Genes related to LDL-C and in vitro detection reagents, preparations or kits and applications thereof

Abstract

The present invention relates to the technical field of dyslipidemia-related genes in bioengineering, and is a gene related to LDL-C and a reagent, preparation or kit and application for in vitro detection thereof, and the gene related to LDL-C is the ABCC1 gene with a mutation at the rs35605 site. The present invention discloses a low-density lipoprotein cholesterol-related gene and an in vitro detection system and application thereof. In addition to being used for in vitro detection of polymorphisms of low-density lipoprotein cholesterol-related genes, the in vitro detection system can also be used for detection, prevention, diagnosis or treatment of hypercholesterolemia, thereby reducing the incidence of hypercholesterolemia, which is of great significance for the prevention and treatment of dyslipidemia-related diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of dyslipidemia-related genes in bioengineering, and is a gene related to LDL-C and a reagent, preparation or kit for in vitro detection thereof and application thereof. Background Art

[0002] Elevated low-density lipoprotein cholesterol (LDL-C) is one of the most dangerous factors for the development of atherosclerotic cardiovascular disease. Both the FOURIER and ODYSSEY studies have shown that maximally reducing LDL-C levels can bring the greatest cardiovascular benefits. Although the diagnosis and treatment of hypercholesterolemia have made great progress in recent years, new chemical and biological agents for lipid-lowering treatment have continued to emerge, and lipid-lowering treatment has greatly improved the prognosis of patients with hypercholesterolemia, its etiology and pathogenesis are still unclear. Since scientists discovered in the 1970s that low-density lipoprotein receptor (LDLR) gene mutations cause familial hypercholesterolemia (FH) and premature cardiovascular disease, people's understanding of hypercholesterolemia has also greatly improved. It has been recognized that hypercholesterolemia is not just a single-factor disease, but a complex disease determined by multiple endogenous and exogenous factors. In addition to traditional risk factors, such as high-fat diet, hypertension, diabetes, smoking and other environmental factors, genetic factors also play an important role in the development of hypercholesterolemia. At present, 157 genes related to lipid levels have been established through genome-wide association studies (GWAS). In our early stage, we used whole exome sequencing (WES) combined with family studies, and screened out a new gene LIMA1 that affects intestinal cholesterol uptake through bioinformatics analysis; we discovered and verified the induced degradation factor IDOL gene of LDLR.

[0003] Cholesterol metabolism is mainly divided into four pathways: synthesis, uptake, efflux, and esterification. Among them, the ATP-binding cassette transporter superfamily plays a key role in cholesterol efflux. GWAS, WES, and basic research have found and confirmed that members of the ATP-binding cassette transporter superfamily, such as ABCA1, ABCG1, ABCG5, and ABCG8, are associated with cholesterol efflux, and the degree of atherosclerosis in gene knockout animals is significantly aggravated. ABCA1 and ABCG1 are widely expressed in tissues throughout the body. Among them, ABCA1 and ABCG1, which are highly expressed in macrophages, affect cholesterol metabolism through possible mechanisms such as coordinating cholesterol efflux and reverse transport degradation. The loss of these two genes will lead to a large amount of lipid deposition in macrophages, thereby aggravating atherosclerosis. ABCG5 and ABCG8 are almost exclusively expressed on the apical surface of hepatocytes and intestinal cells, where they act as heterodimers to mediate the excretion of neutral sterols (including phytosterols and cholesterol) into the bile and intestinal cavity, respectively. Single or combined mutations in ABCG5 or ABCG8 can lead to sitosterolemia.

[0004] At the same time, the ABCC1 gene is located at 16p13.11 and has 35 exons. It is a protein-coding gene. The protein it encodes belongs to the ATP-binding cassette transporter superfamily and is widely expressed in human tissues. Like ABCA1, which has been confirmed to be involved in cholesterol efflux, it is highly expressed in mononuclear macrophages. ABCC1 is also involved in the transport of transmembrane substances inside and outside the cell membrane, such as the transport of steroid hormones and bile salts, and it has also been reported to be involved in fatty acid metabolism. Therefore, the study and analysis of the ABCC1 gene is also more helpful in discovering new pathogenic genes related to hypercholesterolemia. Summary of the invention

[0005] The present invention provides a gene related to LDL-C and a reagent, preparation or kit and application for in vitro detection thereof, which overcomes the deficiencies of the above-mentioned prior art and is more helpful in discovering new pathogenic genes related to hypercholesterolemia, and is of great significance for the prevention and treatment of diseases related to dyslipidemia.

[0006] One of the technical solutions of the present invention is achieved by the following measures: a gene related to LDL-C, namely, an ABCC1 gene with a mutation at the rs35605 site, the nucleotide sequence of the ABCC1 gene with a mutation at the rs35605 site is shown in the sequence table SEQID NO: 1.

[0007] The second technical solution of the present invention is achieved by the following measures: a reagent for in vitro detection of genes related to LDL-C, the reagent is used to detect mutations at the rs35605 site of the ABCC1 gene, and the reagent includes the following primers:

[0008] Upstream primer: 5'ACTGCTCCTAGGATGATGACTCTCACT3'

[0009] Downstream primer: 5'CCTCTCGGAAGTCGCCCCAGC3'.

[0010] The following is a further optimization and / or improvement of the second technical solution of the above invention:

[0011] The above reagent is a reagent combining polymerase chain reaction and restriction fragment length polymorphism analysis.

[0012] The third technical solution of the present invention is achieved through the following measures: a preparation or kit containing reagents for in vitro detection of genes related to LDL-C, the preparation or kit comprising reagents, PCR amplification enzymes and corresponding buffers, PspPI restriction endonucleases and corresponding enzyme cleavage maps.

[0013] The above reagents include the following primers:

[0014] Upstream primer: 5'ACTGCTCCTAGGATGATGACTCTCACT3'

[0015] Downstream primer: 5'CCTCTCGGAAGTCGCCCCAGC3'.

[0016] The fourth technical solution of the present invention is achieved by the following measures: use of a reagent for in vitro detection of genes related to LDL-C in the preparation of a preparation or a kit for in vitro detection of genes related to LDL-C.

[0017] The above-mentioned preparation or kit comprises reagents, PCR amplification enzyme and corresponding buffer, PspPI restriction endonuclease and corresponding enzyme cleavage map.

[0018] The above reagents include the following primers:

[0019] Upstream primer: 5'ACTGCTCCTAGGATGATGACTCTCACT3'

[0020] Downstream primer: 5'CCTCTCGGAAGTCGCCCCAGC3'.

[0021] The present invention discloses a low-density lipoprotein cholesterol-related gene and an in vitro detection system and application thereof. In addition to being used for in vitro detection of the polymorphism of the low-density lipoprotein cholesterol-related gene, the in vitro detection system can also be used for detecting, preventing, diagnosing or treating hypercholesterolemia, thereby reducing the incidence of hypercholesterolemia, which is of great significance for the prevention and treatment of dyslipidemia-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Attached Figure 1 This is the enzyme cleavage map of the ABCC1 rs35605 site of the present invention. DETAILED DESCRIPTION

[0023] The present invention is not limited by the following embodiments, and specific implementation methods can be determined according to the technical scheme of the present invention and actual conditions. Unless otherwise specified, the various chemical reagents and chemicals mentioned in the present invention are all known and commonly used chemical reagents and chemicals in the prior art.

[0024] The present invention will be further described below in conjunction with embodiments:

[0025] Example 1: The gene associated with LDL-C is the ABCC1 gene with a mutation at the rs35605 site. The nucleotide sequence of the ABCC1 gene with a mutation at the rs35605 site is shown in the sequence table as SEQ ID NO: 1.

[0026] The test sample containing the ABCC1 gene in the present invention can be obtained from cells from a subject, such as cells from blood, urine, saliva, gastric juice, hair, biopsy and autopsy materials, preferably from blood.

[0027] Example 2: The in vitro reagent for detecting genes related to LDL-C is used to detect mutations at the rs35605 site of the ABCC1 gene, and the reagent includes the following primers:

[0028] Upstream primer: 5'ACTGCTCCTAGGATGATGACTCTCACT3'

[0029] Downstream primer: 5'CCTCTCGGAAGTCGCCCCAGC3'.

[0030] Example 3: As an optimization of the above Example 2, the reagent is a reagent combining polymerase chain reaction and restriction fragment length polymorphism analysis.

[0031] In the present invention, the so-called "gene polymorphism" refers to the difference in the nucleotide sequence of each individual gene in the population. It is known to those skilled in the art that the polymorphic site described in the present invention is a single nucleotide polymorphism (SNP) site, that is, a single nucleotide in the genome sequence changes; the difference in nucleotide sequence can be reflected at the DNA level or the RNA level, so the hypercholesterolemia-related gene of the present invention can be reflected at the DNA level or the RNA level, preferably the DNA level, and more preferably the genomic DNA.

[0032] Example 4: The preparation or kit containing reagents for in vitro detection of genes associated with LDL-C comprises reagents, PCR amplification enzyme and corresponding buffer, PspPI restriction endonuclease and corresponding enzyme cleavage map.

[0033] Example 5: Use of the reagent for in vitro detection of genes associated with LDL-C in the preparation of a preparation or kit for in vitro detection of genes associated with LDL-C.

[0034] Example 6: As an optimization of the above Example 5, the preparation or kit comprises PCR amplification enzyme and corresponding buffer.

[0035] There are currently two strategies for the study of complex trait diseases, the linkage analysis method and the case-control study. Since hypercholesterolemia is a multifactorial disease, it is the result of the combined effects of genetic and environmental factors, so it is difficult to use linkage analysis. From a genetic perspective, hypercholesterolemia is a complex genetic trait disease. Among the factors that play a role in the occurrence of the disease, in addition to environmental factors, the total number of genes that play a role is estimated to be as many as hundreds, and there are interactions between each gene, and there are interactions between genes and the environment. The occurrence of hypercholesterolemia has a certain familial aggregation, but there are more sporadic cases. Therefore, the present invention adopts a case-control study. The case-control study is to compare the frequency of a certain allele in two randomly selected groups of people (a high LDL-C level group and a low LDL-C level group).

[0036] Embodiment 7:

[0037] (1) Selection of research subjects

[0038] Inclusion and exclusion criteria: The subjects were selected from college students aged 18 to 24 who attended Xinjiang Medical University for routine physical examinations from September to December 2018. All of them signed informed consent before inclusion in the study. Those with a history of heart failure, liver and kidney failure, and those who could not cooperate with the researchers were excluded. According to the latest European and American lipid management guidelines, the LDL-C value was 100 mg / dL, or 2.5 mmol / L, as the critical value. The 2824 subjects finally included in the study were divided into a high LDL-C group (LDL-C value ≥ 2.5 mmol / L) with 1405 cases and a low LDL-C group (LDL-C value < 2.5 mmol / L) with 1419 cases. Both groups were Han people.

[0039] (2) Detecting the polymorphism of the hypercholesterolemia-related gene rs35605 site of the present invention by combining polymerase chain reaction with restriction fragment length polymorphism analysis

[0040] Method: PCR reaction system (50μl): 50ng of genomic template DNA (from blood specimens, the DNA in white blood cells can be extracted by phenol-methylenediamine method or salting-out method according to conventional methods), 25ul of 2*powder Taq PCR mastermix, 21ul of deionized water, 1ul of upper and lower primers, PCR reaction on a 96-well PCR automatic cycler, PCR cycle parameters: 95℃ pre-denaturation for 2 minutes; 94℃ for 20 seconds, 65.0℃ for 30 seconds, 72℃ for 1.5 minutes; after 35 cycles, extend at 72℃ for 2 minutes; finally store at 4℃ or observe on the machine. Primers are as follows:

[0041] Upstream primer: 5'ACTGCTCCTAGGATGATGACTCTCACT3'.

[0042] Downstream primer: 5'CCTCTCGGAAGTCGCCCCAGC3'.

[0043] The amplified product was 245 bases long and was digested with PspPI restriction endonuclease. The digestion conditions were referred to the manufacturer's operating manual. The length was then observed using a UV transilluminator after electrophoresis on a 1% agarose gel.

[0044] Results: Figure 1 As shown. Figure 1 It can be seen that when there is only one fragment with a length of 245 bases, it indicates that the allele of the rs35605 site of the individual to be tested is T; when the PCR product with a length of 245 bases is cut to produce two fragments of 177 and 68 bases, it indicates that the allele of the rs35605 site of the individual to be tested is C; when there are three fragments with lengths of 245, 177 and 68 bases, it indicates that the alleles of the rs35605 site of the individual to be tested are T and C. Therefore, lane 1 shows that the genotype of the rs35605 site of the individual to be tested is T / T homozygous, lane 3 shows that the genotype of the rs35605 site of the individual to be tested is C / C homozygous, and lane 5 shows that the genotype of the rs35605 site of the individual to be tested is T / C heterozygous.

[0045] (3) Association study between polymorphic sites and hypercholesterolemia

[0046] To further explore the relationship between the ABCC1 gene and high LDL-C from a genetic perspective and provide genetic epidemiological evidence for similar studies at home and abroad, the internationally accepted genotyping method combining polymerase chain reaction and restriction fragment length polymorphism analysis was used to detect the polymorphism of the rs35605 locus in samples from the tested individuals in vitro in 1405 high LDL-C and 1419 low LDL-C controls, thereby analyzing the distribution differences of the rs35605 locus in high LDL-C and low LDL-C populations.

[0047] First, the Hardy-Weinberg equilibrium test is used. Hardy-Weinberg equilibrium is a concept in population genetics: it mainly refers to a group of people of a nation living in a certain area and can randomly interbreed with each other. The entire genetic information of this group is called the gene pool of the group, which directly reflects the genetic characteristics of the region and the nation. The expression of this genetic information is gene frequency and genotype frequency. In the absence of mutation, migration and genetic drift, the gene frequency and genotype frequency in the population remain unchanged, which is Hardy-Weinberg equilibrium. This has both genetic polymorphism and genetic stability.

[0048] Analysis of the genotyping results showed that the genotyping results were consistent with the Hardy-Weinberg equilibrium, so experimental errors could be excluded and the genotyping results were relatively reliable. The analysis results are shown in Table 2.

[0049] Conclusion: Univariate analysis showed that the distribution of the three genotypes of the polymorphic site rs35605 in the high LDL-C group and the low LDL-C group was significantly different (P < 0.05). Further analysis of the T / C dominant-recessive inheritance pattern showed that the distribution frequency of the C allele and the C / C and T / C genotypes in the high LDL-C group was significantly higher than that in the low LDL-C group (the distribution frequency of allele C: 0.731 in the high LDL-C group and 0.640 in the low LDL-C group; the distribution frequency of the C / C genotype: 51.3 in the high LDL-C group and 45.9 in the low LDL-C group); the distribution frequency of the T / C genotype: 43.5 in the high LDL-C group and 36.2 in the low LDL-C group), and it was statistically significant (P < 0.001). The above research results show that the risk of high LDL-C in people carrying the C allele is higher than that in people carrying the T allele.

[0050] Factors that may affect the results of case-control studies include genetic confounding from the population, disease confounding caused by lax criteria when selecting cases, etc. Although the subjects selected by the inventors were all from young and middle-aged people with fewer underlying diseases, on the basis of excluding confounding factors such as combined heart, liver and kidney dysfunction, the inventors selected 1405 research samples and corresponding controls. In order to further analyze the contribution of the rs35605 site to the risk of high LDL-C, after adjusting other possible influencing factors such as age, gender, smoking, body mass index, uric acid, etc., multivariate logistic regression model analysis was performed. Logistic regression model analysis is a common analysis method in statistics. It is mainly used for the analysis of binary variables and can be used to adjust the factors that cause confounding to the entire analysis. The results are shown in Table 3.

[0051] Results: As shown in Table 3, multivariate logistic regression model analysis showed that after adjusting for other possible influencing factors such as age, gender, smoking, body mass index, uric acid, etc., the rs35605 locus still remained a risk factor for high LDL-C [T / C genotype and C / C genotype significantly increased the risk of hypercholesterolemia compared with T / T genotype, with OR value = 1.611, 95% CI (1.104-2.253); OR value = 1.526, 95% CI (1.056-2.205); and it was statistically significant (P < 0.001).

[0052] Conclusion: This indicates that the ABCC1 gene with polymorphic site rs35605 mutation is an LDL-C related gene. The risk of hypercholesterolemia in individuals carrying the C allele is significantly increased compared with those carrying the T allele. Therefore, the preparation or kit for in vitro detection of the ABCC1 gene with rs35605 mutation can be used clinically for the detection, prevention, diagnosis or treatment of hypercholesterolemia.

[0053] In summary, the present invention discloses a low-density lipoprotein cholesterol-related gene and an in vitro detection system and application thereof. In addition to being used for in vitro detection of polymorphisms of low-density lipoprotein cholesterol-related genes, the in vitro detection system can also be used to detect, prevent, diagnose or treat hypercholesterolemia, thereby reducing the incidence of hypercholesterolemia, which is of great significance for the prevention and treatment of dyslipidemia-related diseases.

[0054] The above technical features constitute the embodiments of the present invention, which have strong adaptability and implementation effect. Non-essential technical features can be added or reduced according to actual needs to meet the requirements of different situations.

[0055] Sequence Listing

[0056] <110> The First Affiliated Hospital of Xinjiang Medical University

[0057] <120> In vitro detection system and application of single nucleotide polymorphism rs35605 associated with LDL-C

[0058] <130>

[0059] <160> 3

[0060] <170>

[0061] <210> 1

[0062] <211> 245

[0063] <212> DNA

[0064] <213> Artificial sequence

[0065] <400> 1

[0066] actgctccta ggatgatgac tctcactcgg ggcacagcag tcagcactgg gcgttctgct 60

[0067] tgcaggtggc cttgtgcaca tttgccgtct acgtgaccat tgacgagaac aacatcctgg 120

[0068] atgcccagac agccttcgtg tctttggcct tgttcaacat cctccggttt cccctgaaca 180

[0069] ttctccccat ggtcatcagc agcatcgtgc aggtacaggg ggaagctggg gcgacttccg 240

[0070] agagg 245

[0071] <210> 2

[0072] <211> 27

[0073] <212> DNA

[0074] <213> Artificial Sequence

[0075] <400> 2

[0076] actgctccta ggatgatgac tctcact 27

[0077] <210> 3

[0078] <211> 21

[0079] <212> DNA

[0080] <213> Artificial Sequence

[0081] <400> 3

[0082] cctctcggaa gtcgccccag c 21

[0083]

Claims

1. Use of a reagent for in vitro detection of genes associated with LDL-C in the preparation of a preparation or kit for in vitro detection of genes associated with LDL-C, characterized in that The preparation or kit comprises reagents, PCR amplification enzyme and corresponding buffer, PspPI restriction endonuclease and corresponding enzyme cleavage map, and the reagents include the following primers: Upstream primer: 5'ACTGCTCCTAGGATGATGACTCTCACT3' Downstream primer: 5'CCTCTCGGAAGTCGCCCCAGC3', Among them, the gene related to LDL-C is the ABCC1 gene with a mutation at the rs35605 site, and the nucleotide sequence of the ABCC1 gene with a mutation at the rs35605 site is shown in the sequence table SEQ ID NO: 1, and the reagent is a reagent combining polymerase chain reaction and restriction fragment length polymorphism analysis.

Images