Primer-probe set and its application, kit and its detection method and application

By optimizing the sequence design and PCR reaction conditions of the primer probe set, the problem of insufficient primer and probe design is solved, and the high sensitivity and specificity of HBV, HCV and HIV detection is achieved, missing detection and false positives are avoided, and it is suitable for detection of multiple genotypes.

CN116162733BActive Publication Date: 2025-07-18BOE TECHNOLOGY GROUP CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111415435.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-25
Publication Date
2025-07-18
Estimated Expiration
2041-11-25

AI Technical Summary

Technical Problem

In the existing detection technology, insufficient primer and probe design and insufficient optimization of the reaction system lead to problems such as low detection sensitivity, poor specificity and missed detection. Especially in the detection of HBV, HCV and HIV, genomic variants and primer probe combination interference, resulting in inaccurate detection results.

Method used

Design specific primer probe sets, including primer probe sets for HIV, HBV and HCV, optimize sequence length, annealing temperature, GC content and △G value, use self-quenching probes and label fluorescence reporters and quenching groups, combine PCR reaction solution and enzyme mixture, optimize PCR amplification conditions, ensure efficient binding of primers to templates, and reduce missed detection and false positives.

Benefits of technology

It improves the sensitivity and specificity of the detection, avoids missed tests and false positives, ensures the accuracy and inclusiveness of the test results, and is suitable for HBV, HCV and HIV detection of various genotypes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116162733B_ABST
    Figure CN116162733B_ABST
Patent Text Reader

Abstract

Disclosed are a primer-probe set and its applications, a kit and its detection method and applications, which relate to the field of bioengineering technology and are mainly used to solve the problems of low detection sensitivity, poor specificity and missed detection caused by insufficient primer and probe design and inadequate optimization of the reaction system. The primer-probe set can be a primer-probe set for detecting HIV, a primer-probe set for detecting HBV or a primer-probe set for detecting HCV. The kit includes the above-mentioned primer-probe set for detecting HIV, the above-mentioned primer-probe set for detecting HBV and the above-mentioned primer-probe set for detecting HCV. The primer-probe set provided by the present disclosure can be applied to a kit, and has the effect of ensuring the specificity and inclusiveness of the detection results, thereby avoiding the occurrence of missed detection and false positive phenomena.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to the field of bioengineering technology, for example, relates to a primer-probe set and its application, a kit and its detection method and application. Background Art

[0002] Infections by infectious pathogens such as hepatitis B virus (HBV), hepatitis C virus (HCV), and human immunodeficiency virus (HIV) are major problems threatening global human health and blood safety.

[0003] Since various serious infectious diseases such as hepatitis B, hepatitis C, AIDS, and syphilis can be transmitted through blood, in order to ensure the safety of clinical blood use and the quality of blood products, thereby preventing cross-infection between blood donors and recipients and protecting the health of blood collection workers and blood product production workers, it is necessary to prevent infected individuals of the above diseases from entering the blood donation team, and further prevent the pathogen-positive plasma of the above diseases from being directly transfused to patients or used in blood product production. Therefore, the best-quality and most reliable diagnostic reagents available currently should be used to screen blood donors and their blood samples. Summary of the Invention

[0004] The purpose of the present disclosure is to provide a primer-probe set and its application, a kit and its detection method and application, which are mainly used to solve the problems of low detection sensitivity, poor specificity, and missed detection caused by insufficient primer and probe design and inadequate optimization of the reaction system.

[0005] To achieve the above purpose, the present disclosure provides the following technical solutions:

[0006] On the one hand, a primer-probe set for detecting HIV is provided. The primer-probe set for detecting HIV includes: a first sub-primer-probe set and a second sub-primer-probe set targeting the HIV gene Pol region locus, and a third sub-primer-probe set targeting the HIV gene Ltr region locus.

[0007] Among them, the sequences of the first sub-primer-probe set are:

[0008] Forward primer Pol-F1: 5’-TTAAGACAGCAGTACAAATGGCAGT-3’;

[0009] Reverse primer Pol-R1: 5’-TAGTTTGTATGTCTGTTGCTATTATGTCT-3’;

[0010] Probe Pol-P1: 5’-CCCCTGCACTGTACCCCCCAATC-3’;

[0011] Or,

[0012] Upstream primer Pol-F2: 5’-GAATATAGACATAATAGCAACAGACA-3’;

[0013] Downstream primer Pol-R2: 5’-ACTACTGCCCCTTCACCTTTCCA-3’;

[0014] Probe Pol-P2: 5’-CGGGTTTATTACAGRGACAGCAGAGA-3’.

[0015] The sequences of the second set of primer-probes are:

[0016] Upstream primer Gag-F1: 5’-TCCCTCARTCACTCTTTGGCA-3’;

[0017] Downstream primer Gag-R1: 5’-CCTCCAATTCCYCCTATCATT-3’;

[0018] Probe Gag-P1: 5’-TTAGAYACAGGAGCAGATGATACAGT-3’;

[0019] Or,

[0020] Upstream primer Gag-F2: 5’-CTTTGGATGGGNATGAACTC-3’;

[0021] Downstream primer Gag-R2: 5’-GTATATCATTGACAGTCCAGCT-3’;

[0022] Probe Gag-P2: 5’-ATCCTGACAAATGGACAGTTCAGCCTAT-3’.

[0023] The sequences of the third set of primer-probes are:

[0024] Upstream primer Ltr-F1: 5’-CCCTCAGATGCTGCATAWAAGCA-3’;

[0025] Downstream primer Ltr-R1: 5’-ACAGACGGGCACACACTAC-3’;

[0026] Probe Ltr-P1: 5’-CCTGGGAGCTCTCTGGCTA-3’;

[0027] Or,

[0028] Upstream primer Ltr-F2: ACAGACGGGCACACACTAC-3’;

[0029] Downstream primer Ltr-R2: CGGGCGCCACTGCTAGAGATTTTT-3';

[0030] Probe Ltr-P2: 5'-GTAGTGTGTGCCCGTCTGTGTGTGACTC-3'.

[0031] In some embodiments, the probe of at least one of the first sub-primer probe group, the second sub-primer probe group, and the third sub-primer probe group is a self-quenching probe.

[0032] In some embodiments, the 5' end of the self-quenching probe is labeled with a fluorescent reporter group, and the 3' end of the self-quenching probe is labeled with a fluorescent quenching group.

[0033] In some embodiments, the fluorescent reporter group includes CY5, and the fluorescent quenching group includes BHQ1.

[0034] On the other hand, provided is an application of the primer probe group for detecting HIV as described in any of the above embodiments in the preparation of a product for detecting HIV.

[0035] On yet another hand, provided is a primer probe group for detecting HBV. The sequences of the primer probe group for detecting HBV are:

[0036] Upstream primer HBV-F1: 5'-CTAGACTCGTGGTGGACTTCTCTCA-3';

[0037] Downstream primer HBV-R1: 5'-CAGAAGAACCAACAAGAAGATGAGG-3';

[0038] Probe HBV-P1: 5'-AGCAGCAGGATGAAGAGGAAGATGATAAA-3';

[0039] Or,

[0040] Upstream primer HBV-F2: 5'-CCACGGGGCGCACCTCTCTTTACG-3';

[0041] Downstream primer HBV-R2: 5'-CGTGTGCACTTCGCTTCACCTC-3';

[0042] Probe HBV-P2: 5'-CAGATGAGAAGGCACAGACGGGGAG-3'.

[0043] In some embodiments, the probe in the primer probe group for detecting HBV is a self-quenching probe.

[0044] In some embodiments, a fluorescent reporter group is labeled on the 5'-end of the self-quenching probe, and a fluorescent quenching group is labeled on the 3'-end of the self-quenching probe.

[0045] In some embodiments, the fluorescent reporter group includes FAM, and the fluorescent quenching group includes BHQ1.

[0046] In another aspect, there is provided an application of the primer-probe set for detecting HBV as described in any of the above embodiments in the preparation of a product for detecting HBV.

[0047] In another aspect, there is provided a primer-probe set for detecting HCV. The sequences of the primer-probe set for detecting HCV are as follows:

[0048] Forward primer HCV-F1: 5'-GAAAGCGTCTAGCCATGGCGTTA-3';

[0049] Reverse primer HCV-R1: 5'-TACTCACCGGTTCCGCAGACCACTAT-3';

[0050] Probe HCV-P1: 5'-AGTGTCGTGCAGCCTCCAGG-3';

[0051] Or,

[0052] Forward primer HCV-F2: 5'-TAGTGGTCTGCGGAACCGGTGAGTACA-3';

[0053] Reverse primer HCV-R2: 5'-CAAGCACCCTATCAGGCAGTACCAC-3';

[0054] Probe HCV-P2: 5'-CCGAGTAGTGTTGGGYCGCGAAAG-3'.

[0055] In some embodiments, the probe in the primer-probe set for detecting HCV is a self-quenching probe.

[0056] In some embodiments, a fluorescent reporter group is labeled on the 5'-end of the self-quenching probe, and a fluorescent quenching group is labeled on the 3'-end of the self-quenching probe.

[0057] In some embodiments, the fluorescent reporter group includes VIC, and the fluorescent quenching group includes BHQ1.

[0058] In another aspect, there is provided an application of the primer-probe set for detecting HCV as described in any of the above embodiments in the preparation of a product for detecting HCV.

[0059] In another aspect, a kit is provided. The kit includes: a first primer-probe group, a second probe group, and a third probe group. The first primer-probe group is the primer-probe group for detecting HIV as described in any of the above embodiments; the second primer-probe group is the primer-probe group for detecting HBV as described in any of the above embodiments; the third primer-probe group is the primer-probe group for detecting HCV as described in any of the above embodiments.

[0060] In some embodiments, the kit further includes: a PCR reaction solution and an enzyme mixture. Wherein, the enzyme mixture includes a reverse transcriptase, a DNA polymerase, and an RNase inhibitor.

[0061] In some embodiments, the kit further includes: an internal standard quality control, a positive quality control, and a negative quality control.

[0062] In another aspect, a detection method using the kit as described in any of the above embodiments for non-disease diagnosis and non-treatment purposes is provided. The detection method includes: extracting the nucleic acid of a sample; reacting the kit with the nucleic acid of the sample; and analyzing the result of the reaction after the reaction ends.

[0063] In some embodiments, the reaction includes: a PCR amplification reaction.

[0064] In some embodiments, the PCR amplification reaction includes: reverse transcription, pre-denaturation, cyclic amplification, and cooling.

[0065] In some embodiments, the temperature of the reverse transcription is 55±5°C, and the time of the reverse transcription is 15±5 min. The time of the pre-denaturation is 3±1 min. The cyclic amplification includes a first amplification and a second amplification that are carried out cyclically and sequentially; wherein, the temperature of the first amplification is 95±1°C, and the time of the first amplification is 15±5 s; the temperature of the second amplification is 60±2°C, and the time of the second amplification is 30±5 s.

[0066] In another aspect, an application of the kit as described in any of the above embodiments in the preparation of a product for detecting at least one of HIV, HBV, and HCV is provided.

[0067] The primer-probe group and its application, the kit and its detection method and application provided by the present disclosure have the following beneficial effects:

[0068] The primer-probe sets provided by the present disclosure can be the primer-probe sets for detecting HIV, the primer-probe sets for detecting HBV, or the primer-probe sets for detecting HCV. The above-mentioned primer-probe sets are respectively subjected to alignment analysis based on representative sequences in HIV, HBV, and HCV, and screening conditions such as the sequence lengths of the primers and probes, the annealing temperatures of the primers, the annealing temperatures of the probes, the GC contents of the primers and probes (i.e., the ratios of guanine and cytosine), the △G values at the 3'-ends of the primers and probes, the △G values in the middle segments of the primers and probes, and the △G values at the 5'-ends of the primers and probes are optimized. It mainly solves the problems of low sensitivity, poor specificity, and easy missed detection of detection reagents caused by insufficient primer and probe design and insufficient optimization of the reaction system, ensures the specificity and inclusiveness of the detection results, and improves the occurrence of missed detection and false positive phenomena.

[0069] The beneficial effects achievable by the application of the primer-probe sets provided by the present disclosure in the preparation of products for detecting HIV, HBV, or HCV are at least the same as those achievable by the primer-probe sets described in any of the above embodiments, and will not be elaborated here.

[0070] The beneficial effects achievable by the kit, its detection method, and application provided by the present disclosure are at least the same as those achievable by the primer-probe sets described in any of the above embodiments, and will not be elaborated here. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] In order to more clearly illustrate the technical solutions in the present disclosure, the drawings required for some embodiments of the present disclosure will be briefly introduced below. Obviously, the drawings in the following description are only the drawings of some embodiments of the present disclosure. For those of ordinary skill in the art, other drawings can also be obtained based on these drawings. In addition, the drawings in the following description can be regarded as schematic diagrams and are not intended to limit the actual processes of the methods involved in the embodiments of the present disclosure.

[0072] Figure 1 It is a flowchart of the detection method of the kit according to some embodiments. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0073] Next, the technical solutions in some embodiments of the present disclosure will be clearly and completely described in conjunction with the drawings. Obviously, the described embodiments are only a part of the embodiments of the present disclosure, rather than all of the embodiments. Based on the embodiments provided by the present disclosure, all other embodiments obtained by those of ordinary skill in the art belong to the scope of protection of the present disclosure.

[0074] Unless the context otherwise requires, throughout the specification and claims, the term "comprise" and its other forms, such as the third-person singular form "comprises" and the present participle form "comprising", are interpreted in an open, inclusive sense, i.e., "including, but not limited to". In the description of the specification, the terms "one embodiment", "some embodiments", "exemplary embodiments", "example", "specific example", or "some examples", etc., are intended to indicate that the specific features, structures, materials, or characteristics related to the embodiment or example are included in at least one embodiment or example of the present disclosure. The schematic representations of the above terms do not necessarily refer to the same embodiment or example. In addition, the specific features, structures, materials, or characteristics described above may be included in any one or more embodiments or examples in any appropriate manner.

[0075] Hereinafter, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. Thus, the features defined with "first" and "second" may explicitly or implicitly include one or more of such features. In the description of the embodiments of the present disclosure, unless otherwise stated, the meaning of "a plurality" is two or more.

[0076] "At least one of A, B, and C" has the same meaning as "at least one of A, B, or C", and both include the following combinations of A, B, and C: only A, only B, only C, the combination of A and B, the combination of A and C, the combination of B and C, and the combination of A, B, and C.

[0077] "A and / or B" includes the following three combinations: only A, only B, and the combination of A and B.

[0078] The use of "configured to" herein means open and inclusive language, which does not exclude devices that are suitable for or configured to perform additional tasks or steps.

[0079] In addition, the use of "based on" means open and inclusive, because a process, step, calculation, or other action "based on" one or more of the stated conditions or values may, in practice, be based on additional conditions or values beyond those stated.

[0080] As used herein, the term "HIV" is an abbreviation for Human Immunodeficiency Virus. HIV is the main pathogen that induces human acquired immunodeficiency syndrome (AIDS), and belongs to the Retroviridae family and Lentivirus genus in taxonomy.

[0081] As used herein, the term "HBV" is an abbreviation for Hepatitis B Virus. HBV is the pathogen that causes hepatitis B, and belongs to the Hepadnaviridae family. This family of viruses includes the Orthohepadnavirus genus and Avihepadnavirus genus, and among them, the Orthohepadnavirus genus causes human infections.

[0082] As used herein, the term "HCV" is an abbreviation for Hepatitis C Virus. HCV is the pathogen that causes hepatitis C. Since the genome of HCV is similar in structure and phenotypic characteristics to human flaviviruses and pestiviruses, it is classified into the Flaviviridae family.

[0083] As used herein, the term "DNA" is an abbreviation for DeoxyriboNucleic Acid. DNA is the carrier of genetic information existing in biological cells, and its main function in the body is to guide the synthesis of RNA and proteins. DNA is a macromolecular polymer composed of deoxynucleotides, and deoxynucleotides are composed of phosphoric acid, deoxyribose, and bases; among them, there are mainly 4 types of bases, namely A (adenine), G (guanine), C (cytosine), and T (thymine).

[0084] As used herein, the term "RNA" is an abbreviation for Ribonucleic Acid. RNA is the carrier of genetic information existing in biological cells and some viruses and viroids, and its main function in the body is to guide the synthesis of proteins. RNA is a macromolecular polymer composed of ribonucleotides, and ribonucleotides are composed of phosphoric acid, ribose, and bases; among them, there are mainly 4 types of bases, namely A (adenine), G (guanine), C (cytosine), and U (uracil).

[0085] As used herein, the term "PCR" is an abbreviation for Polymerase Chain Reaction. PCR is a molecular biology technique used to amplify specific DNA fragments, and can be regarded as a special DNA replication outside the body. Its greatest feature is that it can greatly increase trace amounts of DNA.

[0086] As used herein, the term "ΔG value" refers to the free energy required for the formation of a DNA duplex.

[0087] Nucleic Acid Testing (NAT) technology is highly sensitive. It can not only detect trace amounts of nucleic acids in specimens but also detect viral nucleic acids even several days after viral infection. Therefore, it greatly shortens the window period and avoids greater losses. With the increasingly perfect and mature application of NAT technology in clinical testing, the sensitivity and specificity of NAT technology have been able to meet the purpose of blood screening. Using this technology for blood screening can significantly shorten the window period for pathogen detection. When using NAT technology to screen for HBV, HCV, and HIV viruses, the window period can be advanced by 9 days, 25 days, and 14 days respectively compared to antibody detection. At the same time, when using NAT technology to screen blood donors, the probability of blood donors transmitting the above viral diseases can be reduced by 42%, 72%, and 50% respectively. Therefore, at the present stage, NAT technology is mostly used for large-scale blood screening worldwide.

[0088] Blood screening has relatively high requirements for the sensitivity and specificity of detection reagents. However, the primer-probe design in current detection reagents is not ideal. On the one hand, due to the phenomenon of high variability in the genomes of HBV, HCV, and HIV, the amplification regions when designing primer-probes are not conservative enough (that is, the sequences of the primer-probes contain some mutant sites) and do not cover the genome comprehensively enough, ultimately resulting in missed detections in the test results and some genotypes not being detected. On the other hand, due to the non-optimization of the combination of primer-probes, there is mutual interference and inhibition between different primer-probe combinations, making the amplification curve morphology non-standard and the amplification efficiency low, ultimately resulting in low sensitivity. In addition, the reliability and stability of domestic actual and detection instruments are relatively poor. On this basis, factors such as human operation errors will also lead to missed detections and false positives, and it is also difficult to ensure the sensitivity and accuracy of test results.

[0089] Based on this, the present disclosure provides a primer-probe set for detecting HIV. The primer-probe set for detecting HIV includes: a first sub-primer-probe set and a second sub-primer-probe set targeting the sites in the Pol region of the HIV gene and a third sub-primer-probe set targeting the sites in the Ltr region of the HIV gene.

[0090] Among them, the sequence of the above first sub-primer-probe set is:

[0091] Forward primer Pol-F1: 5’-TTAAGACAGCAGTACAAATGGCAGT-3’ (SEQ ID No.1);

[0092] Downstream primer Pol-R1: 5’-TAGTTTGTATGTCTGTTGCTATTATGTCT-3’ (SEQ ID No.2);

[0093] Probe Pol-P1: 5’-CCCCTGCACTGTACCCCCCAATC-3’ (SEQ ID No.3);

[0094] Or,

[0095] Upstream primer Pol-F2: 5’-GAATATAGACATAATAGCAACAGACA-3’ (SEQ ID No.10);

[0096] Downstream primer Pol-R2: 5’-ACTACTGCCCCTTCACCTTTCCA-3’ (SEQ ID No.11);

[0097] Probe Pol-P2: 5’-CGGGTTTATTACAGRGACAGCAGAGA-3’ (SEQ ID No.12);

[0098] The sequences of the above second sub-primer probe group are:

[0099] Upstream primer Gag-F1: 5’-TCCCTCARTCACTCTTTGGCA-3’ (SEQ ID No.4);

[0100] Downstream primer Gag-R1: 5’-CCTCCAATTCCYCCTATCATT-3’ (SEQ ID No.5);

[0101] Probe Gag-P1: 5’-TTAGAYACAGGAGCAGATGATACAGT-3’ (SEQ ID No.6);

[0102] Or,

[0103] Upstream primer Gag-F2: 5’-CTTTGGATGGGNATGAACTC-3’ (SEQ ID No.13);

[0104] Downstream primer Gag-R2: 5’-GTATATCATTGACAGTCCAGCT-3’ (SEQ ID No.14);

[0105] Probe Gag-P2: 5’-ATCCTGACAAATGGACAGTTCAGCCTAT-3’ (SEQ ID No.15);

[0106] The sequences of the above third sub-primer probe group are:

[0107] Forward primer Ltr-F1: 5’-CCCTCAGATGCTGCATAWAAGCA-3’ (SEQ ID No.7);

[0108] Reverse primer Ltr-R1: 5’-ACAGACGGGCACACACTAC-3’ (SEQ ID No.8);

[0109] Probe Ltr-P1: 5’-CCTGGGAGCTCTCTGGCTA-3’ (SEQ ID No.9);

[0110] Or,

[0111] Forward primer Ltr-F2: ACAGACGGGCACACACTAC-3’ (SEQ ID No.16);

[0112] Reverse primer Ltr-R2: CGGGCGCCACTGCTAGAGATTTTT-3’ (SEQ ID No.17);

[0113] Probe Ltr-P2: 5’-GTAGTGTGTGCCCGTCTGTGTGTGACTC-3’ (SEQ ID No.18).

[0114] In summary, the primer-probe sets for detecting HIV provided by some embodiments of the present disclosure can be used to detect at least six genotypes of HIV, namely 01_AE, 07_BC, 08_BC, B, BC, and C. That is, the primer-probe sets for detecting HIV provided by some embodiments of the present disclosure select representative sequences in HIV for alignment analysis, and primers and probes are screened out with a sequence length in the range of 18 - 25 bp, an annealing temperature of the primer in the range of 55°C - 65°C, the annealing temperature of the primer being 8°C - 10°C lower than that of the probe, a GC content in the range of 40% - 60%, the △G value at the 3' end being less than the △G values at the middle segment and the 5' end, no primer dimers, and no other non-specific templates after NCBI alignment. Among them, based on the above screening conditions for sequence length, GC content, △G value, and no primer dimers, it can promote the more efficient and specific binding of the primer to the template. Based on the above screening conditions for the annealing temperature of the primer and the probe, it can ensure the efficient and accurate binding of the probe to the template, thereby improving the problems of low detection sensitivity, poor specificity, and missed detection caused by insufficient primer and probe design and insufficient optimization of the reaction system, ensuring the specificity and inclusiveness of the detection results, and avoiding the occurrence of missed detection and false positive phenomena.

[0115] In some examples, the primer-probe set for detecting HIV is configured to be set in Method 1 or Method 2 to further improve the detection sensitivity, enhance the inclusiveness of the detection results, and avoid missed detections.

[0116] Method 1:

[0117] The sequences of the above first sub-primer-probe set are as follows:

[0118] Forward primer Pol-F1: 5’-TTAAGACAGCAGTACAAATGGCAGT-3’ (SEQ ID No.1);

[0119] Reverse primer Pol-R1: 5’-TAGTTTGTATGTCTGTTGCTATTATGTCT-3’ (SEQ ID No.2);

[0120] Probe Pol-P1: 5’-CCCCTGCACTGTACCCCCCAATC-3’ (SEQ ID No.3);

[0121] The sequences of the above second sub-primer-probe set are as follows:

[0122] Forward primer Gag-F1: 5’-TCCCTCARTCACTCTTTGGCA-3’ (SEQ ID No.4);

[0123] Reverse primer Gag-R1: 5’-CCTCCAATTCCYCCTATCATT-3’ (SEQ ID No.5);

[0124] Probe Gag-P1: 5’-TTAGAYACAGGAGCAGATGATACAGT-3’ (SEQ ID No.6);

[0125] The sequences of the above third sub-primer-probe set are as follows:

[0126] Forward primer Ltr-F1: 5’-CCCTCAGATGCTGCATAWAAGCA-3’ (SEQ ID No.7);

[0127] Reverse primer Ltr-R1: 5’-ACAGACGGGCACACACTAC-3’ (SEQ ID No.8);

[0128] Probe Ltr-P1: 5’-CCTGGGAGCTCTCTGGCTA-3’ (SEQ ID No.9).

[0129] Method 2:

[0130] The sequences of the above-mentioned first sub-primer probe set are as follows:

[0131] Forward primer Pol-F2: 5'-GAATATAGACATAATAGCAACAGACA-3' (SEQ ID No. 10);

[0132] Reverse primer Pol-R2: 5'-ACTACTGCCCCTTCACCTTTCCA-3' (SEQ ID No. 11);

[0133] Probe Pol-P2: 5'-CGGGTTTATTACAGRGACAGCAGAGA-3' (SEQ ID No. 12);

[0134] The sequences of the above-mentioned second sub-primer probe set are as follows:

[0135] Forward primer Gag-F2: 5'-CTTTGGATGGGNATGAACTC-3' (SEQ ID No. 13);

[0136] Reverse primer Gag-R2: 5'-GTATATCATTGACAGTCCAGCT-3' (SEQ ID No. 14);

[0137] Probe Gag-P2: 5'-ATCCTGACAAATGGACAGTTCAGCCTAT-3' (SEQ ID No. 15);

[0138] The sequences of the above-mentioned third sub-primer probe set are as follows:

[0139] Forward primer Ltr-F2: ACAGACGGGCACACACTAC-3' (SEQ ID No. 16);

[0140] Reverse primer Ltr-R2: CGGGCGCCACTGCTAGAGATTTTT-3' (SEQ ID No. 17);

[0141] Probe Ltr-P2: 5'-GTAGTGTGTGCCCGTCTGTGTGTGACTC-3' (SEQ ID No. 18).

[0142] In some embodiments, the probe of at least one of the above-mentioned first sub-primer probe set, the above-mentioned second sub-primer probe set, and the above-mentioned third sub-primer probe set is a self-quenching probe.

[0143] In some examples, the 5'-end of the above-mentioned self-quenching probe is labeled with a fluorescent reporter group, and the 3'-end of the above-mentioned self-quenching probe is labeled with a fluorescent quenching group.

[0144] Among them, the above-mentioned fluorescent reporter group may include CY5, and the above-mentioned fluorescence quenching group may include BHQ1.

[0145] In some of the above examples, the 5'-end of the above-mentioned self-quenching probe is labeled with a fluorescent reporter group, and the 3'-end is labeled with a fluorescence quenching group. On this basis, during the PCR amplification reaction of the self-quenching probe: when the self-quenching probe is intact, the fluorescence energy emitted by the fluorescent reporter group is absorbed by the fluorescence quenching group, resulting in no signal being detected by the instrument; when each primer extends, the self-quenching probe bound to the template is cut by Taq enzyme, and the fluorescent reporter group is far away from the fluorescence quenching group, so that the fluorescence energy emitted by the fluorescent reporter group cannot be absorbed, thereby generating a fluorescence signal. Therefore, after the PCR amplification reaction is completed, the melting curve analysis of the amplification product is carried out, and according to different Ct values, the purpose of detecting HIV can be achieved. Among them, the intersection of the standard curve and the threshold line is called the Ct value (that is, Cycle threshold, which refers to the number of cycles experienced when the fluorescence signal in the PCR reaction tube reaches the set threshold).

[0146] Exemplarily, the fluorescent reporter group labeled on the 5'-end of the above-mentioned probe Pol-P1 is CY5, and the fluorescence quenching group labeled on the 3'-end of the above-mentioned probe Pol-P1 is BHQ1.

[0147] Exemplarily, the fluorescent reporter group labeled on the 5'-end of the above-mentioned probe Gag-P1 is CY5, and the fluorescence quenching group labeled on the 3'-end of the above-mentioned probe Gag-P1 is BHQ1.

[0148] Exemplarily, the fluorescent reporter group labeled on the 5'-end of the above-mentioned probe Ltr-P1 is CY5, and the fluorescence quenching group labeled on the 3'-end of the above-mentioned probe Ltr-P1 is BHQ1.

[0149] Exemplarily, the fluorescent reporter group labeled on the 5'-end of the above-mentioned probe Pol-P2 is CY5, and the fluorescence quenching group labeled on the 3'-end of the above-mentioned probe Pol-P2 is BHQ1.

[0150] Exemplarily, the fluorescent reporter group labeled on the 5'-end of the above-mentioned probe Gag-P2 is CY5, and the fluorescence quenching group labeled on the 3'-end of the above-mentioned probe Gag-P2 is BHQ1.

[0151] Exemplarily, the fluorescent reporter group labeled on the 5'-end of the above-mentioned probe Ltr-P2 is CY5, and the fluorescence quenching group labeled on the 3'-end of the above-mentioned probe Ltr-P2 is BHQ1.

[0152] In the above embodiments, the fluorescent reporter group can be selected according to the interference between the fluorescent signals emitted by different fluorescent reporter groups and the product performance; the fluorescent quenching group can be selected according to the quenching effect on the fluorescent reporter group. Selecting the fluorescent reporter group as CY5 and the fluorescent quenching group as BHQ1 can improve the accuracy of product result determination and other related performances.

[0153] Based on the above technical solutions, some embodiments of the present disclosure provide the application of the primer-probe set for detecting HIV as described in any of the above embodiments in the preparation of a product for detecting HIV.

[0154] Based on the above technical solutions, some embodiments of the present disclosure further provide a primer-probe set for detecting HBV. Among them, the primer-probe set for detecting HBV is configured to be set according to Method 3 or Method 4.

[0155] Method 3:

[0156] The sequences of the above primer-probe set for detecting HBV are as follows:

[0157] Forward primer HBV-F1: 5’-CTAGACTCGTGGTGGACTTCTCTCA-3’ (SEQ ID No.19);

[0158] Reverse primer HBV-R1: 5’-CAGAAGAACCAACAAGAAGATGAGG-3’ (SEQ ID No.20);

[0159] Probe HBV-P1: 5’-AGCAGCAGGATGAAGAGGAAGATGATAAA-3’ (SEQ ID No.21).

[0160] Method 4:

[0161] The sequences of the above primer-probe set for detecting HBV are as follows:

[0162] Forward primer HBV-F2: 5’-CCACGGGGCGCACCTCTCTTTACG-3’ (SEQ ID No.22);

[0163] Reverse primer HBV-R2: 5’-CGTGTGCACTTCGCTTCACCTC-3’ (SEQ ID No.23);

[0164] Probe HBV-P2: 5’-CAGATGAGAAGGCACAGACGGGGAG-3’ (SEQ ID No.24).

[0165] In summary, the primer-probe sets for detecting HBV provided by some embodiments of the present disclosure can be used to detect at least 8 genotypes of HBV, namely A, B, C, D, E, F, G, and H. That is, the primer-probe sets for detecting HBV provided by some embodiments of the present disclosure select representative sequences in HBV for alignment analysis, and screen out primer-probes with a sequence length of 18 - 25 bp, an annealing temperature of the primer of 55°C - 65°C, the annealing temperature of the primer being 8°C - 10°C lower than that of the probe, a GC content in the range of 40% - 60%, the ΔG value at the 3' end being less than the ΔG values at the middle segment and the 5' end, no primer dimers, and no other non-specific templates after NCBI alignment. Among them, based on the screening conditions of the above sequence length, GC content, ΔG value, and no primer dimers, it can promote the more efficient and specific binding of the primer to the template. Based on the screening conditions of the annealing temperature of the above primer and probe, it can ensure the efficient and accurate binding of the probe to the template, thereby improving the problems of low detection sensitivity, poor specificity, and missed detection caused by insufficient primer and probe design and incomplete optimization of the reaction system, ensuring the specificity and inclusiveness of the detection results, and avoiding the occurrence of missed detection and false positive phenomena.

[0166] In some embodiments, the probe in the above primer-probe set for detecting HBV is a self-quenching probe.

[0167] In some examples, a fluorescent reporter group is labeled on the 5' end of the above self-quenching probe, and a fluorescent quenching group is labeled on the 3' end of the above self-quenching probe.

[0168] Among them, the above fluorescent reporter group can include FAM, for example; the above fluorescent quenching group can include BHQ1, for example. Here, the fluorescent reporter group can be selected according to the interference between the fluorescent signals emitted by different fluorescent reporter groups and the product performance; the fluorescent quenching group can be selected according to the quenching effect on the fluorescent reporter group. Selecting the fluorescent reporter group as FAM and the fluorescent quenching group as BHQ1 can improve the accuracy of product result determination and other related performances.

[0169] In some of the above examples, the 5' end of the above self-quenching probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quenching group. On this basis, during the PCR amplification reaction of the self-quenching probe: when the self-quenching probe is intact, the fluorescent energy emitted by the fluorescent reporter group is absorbed by the fluorescent quenching group, resulting in no signal being detected by the instrument; when each primer extends, the self-quenching probe bound to the template is cut by Taq enzyme, and the fluorescent reporter group is far away from the fluorescent quenching group, so that the fluorescent energy emitted by the fluorescent reporter group cannot be absorbed, thereby generating a fluorescent signal. Therefore, after the PCR amplification reaction is completed, the melting curve analysis of the amplification product is carried out, and the detection of HBV can be achieved according to different Ct values.

[0170] Exemplarily, the fluorescent reporter group labeled on the 5' end of the above probe HBV-P1 is FAM, and the fluorescent quenching group labeled on the 3' end of the above probe HBV-P1 is BHQ1.

[0171] Exemplarily, the fluorescent reporter group labeled on the 5' end of the above probe HBV-P2 is FAM, and the fluorescent quenching group labeled on the 3' end of the above probe HBV-P2 is BHQ1.

[0172] Based on the above technical solutions, some embodiments of the present disclosure provide an application of the primer-probe set for detecting HBV as described in any of the above embodiments in the preparation of a product for detecting HBV.

[0173] Based on the above technical solutions, some embodiments of the present disclosure provide a primer-probe set for detecting HCV. Among them, the primer-probe set for detecting HCV is configured to be set according to Method Five or Method Six.

[0174] Method Five:

[0175] The sequences of the above primer-probe set for detecting HCV are as follows:

[0176] Forward primer HCV-F1: 5'-GAAAGCGTCTAGCCATGGCGTTA-3' (SEQ ID No.25);

[0177] Reverse primer HCV-R1: 5'-TACTCACCGGTTCCGCAGACCACTAT-3' (SEQ ID No.26);

[0178] Probe HCV-P1: 5'-AGTGTCGTGCAGCCTCCAGG-3' (SEQ ID No.27).

[0179] Method Six:

[0180] The sequences of the primer-probe set for detecting HCV described above are as follows:

[0181] Forward primer HCV-F2: 5’-TAGTGGTCTGCGGAACCGGTGAGTACA-3’ (SEQ ID No.28);

[0182] Reverse primer HCV-R2: 5’-CAAGCACCCTATCAGGCAGTACCAC-3’ (SEQ ID No.29);

[0183] Probe HCV-P2: 5’-CCGAGTAGTGTTGGGYCGCGAAAG-3’ (SEQ ID No.30).

[0184] In summary, the primer-probe set for detecting HCV provided by some embodiments of the present disclosure can be used to detect at least 7 genotypes of HCV, namely 1b, 2a, 3a, 3b, 4, 5, and 6. That is, the primer-probe set for detecting HCV provided by some embodiments of the present disclosure selects representative sequences in HCV for alignment analysis, and screens out primer-probes with a sequence length of 18 - 25bp, an annealing temperature of the primer of 55°C - 65°C, the annealing temperature of the primer being 8°C - 10°C lower than that of the probe, a GC content in the range of 40% - 60%, the △G value at the 3’ end being less than the △G values at the middle segment and the 5’ end, no primer dimer, and no other non-specific templates after NCBI alignment. Among them, based on the above screening conditions for sequence length, GC content, △G value, and no primer dimer, it can promote the more efficient and specific binding of the primer to the template. Based on the above screening conditions for the annealing temperature of the primer and the probe, it can ensure the efficient and accurate binding of the probe to the template, thereby improving the problems of low detection sensitivity, poor specificity, and missed detection caused by insufficient primer and probe design and unoptimized reaction systems, ensuring the specificity and inclusiveness of the detection results, and avoiding the occurrence of missed detection and false positive phenomena.

[0185] In some embodiments, the probe in the primer-probe set for detecting HCV described above is a self-quenching probe.

[0186] In some examples, a fluorescent reporter group is labeled on the 5’ end of the above self-quenching probe, and a fluorescent quenching group is labeled on the 3’ end of the above self-quenching probe.

[0187] Among them, the above fluorescent reporter group may include, for example, VIC; the above fluorescent quenching group may include, for example, BHQ1.

[0188] In some of the above examples, the 5'-end of the above self-quenching probe is labeled with a fluorescent reporter group, and the 3'-end is labeled with a fluorescent quenching group. On this basis, during the PCR amplification reaction of the self-quenching probe: when the self-quenching probe is intact, the fluorescence energy emitted by the fluorescent reporter group is absorbed by the fluorescent quenching group, resulting in no signal detected by the instrument; when each primer extends, the self-quenching probe bound to the template is cut by Taq enzyme, and the fluorescent reporter group is far from the fluorescent quenching group, so that the fluorescence energy emitted by the fluorescent reporter group cannot be absorbed, thus generating a fluorescent signal. Therefore, after the PCR amplification reaction, melting curve analysis is performed on the amplification product, and according to different Ct values, the purpose of detecting HCV can be achieved.

[0189] Exemplarily, the fluorescent reporter group labeled on the 5'-end of the above probe HCV-P1 is VIC, and the fluorescent quenching group labeled on the 3'-end of the above probe HCV-P1 is BHQ1.

[0190] Exemplarily, the fluorescent reporter group labeled on the 5'-end of the above probe HCV-P2 is VIC, and the fluorescent quenching group labeled on the 3'-end of the above probe HCV-P2 is BHQ1.

[0191] In the above embodiments, the fluorescent reporter group can be selected according to the interference between the fluorescent signals emitted by different fluorescent reporter groups and the product performance; the fluorescent quenching group can be selected according to the quenching effect on the fluorescent reporter group. Selecting the fluorescent reporter group as VIC and the fluorescent quenching group as BHQ1 can improve the accuracy of product result determination and other related performances.

[0192] Based on the above technical solutions, some embodiments of the present disclosure provide the application of the primer-probe set for detecting HCV as described in any of the above embodiments in the preparation of a product for detecting HCV.

[0193] Thus, the primer-probe sets provided by some embodiments of the present disclosure can be the primer-probe set for detecting HIV, the primer-probe set for detecting HBV, or the primer-probe set for detecting HCV as described above. The above primer-probe sets can be used to detect at least 8 genotypes of HBV, namely A, B, C, D, E, F, G, and H; 7 genotypes of HCV, namely 1b, 2a, 3a, 3b, 4, 5, and 6; or 6 genotypes of HIV, namely 01_AE, 07_BC, 08_BC, B, BC, and C. That is, the primer-probe sets provided by some embodiments of the present disclosure are subjected to alignment analysis based on representative sequences in HIV, HBV, or HCV, and primer-probes with a sequence length of 18 - 25 bp, an annealing temperature of the primer of 55°C - 65°C, the annealing temperature of the primer being 8°C - 10°C lower than that of the probe, a GC content in the range of 40% - 60%, the ΔG value at the 3' end being less than the ΔG values at the middle segment and the 5' end, no primer dimers, and no other non-specific templates after NCBI alignment are screened out. This mainly solves the problems of low detection sensitivity, poor specificity, and missed detection caused by insufficient primer and probe design and inadequate optimization of the reaction system, ensures the specificity and inclusiveness of the detection results, and avoids the occurrence of missed detection and false positive phenomena.

[0194] Based on the above technical solutions, some embodiments of the present disclosure provide a kit. The kit includes: a first primer-probe set, a second primer-probe set, and a third primer-probe set. Among them, the first primer-probe set is the primer-probe set for detecting HIV as described in any of the above embodiments; the second primer-probe set is the primer-probe set for detecting HBV as described in any of the above embodiments; the third primer-probe set is the primer-probe set for detecting HCV as described in any of the above embodiments.

[0195] In some embodiments, the above kit further includes: a PCR reaction solution and an enzyme mixture. Among them, the enzyme mixture includes reverse transcriptase, DNA polymerase, and an RNase (Ribonuclease) inhibitor.

[0196] In some examples, the above PCR reaction solution may include: Tris (tris(hydroxymethyl)aminomethane), magnesium chloride, potassium chloride, dNTP (deoxy-ribonucleoside triphosphate), DTT (dithiothreitol), betaine, DMSO (dimethyl sulfoxide), sucrose, trehalose, and bovine serum albumin.

[0197] Exemplarily, the above dNTPs may include: dATP (Deoxyadenosine triphosphate), dGTP (Deoxyguanosine triphosphate), dCTP (Deoxycytidine diphosphate), and dUTP (Deoxyuridine triphosphate).

[0198] In some examples, the above DNA polymerase may be Taq enzyme.

[0199] In some examples, the volume ratio of the above PCR reaction solution to the above enzyme mixture may be 9:1.

[0200] In some embodiments, the above kit further includes: internal standard quality control, positive quality control, and negative quality control.

[0201] In some examples, the above internal standard quality control may include: a plasmid containing the detection site sequence of the internal standard gene. Among them, the internal standard gene is, for example, the human GAPDH gene.

[0202] In some examples, the above positive quality control may include: a plasmid containing the detection site sequences of HIV, HBV, and HCV.

[0203] For example, the detection site sequence of HIV is: TAAAGAAAATTATAGGGCAGGTAAGAGATCAAGCTGAACACCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGACCCAATTTGGAAAGGACCAGCAAAACTACTCTGGAA.

[0204] For example, the detection site sequence of HBV is: TTCTTGTTGACAAGAATCCTCACAATACCACAGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGGGAGCACCCACGTGTCCTGGCCAAAATTTGCAGTCCCCAACCTCCAATCACTCACCAACCTCTTGTCCTCCAATTTGTCCTGGTTATCGCTGGATGTGTCTGCGGCGTTTTATCATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGTATGTTGCCCGTTTGTCCTCTACTTCCAGGAACATCAACTACCAGCACGGGAC。

[0205] For example, the detection site sequence of HCV is: ATCACTCCCCTGTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGC GTTAGTATGAGTGTCGTGCAGCCTCCAGGCCCCCCCC-TCCCGGGAGAGCCATA GTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCGGGATGACCGGGTCCTTTCTTGGATCAACCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGCCTTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTA。

[0206] In some examples, the above negative control may include: ultrapure water.

[0207] Exemplarily, the above kit includes: a first primer-probe group, a second primer-probe group, a third primer-probe group, a PCR reaction solution, and an enzyme mixture.

[0208] The first primer-probe group includes: a first sub-primer-probe group, a second sub-primer-probe group, and a third primer-probe group. Among them, the first sub-primer-probe group includes: 0.1 μM of upstream primer, 0.1 μM of downstream primer, and 0.05 μM of probe; the second sub-primer-probe group includes: 0.1 μM of upstream primer, 0.1 μM of downstream primer, and 0.05 μM of probe; the third sub-primer-probe group includes: 0.1 μM of upstream primer, 0.1 μM of downstream primer, and 0.05 μM of probe.

[0209] The second primer-probe set includes: 0.1 μM of the upstream primer, 0.1 μM of the downstream primer, and 0.05 μM of the probe.

[0210] The third primer-probe set includes: 0.1 μM of the upstream primer, 0.1 μM of the downstream primer, and 0.05 μM of the probe.

[0211] The PCR reaction solution includes: 1 M of Tris, 0.003 M of magnesium chloride, 0.03 M of potassium chloride, 1 mM of dATP, 1 mM of dGTP, 1 mM of dCTP, 2 mM of dUTP, 0.2 mM of DTT, 5 mM of betaine, 0.4% of DMSO, 0.5% of sucrose, 0.15% of trehalose, and 0.00025% of bovine serum albumin.

[0212] The enzyme mixture includes: 0.1 U / μL of reverse transcriptase, 0.0625 U / μL of Taq enzyme, and 0.112 U / μL of RNase inhibitor.

[0213] In summary, for the kits provided in some embodiments of the present disclosure, by using the primer-probe sets for detecting HIV, the primer-probe sets for detecting HBV, and the primer-probe sets for detecting HCV as described in any of the above embodiments, and combining the screening of the main raw materials (such as DNA polymerase, reverse transcriptase, and dNTPs, etc.) in the PCR reaction solution and the enzyme mixture and the control of their dosages, the sensitivity and detection rate of the kit for detecting HBV, HCV, and HIV are further improved.

[0214] Based on the above technical solutions, some embodiments of the present disclosure provide an application of the kit as described in any of the above embodiments. This application includes: using the kit as described in any of the above embodiments to prepare a product for detecting at least one of HIV, HBV, and HCV.

[0215] In some examples, the above application includes: using the kit as described in any of the above embodiments to prepare a product for simultaneously detecting HIV, HBV, and HCV.

[0216] Based on the above technical solutions, some embodiments of the present disclosure provide a detection method of the kit as described in any of the above embodiments for non-disease diagnosis and / or non-treatment purposes. Please refer to Figure 1 ., and this usage method includes: S100 to S300.

[0217] S100. Extract the nucleic acid of the sample.

[0218] It should be noted that the nucleic acid of the above sample can be, for example, the RNA of the sample.

[0219] S200. React the kit with the nucleic acid of the sample.

[0220] S300. After the reaction ends, analyze the reaction result.

[0221] It should be noted that the above reaction can include, for example, a PCR amplification reaction.

[0222] In some examples, the above PCR amplification reaction includes: reverse transcription, pre-denaturation, cyclic amplification, and cooling.

[0223] Exemplarily, the temperature of the above reverse transcription is 55 ± 5°C, such as 50°C, 52°C, 54°C, 55°C, 56°C, 58°C, or 60°C; the time of the above reverse transcription is 15 ± 5 min, such as 10 min, 12 min, 14 min, 15 min, 16 min, 18 min, or 20 min.

[0224] Exemplarily, the time of the above pre-denaturation is 3 ± 1 min, such as 3 min, 3 min + 15 s, 3 min + 30 s, 3 min + 45 s, or 4 min. There is no limit to the temperature of the above pre-denaturation. For example, it is 95 ± 5°C, such as 90°C, 92°C, 94°C, 95°C, 96°C, 98°C, or 100°C.

[0225] Exemplarily, the above cyclic amplification includes: a first amplification and a second amplification that are cycled and performed in sequence.

[0226] Among them, the temperature of the above first amplification is 95 ± 1°C, such as 94°C, 94.5°C, 95°C, 95.5°C, or 96°C; the time of the above first amplification is 15 ± 5 s, such as 10 s, 12 s, 14 s, 15 s, 16 s, 18 s, or 20 s; the temperature of the above second amplification is 60 ± 2°C, such as 58°C, 59°C, 60°C, 61°C, or 62°C; the time of the above second amplification is 30 ± 5 s, such as 25 s, 27 s, 29 s, 30 s, 31 s, 33 s, or 35 s. There is no limit to the number of cycles of the above first amplification and the above second amplification. For example, it is 45 ± 5 times, such as 40 times, 42 times, 44 times, 45 times, 46 times, 48 times, or 50 times.

[0227] On this basis, in the case of performing the above PCR amplification reaction using a fluorescence quantitative PCR instrument, for example, fluorescence signals can be collected after the above second amplification ends.

[0228] Exemplarily, the temperature of the above cooling is 25°C to 40°C, such as 25°C, 30°C, 35°C, or 40°C.

[0229] In some examples, when the above reaction includes a PCR amplification reaction, the analysis of the result of the reaction may include: analyzing the fluorescence signal collected in the PCR amplification reaction, and / or, performing a melting curve analysis on the amplification product obtained from the PCR amplification reaction to obtain a Ct value.

[0230] In summary, the detection method of the kit provided by some embodiments of the present disclosure is for non-disease diagnosis and / or non-treatment purposes. By using the primer-probe sets for detecting HIV as described in any of the above embodiments, the primer-probe sets for detecting HBV as described in any of the above embodiments, and the primer-probe sets for detecting HCV as described in any of the above embodiments, combined with the screening of the main raw materials (such as DNA polymerase, reverse transcriptase, and dNTPs, etc.) in the PCR reaction solution and the enzyme mixture and the control of their usage amounts, as well as the control of the conditions of the PCR amplification reaction, the sensitivity and detection rate of the kit in detecting HBV, HCV, and HIV are further improved.

[0231] Next, the embodiments of the present disclosure will be further described in detail. It is easy to understand that the following description is exemplary and not a limitation to the present disclosure, and any other situations also fall within the protection scope of the present disclosure.

[0232] Example 1

[0233] This example is a kit, and its components and working concentrations are as follows in the table:

[0234]

[0235]

[0236] Among them, the fluorescent reporter group labeled on the 5'-end of the above probe Gag-P1 is CY5, and the fluorescent quenching group labeled on the 3'-end of the above probe Gag-P1 is BHQ1.

[0237] The fluorescent reporter group labeled on the 5'-end of the above probe Ltr-P1 is CY5, and the fluorescent quenching group labeled on the 3'-end of the above probe Ltr-P1 is BHQ1.

[0238] The fluorescent reporter group labeled on the 5'-end of the above probe Pol-P1 is CY5, and the fluorescent quenching group labeled on the 3'-end of the above probe Pol-P1 is BHQ1.

[0239] The fluorescent reporter group labeled on the 5'-end of the above probe HBV-P1 is FAM, and the fluorescent quenching group labeled on the 3'-end of the above probe HBV-P1 is BHQ1.

[0240] The fluorescent reporter group labeled on the 5' end of the probe HCV-P1 is VIC, and the fluorescent quencher group labeled on the 3' end of the probe HCV-P1 is BHQ1.

[0241] Example 2

[0242] This embodiment is a method for simultaneously detecting HIV, HBV and HCV using the kit described in Example 1. The method includes S10 to S60.

[0243] S10. Use negative plasma to dilute the HBV national standard to 25 IU / mL, 5 IU / mL and 1 IU / mL, dilute the HCV national standard to 50 IU / mL, 10 IU / mL and 2 IU / mL, and dilute the HCV national standard to 100 IU / mL, 35 IU / mL and 10 IU / mL.

[0244] S20. Use QIAamp Viral RNA Mini Kit to extract total RNA from each of the above samples; the extraction volume of each sample is 0.8 mL.

[0245] S30. Mix the PCR reaction solution and the enzyme mixture in a ratio of 18 μL + 2 μL, and dispense the reaction reagents obtained after mixing into eight-tube strips. At the same time, take 20 μL of the nucleic acid composition and add it to the corresponding eight-tube strips. Cover the lid and centrifuge instantly, and then put the eight-tube strips into the fluorescent quantitative PCR instrument.

[0246] S40, performing a PCR amplification reaction, and collecting fluorescence signals of FAM, ROX, VIC and CY5 channels; wherein the conditions of the PCR amplification reaction are as follows:

[0247] Reverse transcription: 55°C, 15 min;

[0248] Pre-denaturation: 95°C, 3 min;

[0249] Cyclic amplification: 95°C, 15 s; 60°C, 30 s (collecting fluorescence signals), 45 cycles;

[0250] Then cool to 40°C.

[0251] S50, after the PCR amplification reaction is completed, the instrument automatically saves the results, and the instrument's own software can be used for automatic analysis (or the baseline start value, end value and threshold line can be manually adjusted for analysis), a standard curve is drawn, and then the Ct value of each sample is recorded.

[0252] S60, perform result quality control and test result analysis based on the Ct value of each sample.

[0253] Results The quality control standards were: no Ct value for the negative quality control FAM channel, and Ct value for the ROX channel ≤38; the concentration of the positive quality control product was between Ct values of 25 and 30.

[0254] The criteria for analyzing the test results are:

[0255] For samples with a Ct value of ≤38 in the ROX channel and no Ct value in other channels, they were judged as negative;

[0256] For samples with a FAM channel Ct value ≤ 45 and a typical “S”-shaped curve, they were determined to be HBV positive;

[0257] For samples with a VIC channel Ct value ≤ 45 and a typical “S”-shaped curve, they were determined to be HCV positive;

[0258] For samples with a Ct value of ≤45 in the CY5 channel and a typical “S”-shaped curve, they were determined to be HIV positive;

[0259] For samples with positive signals in at least two of the above FAM, VIC, and CY5 channels and showing typical "S"-shaped curves, it is determined that there are more than two viral infections at the same time;

[0260] For samples with a Ct value of the ROX channel greater than 38 and no signal in other channels, the test results are considered invalid and need to be retested;

[0261] For ROX channel Ct value ≤ 38, other channels 40 ≤ Ct value ≤ 45, and does not present a typical "S" curve, it must be responsible. The result is a Ct value of <40, which is considered positive, and the result is 40 ≤ Ct value ≤ 45, which is considered negative.

[0262] The test results are shown in the following table:

[0263]

[0264] As can be seen from the above table, it has been verified that when the concentrations of HBV, HCV and HIV are 5IU / mL, 10IU / mL and 35IU / mL, the positive detection rates of 20 repeated tests are all 100%, and there is no cross-reaction between them.

[0265] Example 3

[0266] The components of the kit in this example and their working concentrations are as follows:

[0267]

[0268]

[0269] Among them, the fluorescent reporter group labeled on the 5'-end of the probe Gag-P1 is CY5, and the fluorescent quenching group labeled on the 3'-end of the probe Gag-P1 is BHQ1.

[0270] The fluorescent reporter group labeled on the 5'-end of the probe Ltr-P1 is CY5, and the fluorescent quenching group labeled on the 3'-end of the probe Ltr-P1 is BHQ1.

[0271] The fluorescent reporter group labeled on the 5'-end of the probe Pol-P1 is CY5, and the fluorescent quenching group labeled on the 3'-end of the probe Pol-P1 is BHQ1.

[0272] The fluorescent reporter group labeled on the 5'-end of the probe HBV-P2 is FAM, and the fluorescent quenching group labeled on the 3'-end of the probe HBV-P2 is BHQ1.

[0273] The fluorescent reporter group labeled on the 5'-end of the probe HCV-P2 is VIC, and the fluorescent quenching group labeled on the 3'-end of the probe HCV-P2 is BHQ1.

[0274] Example 4

[0275] This example is a method for simultaneously detecting HIV, HBV and HCV using the kit described in Example 2. This method includes S1 to S2.

[0276] S1. Configure the reaction reagents for the PCR amplification reaction according to the method of Example 1.

[0277] S2. Amplify HBV genotype B, C, D plasmids, HCV genotype 1b, 2a, 3 plasmids, and HIV subtype 01_AE, 07_BC, 08_BC plasmids with a concentration of 1000 copies / mL respectively; among them, the sample loading amount of the nucleic acid composition and the conditions of the PCR amplification reaction are referred to Example 1.

[0278] The verification results of HBV subtypes are shown in the following table:

[0279] Sample FAM VIC ROX CY5 Result determination B 33.69 / 30.12 / + C 32.69 / 30.47 / + D 33.47 / 31.22 / +

[0280] The verification results of HCV subtypes are shown in the following table:

[0281]

[0282]

[0283] The verification results of HIV subtypes are shown in the following table:

[0284] Sample FAM VIC ROX CY5 Result determination 01_AE / / 31.22 33.47 + 07_BC / / 30.47 34.25 + 08_BC / / 29.89 34.19 +

[0285] The results show that the kit of this embodiment can detect the main domestic prevalent genotypes of HBV, HCV and HIV in China, and can avoid the occurrence of missed detection.

[0286] In summary, the primer-probe sets provided in some embodiments of the present disclosure can be the primer-probe set for detecting HIV, the primer-probe set for detecting HBV or the primer-probe set for detecting HCV as described above. The above primer-probe sets are subjected to alignment analysis based on representative sequences in HIV, HBV or HCV, and primer-probes with a sequence length in the range of 18 - 25 bp, an annealing temperature of the primer in the range of 55°C - 65°C, the annealing temperature of the primer being 8°C - 10°C lower than that of the probe, a GC content in the range of 40% - 60%, the △G value at the 3' end being less than the △G values at the middle segment and the 5' end, no primer dimer, and no other non-specific templates after NCBI alignment are screened out. It mainly solves the problems of low detection sensitivity, poor specificity and missed detection caused by insufficient design of primers and probes and insufficient optimization of the reaction system, ensures the specificity and inclusiveness of the detection results, and avoids the occurrence of missed detection and false positive phenomena.

[0287] On this basis, the kits provided in some embodiments of the present disclosure, by using the primer-probe set for detecting HIV as described in any of the above embodiments, the primer-probe set for detecting HBV as described in any of the above embodiments, and the primer-probe set for detecting HCV as described in any of the above embodiments, combined with the screening of the main raw materials (such as DNA polymerase, reverse transcriptase, dNTPs, etc.) in the PCR reaction solution and the enzyme mixture and the control of their usage amounts, further improve the sensitivity and detection rate of the kit in detecting HBV, HCV and HIV.

[0288] Moreover, the kits provided in some embodiments of the present disclosure are detection methods for non-disease diagnosis and non-treatment purposes. By controlling the conditions of the PCR amplification reaction, the sensitivity and detection rate of the kit in detecting HBV, HCV and HIV are further improved.

[0289] The above is only the specific implementation manner of the present disclosure, but the protection scope of the present disclosure is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present disclosure, thinking of changes or substitutions, should be covered within the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure should be subject to the protection scope of the claims. Sequence Listing <110> BOE Technology Group Co., Ltd., Chengdu BOE Optoelectronics Technology Co., Ltd. <120> Primer-Probe Set and Its Application, Kit and Its Detection Method and Application <160> 30 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <400> 1 ttaagacagc agtacaaatg gcagt 25 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <400> 2 tagtttgtat gtctgttgct attatgtct 29 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <400> 3 cccctgcact gtacccccca atc 23 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <400> 4 tccctcartc actctttggc a 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <400> 5 cctccaattc cycctatcat t 21 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <400> 6 ttagayacag gagcagatga tacagt 26 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <400> 7 ccctcagatg ctgcatawaa gca 23 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 acagacgggc acacactac 19 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <400> 9 cctgggagct ctctggcta 19 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <400> 10 gaatatagac ataatagcaa cagaca 26 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <400> 11 actactgccc cttcaccttt cca 23 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <400> 12 cgggtttatt acagrgacag cagaga 26 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 ctttggatgg gnatgaactc 20 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <400> 14 gtatatcatt gacagtccag ct 22 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <400> 15 atcctgacaa atggacagtt cagcctat 28 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <400> 16 acagacgggc acacactac 19 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <400> 17 cgggcgccac tgctagagat tttt 24 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <400> 18 gtagtgtgtg cccgtctgtg tgtgactc 28 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <400> 19 ctagactcgt ggtggacttc tctca 25 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <400> 20 cagaagaacc aacaagaaga tgagg 25 <210> 21 <211> 29 <212> DNA <213> Artificial Sequence <400> 21 agcagcagga tgaagaggaa gatgataaa 29 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <400> 22 ccacggggcg cacctctctt tacg 24 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <400> 23 cgtgtgcact tcgcttcacc tc 22 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <400> 24 cagatgagaa ggcacagacg gggag 25 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <400> 25 gaaagcgtct agccatggcg tta 23 <210> 26 <211> 26 <212> DNA <213> Artificial Sequence <400> 26 tactcaccgg ttccgcagac cactat 26 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <400> 27 agtgtcgtgc agcctccagg 20 <210> 28 <211> 27 <212> DNA <213> Artificial Sequence <400> 28 tagtggtctg cggaaccggt gagtaca 27 <210> 29 <211> 25 <212> DNA <213> Artificial Sequence <400> 29 caagcaccct atcaggcagt accac 25 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <400> 30 ccgagtagtg ttgggycgcg aaag 24

Claims

1. A kit, characterized in that, Comprising: A first primer-probe set for detecting HIV; The first primer-probe set includes: a first sub-primer-probe set and a second sub-primer-probe set targeting the Pol region locus of the HIV gene; and a third sub-primer-probe set targeting the Ltr region locus of the HIV gene; Wherein, the sequence of the first sub-primer-probe set is: Forward primer Pol-F1: 5’-TTAAGACAGCAGTACAAATGGCAGT-3’; Reverse primer Pol-R1: 5’-TAGTTTGTATGTCTGTTGCTATTATGTCT-3’; Probe Pol-P1: 5’-CCCCTGCACTGTACCCCCCAATC-3’; The sequence of the second sub-primer-probe set is: Forward primer Gag-F1: 5’-TCCCTCARTCACTCTTTGGCA-3’; Reverse primer Gag-R1: 5’-CCTCCAATTCCYCCTATCATT-3’; Probe Gag-P1: 5’-TTAGAYACAGGAGCAGATGATACAGT-3’; The sequence of the third sub-primer-probe set is: Forward primer Ltr-F1: 5’-CCCTCAGATGCTGCATAWAAGCA-3’; Reverse primer Ltr-R1: 5’-ACAGACGGGCACACACTAC-3’; Probe Ltr-P1: 5’-CCTGGGAGCTCTCTGGCTA-3’; A second primer-probe set for detecting HBV; the sequence of the second primer-probe set is: Forward primer HBV-F1: 5’-CTAGACTCGTGGTGGACTTCTCTCA-3’; Reverse primer HBV-R1: 5’-CAGAAGAACCAACAAGAAGATGAGG-3’; Probe HBV-P1: 5’-AGCAGCAGGATGAAGAGGAAGATGATAAA-3’; A third primer-probe set for detecting HCV; the sequence of the third primer-probe set is: Forward primer HCV-F1: 5’-GAAAGCGTCTAGCCATGGCGTTA-3’; Reverse primer HCV-R1: 5’-TACTCACCGGTTCCGCAGACCACTAT-3’; Probe HCV-P1: 5’-AGTGTCGTGCAGCCTCCAGG-3’.

2. The kit according to claim 1, wherein The probe of at least one of the first sub-primer-probe set, the second sub-primer-probe set, and the third sub-primer-probe set is a self-quenching probe.

3. The kit according to claim 2, wherein In the first primer-probe set, the 5’ end of the self-quenching probe is labeled with a fluorescent reporter group, and the 3’ end of the self-quenching probe is labeled with a fluorescent quenching group.

4. The kit according to claim 3, wherein In the first primer-probe set, the fluorescent reporter group includes CY5, and the fluorescent quencher group includes BHQ1.

5. The kit according to claim 1, wherein the probe in the primer-probe set for detecting HBV is a self-quenching probe.

6. The kit according to claim 5, wherein in the primer-probe set for detecting HBV, the 5'-end of the self-quenching probe is labeled with a fluorescent reporter group, and the 3'-end of the self-quenching probe is labeled with a fluorescent quencher group.

7. The kit according to claim 6, wherein in the primer-probe set for detecting HBV, the fluorescent reporter group includes FAM, and the fluorescent quencher group includes BHQ1.

8. The kit according to claim 1, wherein the probe in the primer-probe set for detecting HCV is a self-quenching probe.

9. The kit according to claim 8, wherein in the primer-probe set for detecting HCV, the 5'-end of the self-quenching probe is labeled with a fluorescent reporter group, and the 3'-end of the self-quenching probe is labeled with a fluorescent quencher group.

10. The kit according to claim 9, wherein in the primer-probe set for detecting HCV, the fluorescent reporter group includes VIC, and the fluorescent quencher group includes BHQ1.

11. The kit according to any one of claims 1 to 10, characterized in that, It further includes: PCR reaction solution and enzyme mixture; wherein, the enzyme mixture includes reverse transcriptase, DNA polymerase and RNase inhibitor.

12. The kit according to claim 11, characterized in that, It further includes: internal standard quality control, positive quality control and negative quality control.

13. A detection method for the kit according to any one of claims 1 to 12, which is for non-diagnostic and non-therapeutic purposes, characterized in that, It includes: extracting the nucleic acid of the sample; performing a PCR amplification reaction on the nucleic acid of the sample using the kit; after the reaction ends, analyzing the result of the reaction.

14. The detection method according to claim 13, characterized in that, The PCR amplification reaction includes: reverse transcription, pre-denaturation, cyclic amplification and cooling.

15. The detection method according to claim 14, wherein the temperature of the reverse transcription is 55±5°C, and the time of the reverse transcription is 15±5 min; the time of the pre-denaturation is 3±1 min; the cyclic amplification includes a first amplification and a second amplification that are carried out cyclically and sequentially; wherein, the temperature of the first amplification is 95±1°C, and the time of the first amplification is 15±5 s; the temperature of the second amplification is 60±2°C, and the time of the second amplification is 30±5 s.

16. Use of a kit according to any one of claims 1 to 12 in the preparation of a product for detecting at least one of HIV, HBV and HCV.

Citation Information

Patent Citations

  • Human immunodeficiency virus (HIV) nucleic acid detection kit

    CN103074446A

  • Fluorescent quantitative PCR kit for simultaneous detection of hepatitis B Virus, hepatitis C Virus and human immunodeficiency virus Type 1

    CN109182600A