psyllid as a template. The PCR amplification primers are: DcitCCE17-1F (SEQ ID NO.1):

[0041] 5'-CTCGGTACCCTCGAGGGATCCATGTCCACCAAAGTGATAAGCACA-3'; DcitCCE17-1R (SEQID NO.2):

[0042] 5'-AGCAGAGATTACCTATCTAGATCACAGTTTATTGACCCAAAAGTCA-3'.

[0043] The PCR amplification reaction system was: 2× Phanta Max Master Mix 25 μL (Novozymes, China), 2 μL of each forward and reverse primer at a concentration of 10 μM, 2 μL of cDNA template, and ddH2O supplemented to 50 μL.

[0044] The PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; then denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec, extension at 72°C for 10 sec, 40 cycles; and finally extension at 72°C for 5 min.

[0045] The E. coli protein expression vector PcoldII vector (Takara) was digested with BamHI and XbaI to obtain a linear vector. The PCR product and the linear vector were recovered by gel extraction using the kit FastPure Gel DNA Extraction Mini Kit (Novozymes, China). The target fragment and the linear vector were connected using the kit ClonExpress II One Step Cloning Kit (Novozymes, China) to obtain the recombinant plasmid, which was transformed into DH5α competent medium. After overnight culture, a single colony was picked for bacterial liquid PCR and sequencing verification. After the qualified bacterial liquid was expanded and cultured, the recombinant plasmid was extracted using the endotoxin-free plasmid mini-extraction kit (Tiangen, China). The recombinant plasmid was then transformed into BL21 (DE3) competent cells. After overnight culture on the plate, a single colony was picked and the bacterial liquid PCR was verified. Take 1 ml of the qualified bacterial liquid and transfer it to 100 ml of LB medium containing AMP and shake culture (37°C, 220rpm) until the bacterial liquid OD is 0.6-0.8. Then, 100ul IPTG (isopropyl-β-D-thiogalactoside) (0.1M) was added to induce expression overnight (15°C, 180rpm). The induced expression bacterial solution was centrifuged at 9000g, 4°C, for 5min, and the supernatant was discarded. 10ml PBS (0.1M), 400ul protease inhibitor Cocktial, and 20ul lysozyme were added to the precipitate and resuspended, and ice bathed for 30min. After ultrasonic disruption for 30min, the supernatant was centrifuged and the supernatant of the recombinant DcitCCE17 protein was identified by SDS-PAGE and Western Blotting.

[0046] Purification and content determination of DcitCCE17 enzyme: To purify the recombinant protein DcitCCE17, it was combined with Ni-NTA6FF (Pre-Packed Gravity Column) agarose purification resin (Sangon Biotechnology, China) and eluted with 500 mM imidazole. The buffer of the purified protein was replaced with PBS and concentrated using Millipore ultrafiltration centrifuge tubes (10 kDa). The content of DcitCCE17 protein was determined by Bradford Coomassie Brilliant Blue staining.

[0047] DcitCCE17 enzyme activity analysis: The enzymatic activity of DcitCCE17 was detected using a carboxylesterase (CarE) activity detection kit (Solarbio, China).

[0048] Metabolism analysis of flupyrazone, avermectin, and bifenthrin by DcitCCE17 enzyme: Avermectin standard, flupyrazone standard, and bifenthrin standard were prepared into a mother solution with a concentration of 10 mg / mL in acetonitrile, and diluted into three series of concentrations for standard curves. We selected Ultimate 3000 liquid chromatograph (Thermo Fisher Scientific, USA) and C18 column (4.6×150 mm, 3.5 μm) for detection. The chromatographic operating conditions were: the flow rate of flupyrazone was 1 ml / min, the injection volume was 2 μl, the column temperature was 30°C, the detection wavelength was 260 nm, and the mobile phase was (acetonitrile: 0.25% formic acid = 40%: 60%). The flow rate of bifenthrin is 1 ml / min, injection volume: 10 μl, column temperature: 35°C, detection wavelength: 225 nm, mobile phase (methanol: ultrapure water = 90%: 10%). The flow rate of avermectin is 1 ml / min, injection volume: 10 μl, column temperature: 30°C, detection wavelength: 245 nm, mobile phase (methanol: ultrapure water = 85%: 15%). The standard curve is drawn with the peak area as the y-axis and the concentration as the x-axis. The reaction system for the metabolism of pesticides by recombinant DcitCCE17 protein is 500ul, 30ug of recombinant DcitCCE17 protein is added, and the reagent is added to make the final concentration 50mg / L. The remaining volume is supplemented with PBS, mixed and reacted on a shaker for 2.5h (30℃, 250rpm), 500ul of acetonitrile is added to terminate the reaction, vortexed for 3min, centrifuged at 4℃, 12000g for 10min, and the supernatant is filtered with a 0.22μm filter membrane and loaded to detect the content of residual pesticides. Each treatment was repeated 3 times, and 30ug of inactivated recombinant DcitCCE17 protein was used as a control.

[0049] 2. Results and Analysis

[0050] 2.1 Resistance spectrum of RS population

[0051] Toxicity test results ( Figure 1 ) showed that the RS population had a high resistance to flupyralidone, avermectin and bifenthrin, with resistance multiples of 8.53 times, 12.11 times and 25.19 times, respectively, while the RS population did not have a high resistance to other agents. The bioassay results showed that the RS population had a certain cross-resistance to flupyralidone, avermectin and bifenthrin.

[0052] 2.2 Metabolic genes differentially expressed in RS populations

[0053] In the differential gene expression profile, a total of 6 up-regulated genes were found through metabolic detoxification gene screening (Table 1), among which the gene with the highest up-regulated fold was DC02G036740. Through annotation, this gene is a type of citrus psyllid esterase. We named this gene DcitCCE17 in the internal citrus psyllid gene database of our laboratory, and the full-length sequence of the ORF of the citrus psyllid DcitCCE17 gene is shown in SEQ ID NO. 3. Since the higher the up-regulated fold of the detoxification enzyme gene in the resistant strain, it indicates that the gene is the most active and the most critical in the detoxification process of pesticides, so it is speculated that DcitCCE17 is the key factor for the cross-resistance of the RS population to flupyralid, avermectin, and bifenthrin.

[0054] Table 1: Summary of upregulated detoxification enzyme genes in RS differential gene expression profiles

[0055]

[0056]

[0057] The full-length sequence of the ORF of the DcitCCE17 gene of citrus psyllid (SEQ ID NO.3) is as follows:

[0058] ATGTCCACCAAAGTGATAAGCACAAGCTACGGAAAATTGAAGGGGTCGTTGAAAACGAGCAAGT

[0059] ATGACGAAACGAAGTATTTCAGCTTTCAAGGAATTCCTTATGCCAAACCTCCCGTGGGAAACCTA

[0060] AGATTTAAGGCTCCTGAAGATTTGGAACCTTGGGAGGGAGTCCGGGATGCACTGAAGGAAGGAA

[0061] ATTGTGGACCCCAATATGACATGGGCACCAAGATCTATATCGGGGACGAGGATTGCCTGTACTTGA

[0062] ATGTGTATGTTCCAGATGTAGCACAAACTACCCTACTCCCAGGTGATGGTTTGGATTCATGGAGGAG

[0063] GTTTTGCCTATGGACACGGCAATGCAGACGCTTATGGCCCGGAATTTCTGATGAACAAAAATGTC

[0064] ATCCTGGTAACAGTCAACTATAGGCTTGGAATTCTAGGCTTTCTCAACTTGGAAACCAAGGATGC

[0065] TGCAGGGAATATGGGTCTCAAGGATCAAAATGCGGCTCTGAAGTGGGTGAAAAAAGAGATCGAA

[0066] AATTTTGGTGGCGATTCAAAAAATGTAACTTTGTTTGGCGAAAGTGCAGGAGGTGCAAGTGTGC

[0067] ACTATCACATGTTGTCACCACTTTCCAAGGGTTTATTTCACAAAGCCATTCTCATGAGTGGCTCAG

[0068] CCATGTGCAATTGGGGGTTCACGAAGAACCATTTGCAGAGAGCATTTGATTTAGGAAAATTATTG

[0069] GGCTGTGAGGCTAAGACCAAAGAAGAACTGCTGACATTCTTAATGAAGGCATCTCCAAAGGAAT

[0070] TTGCTGGTAACCAAGATAAAGTGATCAATGACGTGGAGCATCTGACCGGTACAGACCAAGCCTTT

[0071] GTGCCTACTGTGGACGGCGAATTTCTCACTGAAGAGCCTTTGCAATCCCTGAGGAAAGGCAACG

[0072] TACATGATTTGCCTACAATTGTAGGAACCGTATCTCACGAGGGCTTCCTCATATACAATTCTGTTGC

[0073] AAAGTGGCCATGGTTTGTGGAGAAGTTGAACAAGGAGTTAGAGGCTGTCAGTCCGTATCCAATA

[0074] GCACCGTCCAAGGAGTTGTCCAAATCCATTAGAAATGTGTATTTCCAAGGTGATGAGACCATCTG

[0075] TTTCAAGAAACACAATGAACAATTCGTTCAGTTGTTTTCTCACACCCACTTCTTGGTACCCATGTT

[0076] TATGAGTCTGAAGTACGAGCTAAACTCACCCTCCAGAAAGGCGCCGATCTATTGCTACAGGTTTG

[0077] CTTACGACGGCAACTTGGGCTGGTTCAAGAAATTGATGGCCTCTTCGAGGAAGATCGACATTCCT

[0078] GCAGGAGTGTCCCATGTTGACGAGTTAGGCTACCTCCTATCCAATGACTTGGTGGATCACAAAAA

[0079] GCTAGCGACCGAAGATGACAGGAAAATCGTTGACAAATTTACGACCCTGTGGAGCAACTTTGCC

[0080] AAAACCGGTAATCCAAATCCTGCGGATCATCAAGTTTGGTCTCCCATAGAAAGCTACGAGCAGAG

[0081] AAACTATTTGGACATTGCAAGTCCATCGAGTATTGTGATGAAGAAGAATTTAGACAAGGATAAAATTGACTTTTGGGTCAATAAACTGTGA.

[0082] 2.3 Functional verification of candidate gene DcitCCE17

[0083] SDS-PAGE identification revealed that the target band located near 60KDa appeared in both the precipitate and the supernatant ( Figure 2 ), which is consistent with the predicted molecular weight of DcitCCE17 protein (59.25KDa). The Western blotting results ( Figure 2 The upper mark "4" indicates that the target band in the supernatant is specific, indicating that the DcitCCE17 protein can be expressed in a soluble state in the E. coli expression system.

[0084] The results of esterase activity test showed that DcitCCE17 protein had esterase activity, the activity of the supernatant was 2.9, and the activity after purification and concentration was 4.42 (U / mg prot) ( Figure 3 ).

[0085] We used HPLC to analyze the metabolic capacity of recombinant DcitCCE17 protein to avermectin, flupyralidone and bifenthrin. According to the residual concentration of pesticides, the residual amount of active protein group was significantly lower than that of inactivated protein group ( Figure 4 ), indicating that these three pesticides can be metabolized by the recombinant DcitCCE17 protein, and the metabolic rates from high to low are 64.88% for bifenthrin, 27.84% for flupyralidone, and 25.36% for avermectin.

[0086] 3. Conclusion:

[0087] The citrus psyllid esterase DcitCCE17 can metabolize three pesticides, avermectin, flupyrazone and bifenthrin, to varying degrees. It can be used as an indicator enzyme to provide a molecular marker for the cross-resistance of citrus psyllid field populations to avermectin, flupyrazone and bifenthrin. The up-regulation of DcitCCE17 expression indicates that citrus psyllids have a certain degree of resistance to these three pesticides, avermectin, flupyrazone and bifenthrin, which is cross-resistance. Cross-resistance refers to the phenomenon that after a pest population develops resistance to a certain pesticide, it often also develops resistance to other agents with similar chemical structures or similar toxicological mechanisms. One explanation for the phenomenon of cross-resistance is that the same detoxification enzyme in the pest body effectively degrades different types of pesticides.

[0088] Example 2: Application and detection method of molecular markers in test populations

[0089] 1. Test insects

[0090] The pesticide-sensitive population of citrus psyllid (code: SS) was collected from a citrus orchard that had been abandoned for many years in Guilin, Guangxi. It was reared and propagated in insect cages using Murraya exotica without any contact with any chemical agents.

[0091] The field populations for the test were collected from citrus orchards in Nanning and Guilin, Guangxi, and the test numbers were CS-01 and CS-02 respectively. The citrus psyllid populations collected from the field were placed in separate insect cages and raised with Murraya odorifera.

[0092] 2. Analysis of differential expression of DcitCCE17 between sensitive and test populations

[0093] Total RNA from susceptible and tested populations of citrus psyllid was prepared using ReliaPrep TM RNA was extracted using the RNATissue Miniprep System Kit (Promega, USA).

[0094] The total RNA obtained above was used III 1st Strand cDNA Synthesis Kit (+gDNAwiper) (Novozymes, China) was used to reverse transcribe into cDNA, and the method and steps were carried out according to the instructions of the kit.

[0095] The expression level of DcitCCE17 gene in sensitive population and test population of citrus psyllid was detected by qPCR, with the above cDNA as template, upstream primer qPCR-1F (SEQ ID NO.4): 5'-AGCCTTTGTGCCTACTGTGGA-3'; downstream primer qPCR-1R (SEQ ID NO.5): 5'-TGAGGAAGCCCTCGTGAGATA-3', and α-Tubulin gene as internal reference gene. The results of fluorescence quantitative PCR were based on the CT values ​​of the target gene and the internal reference gene, and 2 -ΔΔCT The data were analyzed by t-test in SPSS 20.0 software.

[0096] The qPCR amplification reaction system was: 10 μL of 2×ChamQ Universal SYBR qPCR Master Mix (Novozymes, China), 0.4 μL of upstream and downstream primers at a concentration of 10 μM, 4 μL of cDNA template of the population to be tested, and ddH2O was added to 20 μL.

[0097] The qPCR amplification conditions were: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 10 seconds, annealing at 60°C for 10 seconds, and 40 cycles; the final melting curve reaction conditions were: reaction at 95°C for 15 seconds, reaction at 60°C for 60 seconds, and reaction at 95°C for 15 seconds.

[0098] The results are as follows Figure 5 As shown in the results, the relative expression of DcitCCE17 gene in the field test population CS-01 was 5.23±0.85. Compared with the sensitive population (SS), the expression level of DcitCCE17 gene was significantly upregulated (P<0.01), indicating that the CS-01 population had cross-resistance to avermectin, flupyralidone and bifenthrin. The relative expression of DcitCCE17 gene in the field test population CS-02 was 0.89±020. Compared with the sensitive population (SS), the expression level of DcitCCE17 gene was not different (P<0.05), indicating that the CS-02 population had no cross-resistance to avermectin, flupyralidone and bifenthrin.

[0099] 3. Detection of the actual resistance multiple of the test population to avermectin, flupyralidone and bifenthrin

[0100] The indoor bioassay method in Example 1 was used for determination, and the sensitive population SS was the SS population in Example 1. The resistance multiples of the test population CS-01 to avermectin, flupyrazone and bifenthrin were 5.45, 10.11 and 19.69 respectively; the resistance multiples of CS-02 to avermectin, flupyrazone and bifenthrin were 0.45, 1.78 and 1.23 respectively; the indoor bioassay results showed that CS-01 had cross-resistance to avermectin, flupyrazone and bifenthrin, while CS-02 had no cross-resistance to avermectin, flupyrazone and bifenthrin, which was consistent with the detection results of DcitCCE17 gene expression level.

Claims

1. Application of a molecular marker for cross-resistance of citrus psyllid to multiple pesticides in the classification of sensitive and resistant populations of citrus psyllid to bifenthrin, flupyralidone and avermectin, wherein the molecular marker is a carboxylesterase gene DcitCCE17, and its nucleotide sequence is shown in SEQ ID NO.

3.

2. The use according to claim 1, characterized in that: The expression level of the carboxylesterase gene DcitCCE17 of the citrus psyllid to be tested is detected. If the expression level of the DcitCCE17 gene of the citrus psyllid to be tested is significantly higher than that of the DcitCCE17 gene of the sensitive population, it can be determined that the citrus psyllid to be tested has cross-resistance to bifenthrin, flupyradone and avermectin. If there is no significant difference in the expression level of the DcitCCE17 gene between the citrus psyllid to be tested and the sensitive population, it cannot be determined that the citrus psyllid to be tested has cross-resistance.

3. A method for detecting molecular markers of cross-resistance of citrus psyllid to multiple pesticides, characterized in that: The molecular marker is the carboxylesterase gene DcitCCE17, and its nucleotide sequence is shown in SEQ ID NO.3; taking the citrus psyllid pesticide-sensitive population as a control, the expression level of the carboxylesterase gene DcitCCE17 of the citrus psyllid to be tested is detected. If the expression level of the DcitCCE17 gene of the citrus psyllid to be tested is significantly higher than that of the sensitive population, it can be judged that the citrus psyllid to be tested has cross-resistance to bifenthrin, flupyralid and avermectin; if there is no significant difference in the expression level of the DcitCCE17 gene between the citrus psyllid to be tested and the sensitive population, it cannot be judged that the citrus psyllid to be tested has cross-resistance.

4. The method according to claim 3, characterized in that: The method comprises the following steps: extracting total RNA of the citrus psyllid to be tested, reversing it into cDNA, performing qPCR amplification with the cDNA as a template, taking a sensitive population as a control, determining the expression level of the DcitCCE17 gene in the tested object; when the expression level of the DcitCCE17 gene in the tested object is significantly higher than that in the sensitive population, it can be determined that the tested object has cross-resistance to bifenthrin, flupyradone and avermectin.

5. The method according to claim 4, characterized in that: The primer sequences for qPCR amplification are: Upstream primer qPCR-1F: 5'-AGCCTTTGTGCCTACTGTGGA-3'; downstream primer qPCR-1R: 5'-TGAGGAAGCCCTCGTGAGATA-3'.

6. The method according to claim 4, characterized in that: The qPCR amplification reaction system was: 10 μL of 2×ChamQUniversal SYBR qPCR Master Mix, 0.4 μL of each forward and reverse primer at a concentration of 10 μM, 4 μL of cDNA template of the population to be tested, and ddH2O was added to 20 μL.

7. The method according to claim 4, characterized in that: The qPCR amplification conditions were: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 10 seconds, annealing at 60°C for 10 seconds, and 40 cycles; the final melting curve reaction conditions were: reaction at 95°C for 15 seconds, reaction at 60°C for 60 seconds, and reaction at 95°C for 15 seconds.

Images