Use of reagent for promoting expression of circular RNA circALSM1 in preparation of medicine for treating pulmonary arterial hypertension

Abstract

The application provides application of a reagent for promoting expression of circular RNA circALSM1 in preparation of a drug for treating pulmonary arterial hypertension. The application verifies that an adeno-associated virus vector overexpressing circALSM1 can relieve disease progression of MCT-PAH rats and improve pulmonary vascular remodeling by constructing the adeno-associated virus vector, and provides a feasible strategy for preparation of a related targeted drug.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application of reagents that promote the expression of circular RNA circALSM1 in the preparation of drugs for treating pulmonary hypertension. Background Technology

[0002] Pulmonary arterial hypertension (PAH) is a pathophysiological disease with diverse clinical manifestations that can complicate most cardiovascular and respiratory diseases. PAH is currently considered a serious public health issue threatening human physical and mental well-being. The main pathological change in PAH is pulmonary vascular remodeling. Pulmonary vascular remodeling is characterized by the accumulation of different vascular cells in the pulmonary artery wall (pulmonary artery endothelial cells (PAECs), smooth muscle cells, fibroblasts, myofibroblasts, and pericytes, etc.), accompanied by perivascular inflammatory cell infiltration.

[0003] Although there are currently various targeted drugs for the treatment of PAH, these targeted drugs aim to dilate pulmonary vessels and cannot completely reverse pulmonary vascular remodeling and control inflammation. Therefore, in order to reverse pulmonary vascular remodeling, it is urgent for us to better understand the pathophysiological mechanism of pulmonary artery remodeling and provide corresponding strategies for the research of specific therapeutic drugs. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, the present invention provides the application of a reagent that promotes the expression of circular RNA circALSM1 in the preparation of drugs for treating pulmonary hypertension.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention is to provide the use of a reagent that promotes the expression of circular RNA circALSM1 in the preparation of a drug for treating pulmonary hypertension.

[0007] Furthermore, the reagents used to promote the expression of the circular RNA circALSM1 include a circALSM1 overexpression vector.

[0008] Furthermore, the aforementioned vector is one of adeno-associated virus vectors, adenovirus vectors, lentivirus vectors, or retrovirus vectors.

[0009] A second aspect of the invention is the use of a reagent that promotes the expression of the circular RNA circALSM1 in the preparation of drugs that reverse or improve pulmonary vascular remodeling.

[0010] Furthermore, the reagents used to promote the expression of the circular RNA circALSM1 include a circALSM1 overexpression vector.

[0011] Furthermore, the aforementioned vector is one of adeno-associated virus vectors, adenovirus vectors, lentivirus vectors, or retrovirus vectors.

[0012] A third aspect of the present invention is to provide a pharmaceutical composition for treating pulmonary hypertension, or reversing or improving pulmonary vascular remodeling, comprising an agent that promotes the expression of circular RNA circALSM1.

[0013] Furthermore, the reagents used to promote the expression of the circular RNA circALSM1 include a circALSM1 overexpression vector.

[0014] Furthermore, the aforementioned vector is one of adeno-associated virus vectors, adenovirus vectors, lentivirus vectors, or retrovirus vectors.

[0015] Furthermore, the above-mentioned pharmaceutical composition also includes a pharmaceutically acceptable carrier or excipient.

[0016] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:

[0017] This invention constructs an adeno-associated virus vector overexpressing circALSM1 and verifies that this adeno-associated virus vector can alleviate disease progression and improve pulmonary vascular remodeling in MCT-PAH rats, providing a practical strategy for the preparation of related targeted drugs. Attached Figure Description

[0018] Figure 1 A flowchart of rat MCT-PH modeling in one embodiment of the present invention is shown;

[0019] Figure 2 The results of echocardiographic assessment of cardiac function in four rat groups (control, MCT, MCT-AAV-NC, and MCT-AAV) are shown in one embodiment of the present invention. Figure A shows the echocardiographic results of rat RVEDD; Figure B shows the echocardiographic results of rat PAT.

[0020] Figure 3 The figures show the results of right ventricular vasculature (RVSP) detection in four rat groups (control, MCT, MCT-AAV-NC, and MCT-AAV) using right heart catheterization and the results of right ventricular hypertrophy assessment using the Fulton index in one embodiment of the present invention; Figure A shows the RVSP results; Figure B shows the Fulton index.

[0021] Figure 4 The figure shows the fluorescent expression of GFP in the pulmonary artery intima in the MCT-AAV-NC group and the MCT-AAV group in one embodiment of the present invention (Figure A) and the quantitative expression of circALSM1 in the lung tissue of the two groups by qRT-PCR (Figure B).

[0022] Figure 5 The figure shows HE staining images of four rat groups (control, MCT, MCT-AAV-NC, and MCT-AAV) in one embodiment of the present invention (Figure A) and a bar chart of the pulmonary vascular media thickness of each rat group (Figure B). Detailed Implementation

[0023] This invention provides the application of a reagent that promotes the expression of the circular RNA circALSM1 in the preparation of drugs for treating pulmonary arterial hypertension. The invention is described in detail below with reference to specific embodiments and accompanying drawings to provide a better understanding; however, these embodiments do not limit the scope of the invention.

[0024] In the following examples, Student's t-test and analysis of variance were used. Statistical results are expressed as mean ± standard error (mean ± SE). Each group had at least three samples, and each experiment was repeated at least three times. All statistical tests were two-tailed tests, and P < 0.05 was considered statistically significant. Statistical analysis and graphing were performed using SPSS (Statistical Package for Social Science, Chicago, IL, USA) 25.0, GraphPad Prism (San Diego, CA, USA) 8.0, and Image J (National Institutes of Health) 1.8.0.

[0025] Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared according to conventional methods, unless otherwise specified.

[0026] Example 1

[0027] This embodiment constructs a PAH rat model. The specific construction process and grouping are as follows:

[0028] 1. Construct a viral vector overexpressing circALSM1 with green fluorescent protein (GFP).

[0029] (1) Adeno-associated virus (AAV) packaging

[0030] The three-plasmid system consists of pAAV-RC, pHelper, and a shuttle plasmid (carrying the circALSM1 gene coding sequence). The sequences are as follows:

[0031] ATGCCTCAGTTCAAGTGCTAATCACTGGGGATGAGAACCTCTCAGACA

[0032] AAAAACAGCAAGAGATTCACAGTACAAGGGCAGTGACTGAGGCTGCCCA

[0033] GGCTAAAGAAAAGAATCTTTGCAGAAAGATACTGCAGATTCCAGTGCTG

[0034] CTGCTGCTGCAGAGCACTCAGCTCAAGTAGGAGACCCAGAAATGAAGAAC

[0035] TTGCCAGACACTAAAGCCATTACACAGAAAGAGGAGATCCATAGGAAGAA

[0036] GACAGTTCCCGAGGAAGCCTGGCCAAACAATAAAGAATCCCTACAGATCA

[0037] ATATTGAAG (SEQ ID NO.1)

[0038] Day 1: 293T cells were passaged into 100cm plates for transfection. After the procedure, the plates were placed in an incubator at 37°C, 5% CO2, and 95% relative humidity.

[0039] (2) Transfection can proceed once the cell density reaches approximately 80-90% confluence. The transfection complex system required for transfecting a 100cm plate is as follows:

[0040]

[0041] (3) Change medium: Replace with fresh complete medium containing 10% fetal bovine serum (FBS) 6 hours after transfection.

[0042] (4) Cell collection: 72 h after transfection, the cells containing AAV particles were gently scraped off with a cell scraper and collected in a 15 mL centrifuge tube. The cells were collected by centrifugation at 150 × g for 3 min. The culture supernatant was removed, the cells were washed once with PBS, and finally the cells were resuspended in 300 μL PBS.

[0043] (5) Cell disruption: Prepare a 37°C constant temperature water bath and liquid nitrogen. Repeat the freeze-thaw cycle three times in liquid nitrogen and a 37°C water bath. 4°C, 2000×g, 5min, remove cell debris and collect the lysate supernatant containing AAV particles.

[0044] (6) Purification and titer detection.

[0045] 2. Establishment of a monocrotaline (MCT)-induced PAH rat model

[0046] Male, clean-grade Sprague-Dawley rats, weighing 200–220 g and 8 weeks old, were purchased from the Animal Experiment Center of Tongji University. The rats were housed separately in a clean environment in the Tongji University animal facility for one week to acclimatize. Subsequently, the rats were randomly divided into four groups: a normal control group (control group), an MCT group, an MCT combined with AAV-NC (negative control) group (MCT-AAV-NC), and an MCT combined with AAV group (MCT-AAV). Figure 1 As shown, rats were administered AAV-circALSM1 and AAV-NC 200 μL (viral titer 2 × 10⁻⁶) 2 weeks and 1 week before MCT administration. 12 Rats were given two tracheal injections, followed by a single subcutaneous injection of MCT (60 mg / kg) into the neck and back of the neck. The control group received an equal volume of saline to establish a pH model. On the second day after MCT administration, each rat underwent a tracheotomy. The control and MCT groups received the same volume of saline. The MCT combined with AAV-NC group received 200 μL of AAV-NC via tracheotomy, and the MCT combined with AAV group received 200 μL of AAV (virus titer 2 × 10⁻⁶) via tracheotomy. 12 The specific steps for endotracheal injection are as follows:

[0047] (1) After anesthetizing the rats, place them in a supine position with their heads extended backward to keep the trachea in the midline position, which facilitates the exposure of the trachea;

[0048] (2) Make a longitudinal incision in the midline of the anterior neck, along with the skin, subcutaneous tissue and superficial fascia;

[0049] (3) Bluntly dissect the anterior neck tissues and muscles. During this process, the trachea must be kept in the center to prevent it from being pulled and displaced.

[0050] (4) Expose the anterior wall of the trachea, and inject the prepared adeno-associated virus drop and its control into the trachea using a 1mL insulin syringe. Take care to prevent the rat from dying due to too rapid an injection.

[0051] (5) Remove the syringe and suture the anterior neck muscles and skin.

[0052] Each group was provided with sufficient food and water, and the environment was kept suitable. They were raised under the same conditions for 28 days. The rats underwent echocardiography and right heart catheterization, and samples from the heart, lungs, and peripheral blood were collected.

[0053] Example 2

[0054] This embodiment, based on Example 1, performs echocardiography and hemodynamic testing on rats. The specific experimental steps and results are as follows:

[0055] 1. Color Doppler echocardiography of rats

[0056] On day 28 after subcutaneous injection of MCT, hemodynamics and cardiac-related parameters were assessed using small animal ultrasound. Animals in each group were anesthetized with a 1.5% isoflurane-oxygen mixture, and the fur on their necks and chests was shaved before placing them on an echocardiography platform. The probe was positioned on the left side of the sternum at an angle of 10°–30° to the sternal midline to display the long-axis section of the left ventricle. M-curve measurements were taken guided by the two-dimensional image. Doppler flow was detected at the mitral, aortic, and pulmonary valve orifices on the parasternal long-axis and pulmonary artery long-axis sections. Based on the standards established by the American Society of Echocardiography (ASE), heart rate, transverse and longitudinal diameters of the atrioventricular chambers at end-diastole and end-systole, right ventricular free wall thickness, interventricular septum thickness, right ventricular short-axis shortening, tricuspid annular systolic displacement, ejection fraction, cardiac output, and stroke volume were measured.

[0057] 2. Rat hemodynamic testing

[0058] A self-made modified silicone catheter was used to perform right heart catheterization via the right jugular vein to measure hemodynamic parameters in rats. The specific procedure is as follows:

[0059] (1) Connect the self-made improved silicone tubing tee to the pressure converter and connect it to the powerLab signal acquisition system;

[0060] (2) Anesthetize each group of animals with isoflurane-oxygen mixture (1.5%). After successful anesthesia, fix the rats in a supine position on the operating platform.

[0061] (3) Use tissue scissors to cut open the skin on the right side of the rat's neck, bluntly separate the subcutaneous tissue and fat, expose the right common jugular vein, use vascular clamps to clamp the proximal end of the vessel, and ligate the distal end of the vessel with surgical sutures;

[0062] (4) Place the pad under the right common jugular vein, use ophthalmic scissors to make a "V" shaped incision on the anterior wall of the blood vessel, place ophthalmic forceps in the blood vessel to enlarge the blood vessel, insert the catheter, release the blood vessel clamp, ligate the proximal end of the blood vessel, and fix the catheter.

[0063] (5) Slowly push the catheter and judge the position of the catheter based on the waveform given by the signal acquisition system. When a huge sawtooth wave appears, it indicates that the catheter has successfully entered the right ventricle.

[0064] (6) Record waveforms continuously and monitor the right ventricular pressure and pulmonary artery pressure of rats; after the measurement is completed, remove the catheter and collect tissue samples from the heart, lungs and other organs.

[0065] like Figure 2 As shown in Figure A, the right ventricular enddiastolic dimension (RVEDD) of rats in the MCT group was significantly increased compared to the control group (P = 0.0204). The RVEDD was decreased in the MCT-AAV group compared to the MCT-AAV-NC group, but the difference was not statistically significant (P = 0.0940). Figure 2 As shown in Figure B, the pulmonary artery acceleration time (PAT) in the MCT group was significantly lower than that in the control group (P = 0.0308). After AAV treatment, the PAT in the MCT-AAV group was significantly higher than that in the MCT-AAV-NC group (P = 0.0026). These results indicate that circALSM1 can improve cardiac function in MCT-PAH rats.

[0066] like Figure 3 As shown in Figure A, the results of right heart catheterization revealed that, compared with the control group, the right ventricular systolic pressure (RVSP) in the MCT group was significantly higher (P<0.0001), and the RVSP in the MCT-AAV group was significantly lower than that in the control group (P<0.0001). This indicates that circALSM1 can improve the right ventricular systolic pressure in MCT-PAH rats.

[0067] Example 3

[0068] In this embodiment, after the hemodynamic parameters were measured, peripheral blood, heart, lung tissue, and other tissue samples were collected and relevant tests were performed. The specific experimental steps and results are as follows:

[0069] 1. Animal specimen collection

[0070] (1) Fix the rat’s limbs on the dissection table, expose the entire chest and abdomen, cut the abdomen from bottom to top along the midline of the abdomen until the xiphoid process, turn the liver upward to expose the porta hepatis, insert the blood collection tube into the portal vein along the porta hepatis, draw 5-10 mL of venous blood, centrifuge at 3000 rpm at 4℃ for 10 minutes, take the supernatant, and store at -80℃ for later use.

[0071] (2) Cut along the rib margin of the rat to both sides, lift the xiphoid process to expose the diaphragm, cut the diaphragm to expose the heart and lungs, irrigate the heart and lung tissue with heparinized saline until the lungs turn white, and remove the heart and lungs;

[0072] (3) Blood vessels were removed from the heart tissue, and the right ventricular (RV), left ventricular and septal (LV+S) were separated. After the water was absorbed with filter paper, the parts were weighed and recorded. The Fulton index (RV / (LV+S)) was used to calculate the right ventricular hypertrophy index, which reflects the right ventricular hypertrophy in rats. After weighing, a 5mm × 5mm part of the right ventricular was soaked in 4% paraformaldehyde solution for subsequent experiments. The remaining part was flash-frozen in liquid nitrogen and stored at -80℃ for later use.

[0073] (4) After the whole lung tissue of the rat was removed, it was soaked in physiological saline. The right upper lung tissue was placed in 4% paraformaldehyde solution for subsequent experiments. The remaining part was quick-frozen in liquid nitrogen and stored at -80℃ for later use.

[0074] 2. Frozen sections of fresh lung tissue

[0075] (1) Fresh lung tissue (1×1×1cm) was immediately taken from the rats after the right heart catheterization examination and quickly frozen in liquid nitrogen;

[0076] (2) Apply a layer of OCT embedding gel to the sample holder, place the quick-frozen tissue on top of the sample holder, and place it in a 4°C refrigerator for 5-10 minutes to allow the OCT gel to penetrate the lung tissue.

[0077] (3) Remove the tissue and place it on a glass slide, then freeze the sample quickly;

[0078] (4) Place the tissue on the sample holder, apply another layer of OCT embedding gel to the tissue to completely cover it, and place it on a quick-freezing rack for 30 minutes.

[0079] (5) Slicing: Use a constant temperature cryostat to slice the slices. After slicing, fix the slices with acetone and air dry at room temperature.

[0080] 3. Paraffin embedding of heart and lung tissue

[0081] (1) The cardiopulmonary tissue fixed with 4% paraformaldehyde solution was removed and placed in a dehydration box;

[0082] (2) Dehydration: Place the dehydration box in the dehydration machine and dehydrate the tissue with alcohol in sequence, that is: 75% alcohol for 4 hours, 85% alcohol for 2 hours, 90% alcohol for 2 hours, 95% alcohol for 1 hour, anhydrous ethanol for the first dehydration for 30 minutes, and then dehydrate again for 30 minutes with fresh anhydrous ethanol.

[0083] (3) Transparency: The first treatment was with 1 / 2 ethanol + 1 / 2 xylene for 60 min, followed by treatment with xylene for 60 min, and finally treatment with xylene for 60 min.

[0084] (4) Infiltration: The first treatment was with 1 / 2 xylene + 1 / 2 paraffin for 90 min, followed by paraffin treatment for 120 min, and then the paraffin was replaced and treated for 120 min.

[0085] (5) Embedding: Place the wax-impregnated tissue into the embedding machine. First, place the melted wax into the embedding frame. Before the wax solidifies, remove the tissue and label it. Cool it on a -20℃ freezing stage.

[0086] (6) Sectioning: Place the wax block on a paraffin microtome to section it. The section thickness is 4μm. Flatten the tissue, place it on a glass slide, and bake it in a 60℃ oven. After the water is dried and the wax is melted, take it out and store it at room temperature for later use.

[0087] 4. Hematoxylin-eosin (HE) staining

[0088] (1) Dewaxing to water: The paraffin sections of the tissue were soaked in 100% xylene for 10 min three times in sequence; then they were successively subjected to 100% ethanol, 95% ethanol, 75% ethanol, 50% ethanol and deionized water, each gradient for 5 min.

[0089] (2) Staining: Stain with hematoxylin for 5 minutes. The staining time can be increased or decreased as appropriate. Rinse with running water.

[0090] (3) Use a pipette to draw 5% acetic acid and drop it onto the tissue. The acetic acid will differentiate the tissue for 1 minute. After differentiation, the color will lighten. Rinse with running water.

[0091] (4) Stain with eosin for 1 minute. The staining time can be increased or decreased as appropriate. Rinse with running water.

[0092] (5) Dehydration: 70% alcohol, 80% alcohol, 90% alcohol, and anhydrous alcohol for 1 min each, and anhydrous ethanol for 5 min;

[0093] (6) Transparency: First treatment with xylene for 2 minutes, then treatment with xylene for 2 minutes;

[0094] (7) Sealing: Cover with a coverslip and seal with neutral resin;

[0095] (8) Image acquisition: Observe and photograph the pulmonary arterioles under a microscope;

[0096] (9) Image analysis: Pulmonary arteriolar media thickness (%) = (outer diameter of vessel - inner diameter of vessel) / outer diameter of vessel × 100, which reflects the degree of pulmonary arteriolar media thickening. The analysis software used was Image-Pro Plus.

[0097] like Figure 3 As shown in Figure B, compared with the control group, the Fulton index of the MCT group was significantly increased (P<0.0001), and the Fulton index of the AAV-circALSM1 tracheal injection prevention group was significantly decreased compared with the control group (P=0.0077). This indicates that circALSM1 can improve the degree of right ventricular hypertrophy in MCT-PH rats.

[0098] like Figure 4 As shown in Figure A, microscopic observation of frozen sections of lung tissue from rats in the AAV-NC and AAV groups revealed that GFP was mainly expressed in the pulmonary vascular endothelium, indicating that circALSM1 is primarily expressed and functions in the lung endothelium. Simultaneously, we performed qRT-PCR experiments on lung tissues from rats in the MVT-AAV-NC and MCT-AAV groups to quantify the expression efficiency of circALSM1. The results are shown in Figure A. Figure 4 As shown in Figure B, the expression level of circALSM1 in the lung tissue of rats in the MCT-AAV group was significantly higher than that in the AAV-NC group (P<0.0001).

[0099] like Figure 5 As shown in the HE staining, compared with the control group, the pulmonary arteriolar media in the MCT group was significantly thickened, and the lumen was significantly narrowed (P<0.0001), with a large number of inflammatory cells infiltrating the perivascular area. In contrast, the pulmonary vascular media thickness in the MCT-AAV group was significantly lower than that in the MCT-AAV-NC group (P<0.0001), and the degree of peripheral inflammatory infiltration was reduced, indicating that circALSM1 can improve pulmonary vascular remodeling.

[0100] In conclusion, circALSM1 can alleviate disease progression and improve pulmonary vascular remodeling in MCT-PAH rats.

[0101] Specific embodiments have been described in detail, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. Application of the circular RNA circALSM1 in the preparation of a drug for treating pulmonary arterial hypertension, characterized in that, The nucleotide sequence of the circular RNA circALSM1 is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The drug for treating pulmonary arterial hypertension comprises a circALSM1 overexpression vector.

3. Use according to claim 2, characterized in that, The vector is one of an adeno-associated virus vector, an adenovirus vector, and a retrovirus vector.

Images