Construction of PPARγ knockout cell line and its application as PRRSV production cell line

Abstract

The present invention belongs to the technical field of antiviral research, and specifically relates to the construction of a PPARγ knockout cell line and its application as a PRRSV production cell line. First, the present invention unexpectedly discovered that knocking out the PPARγ gene in the host cell can significantly promote the replication of PRRSV. Therefore, the cell line constructed by inhibiting / interfering / silencing / knocking out the PPARγ gene in the host cell can be used as a PRRSV or PRRSV vaccine production cell line to promote the production of PRRSV or PRRSV vaccine; secondly, the PPARγ gene can be used as a target for screening drugs for preventing or treating PRRS, for the development of drugs for preventing and treating PRRSV and the research of anti-PRRSV transgenic pigs, and has broad application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of antiviral research, and specifically relates to the construction of a PPARγ knockout cell line and the application of the cell line as a PRRSV production cell line. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS), commonly known as "blue ear disease", is a major viral disease that is extremely harmful to the global pig industry. The pathogen of the disease is porcine reproductive and respiratory syndrome virus (PRRSV), which mainly causes reproductive disorders in pregnant sows and respiratory diseases in growing pigs of all ages, causing significant economic losses to the pig industry. The direct economic losses caused by the disease to the pig industry in the United States alone are as high as 664 million US dollars per year, and the losses caused to my country's pig industry exceed 2 billion US dollars per year. The disease first broke out in my country in 1995. In 2006, a large-scale outbreak of highly pathogenic PRRS caused mainly by variants of the North American type of highly pathogenic PRRS virus (HP-PRRSV) caused an almost devastating blow to my country's pig industry. In 2013, the NADC30-like PRRSV strain isolated in the United States in 2008 appeared, followed by various recombinant strains. Due to the high variability and complex infection characteristics of the virus, PRRSV contamination is still widespread and the strain types are complex. No substantial progress has been made in the control of the disease. Due to the high variability, diversity of strains, and super strong immunosuppression and immune escape capabilities of PRRSV, the existing commercial vaccines cannot provide satisfactory protection, which poses a huge challenge to the effective prevention and control of PRRSV. Therefore, it is urgent to conduct in-depth research on the host-PRRSV interaction mechanism and discover the molecules that regulate virus replication from the host source to provide new references for the formulation of safe and effective PRRSV prevention and control strategies.

[0003] PPARγ is a member of the peroxisome proliferator-activated receptor family and has been widely studied in diabetes, cancer and various allergic diseases for many years. Currently, existing reports have shown that PPARγ can enhance viral replication in cells infected with human cytomegalovirus (HCMV).

[0004] The present invention unexpectedly discovered that knocking out the PPARγ gene in the host MARC-145 cells can significantly promote the replication of PRRSV, and can be used as a PRRSV or PRRSV vaccine production cell line; and the PPARγ gene can be used as a target for screening drugs for preventing or treating PRRS, which has broad application prospects. Summary of the invention

[0005] In view of the above technical problems, the purpose of the present invention is to provide a construction of a PPARγ knockout cell line and its application as a PRRSV production cell line. Specifically, it includes the following contents:

[0006] In a first aspect, the present invention provides an application of PPARγ as a target in screening drugs for preventing or treating porcine reproductive and respiratory syndrome, wherein the drug promotes the expression of PPARγ.

[0007] In a second aspect, the present invention provides a use of PPARγ or a recombinant vector / plasmid expressing PPARγ in the preparation of a drug for preventing or treating porcine reproductive and respiratory syndrome.

[0008] In a third aspect, the present invention provides the use of a PPARγ gene knockout / deficient cell line as a cell line for producing porcine reproductive and respiratory syndrome virus or virus vaccine.

[0009] In a fourth aspect, the present invention provides the use of an agent for inhibiting / silencing / interfering with PPARγ gene expression in the preparation of porcine reproductive and respiratory syndrome virus or virus vaccine production cell lines.

[0010] Preferably, the agent for inhibiting / silencing / interfering with PPARγ gene expression comprises sgRNA that specifically targets the PPARγ gene.

[0011] Preferably, the sequence of the sgRNA is as follows:

[0012] Sense strand: CACCGGGCTGCCAGTTTCGCTCCG;

[0013] Antisense strand: AAACCGGAGCGAAACTGGCAGCCC.

[0014] In a fifth aspect, the present invention provides a sgRNA that specifically targets the PPARγ gene, and the sequence of the sgRNA is as follows:

[0015] Sense strand: CACCGGGCTGCCAGTTTCGCTCCG;

[0016] Antisense strand: AAACCGGAGCGAAACTGGCAGCCC.

[0017] In a sixth aspect, the present invention provides the use of the sgRNA described in the fifth aspect in knocking out / deleting the PPARγ gene or in preparing a PPARγ gene knockout / deletion cell line.

[0018] In the seventh aspect, the present invention provides a reagent or kit for knocking out the PPARγ gene, the reagent or kit comprising the sgRNA described in the fifth aspect above, or a targeting vector for targeted knockout of the PPARγ gene; the targeting vector for targeted knockout of the PPARγ gene comprises the sgRNA described in the fifth aspect above and the coding sequence of the Cas9 protein gene.

[0019] In an eighth aspect, the present invention provides a PPARγ gene knockout / deficient cell line, and the method for constructing the PPARγ gene knockout / deficient cell line is: using the CRISPR / Cas9 system and the sgRNA described in the fifth aspect to knock out the PPARγ gene in the host cell.

[0020] In a ninth aspect, the present invention provides a MARC-145 cell line with PPARγ gene knockout / deficient, wherein the method for constructing the MARC-145 cell line comprises the following steps:

[0021] (1) preparing the sgRNA targeting the PPARγ gene as described in the fifth aspect above;

[0022] (2) annealing the sgRNA prepared in step (1) and connecting it to a lentiviral knockout plasmid to obtain a lentiviral knockout plasmid that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence;

[0023] (3) The lentiviral knockout plasmid prepared in step (2) was transfected into MARC-145 cells, and the PPARγ gene knockout / deficient MARC-145 cell line was obtained by puromycin antibiotic selection and cell limiting dilution method.

[0024] In the tenth aspect, the present invention provides the use of the cell lines described in the eighth and ninth aspects as cell lines for producing porcine reproductive and respiratory syndrome virus or virus vaccines.

[0025] The beneficial effects of the present invention are: first, the present invention unexpectedly discovered that knocking out the PPARγ gene in the host cell can significantly promote the replication of PRRSV. Therefore, the cell line constructed by inhibiting / interfering / silencing / knocking out the PPARγ gene in the host cell can be used as a PRRSV or PRRSV vaccine production cell line to promote the production of PRRSV or PRRSV vaccine; secondly, the PPARγ gene can be used as a target for screening drugs for preventing or treating PRRS, for developing drugs for preventing and treating PRRSV and for research on anti-PRRSV transgenic pigs, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0027] Figure 1 The sgRNA sequence information designed by the present invention for the PPARγ genome in MARC-145 cells;

[0028] Figure 2 Western blot detection results of the PPARγ knockout cell line constructed by the present invention; wherein, normal cell control: MARC-145 normal cells; PPARγ knockout cells: MARC-145 cells with PPARγ knockout;

[0029] Figure 3 Western blot detection results of PRRSV N protein after normal cell control and PPARγ knockout cell line were infected with HP-PRRSV GD-HD strain; the normal cell control was MARC-145 normal cells infected with HP-PRRSV GD-HD strain; PPARγ knockout cells: PPARγ knockout MARC-145 cells infected with HP-PRRSV GD-HD strain;

[0030] Figure 4 Virus titer in the cell culture supernatant after normal cell control and PPARγ knockout cell lines were infected with HP-PRRSV GD-HD strain; the normal cell control was MARC-145 normal cells infected with HP-PRRSV GD-HD strain; PPARγ knockout cells: PPARγ knockout MARC-145 cells infected with HP-PRRSV GD-HD strain. DETAILED DESCRIPTION

[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] DMEM medium and Opti-MEM medium were purchased from LifeTech; trypsin and fetal bovine serum were purchased from BI; sgRNA sequences and primers were synthesized by Xi'an Qingke Jersey Biotechnology Co., Ltd.; PPARγ polyclonal antibody was purchased from Chengdu Zhengneng Biotechnology Co., Ltd.; tubulin monoclonal antibody was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; Esp3I restriction endonuclease was purchased from ThermoFisher Scientific; Lenti-CRISPRv2 lentiviral knockout plasmid and psPAX2, pMD2.G lentiviral helper plasmid, HEK-293T cells (human embryonic kidney cells) and MARC-145 cells (a cell line derived from rhesus monkey kidney cells MA-104), highly pathogenic PRRSV strain GD-HD and PRRSV-N protein monoclonal antibody were preserved by Xiao Shuqi's pig disease prevention and control research group, Livestock Disease Pathogen Biology Research Center, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0033] Example 1 Construction of PPARγ gene knockout MARC-145 cell line

[0034] In this example, MARC-145 cells were used as an example to construct a PPARγ gene knockout cell line, which specifically includes the following contents: 1. Design of sgRNA

[0035] This example takes MARC-145 cells as an example. Figure 1 As shown, sgRNA was designed in the sixth exon of the African green monkey PPARγ gene (sequence number NW_023666077.1), and the sequence is shown in Table 1 below:

[0036] Table 1 sgRNA sequence information

[0037]

[0038] Note: The bold and underlined part is the sticky end.

[0039] 2. Denaturation and annealing of sgRNA

[0040] The two synthesized sgRNA single-stranded oligonucleotides were denatured and annealed into double-stranded oligonucleotide fragments. The reaction procedure was 37°C for 30 min; 95°C for 5 min; 5°C / min to 25°C. Then, the product was added with ddH2O at a volume ratio of 1:100. 2 O dilution for subsequent enzyme digestion and ligation.

[0041] 3. Construction of Lenti-CRISPRv2-sgRNA Lentivirus Knockout Plasmid

[0042] According to the instructions of Esp3I restriction endonuclease, the Lenti-CRISPRv2 lentiviral knockout plasmid was cut to remove sticky ends, and the annealed sgRNA double-stranded oligonucleotide fragment was connected to the cut vector under the action of T4 ligase. The ligation product was transformed, plated, single clones were picked and sequenced to screen Lenti-CRISPRv2-sgPPARγ positive clones.

[0043] 4. Packaging Lenti-CRISPRv2-sgRNA Lentivirus

[0044] HEK-293T cells in good condition were plated into 6-well cell plates and placed in a 5% CO 2 The cells were cultured in a constant temperature incubator at 37°C for 12 hours, and the lentiviral plasmid was transfected when the cell confluence was about 70%. Take two sterile, enzyme-free 1.5mL centrifuge tubes and add 125μL of Opti-MEM medium to each. Add 1.28μg of Lenti-CRISPRv2-sgPPARγ, 1.28μg of psPAX2, and 0.64μg of pMD2.G to one of the centrifuge tubes, and 19.2μL of PEI transfection reagent to the other tube. After mild shaking and mixing, the Opti-MEM medium containing the lentiviral plasmid and auxiliary plasmid was slowly added to the centrifuge tube containing the transfection reagent and allowed to stand at room temperature for 20 minutes (the above 250μL of transfection mixture corresponds to one well of a 6-well plate. If multiple wells need to be transfected, they should be increased proportionally). After incubation, 250μL of the transfection complex was added to the 6-well plate, and then placed at 37°C with 5% CO 2 The cells were incubated in a cell culture incubator for 48 h. The supernatant culture fluid was collected and filtered through a 0.22 μM filter membrane for direct infection or stored at -80 °C for later use.

[0045] 5. Lenti-CRISPRv2-sgRNA lentivirus infection and screening of gene knockout cells

[0046] Lentivirus infection: MARC-145 cells in good condition were evenly plated in a 6-well plate and placed in a 37°C incubator with 5% CO 2 The cells were placed in a cell culture incubator for 12 hours, followed by lentivirus infection. The cell culture medium was discarded, 1 mL of packaged lentivirus was added to each well, and 1 mL of normal culture medium was added to each well after 4 hours, and the cells were placed in a 37°C incubator containing 5% CO. 2 The cells were placed in a cell culture incubator for 24 h, and a normal cell control not infected with lentivirus was set up at the same time.

[0047] Screening knockout cells: After the cell confluence reaches 90%, discard the culture medium, subculture the cells infected / not infected with the lentivirus, add puromycin to a final concentration of 2.5μg / mL, and continue to culture until all normal cells not infected with the lentivirus die, while some cells infected with the lentivirus survive. The surviving cells are expanded and cultured, and a certain amount of cell samples are collected to identify the gene knockout effect of PPARγ by Western blot.

[0048] 6. Western blot to identify the effect of PPARγ gene knockout

[0049] Cell lysis: Add 150 μL of high-efficiency RIPA tissue / cell rapid lysis buffer (containing protease inhibitors, 1:100) to the collected cell samples, repeatedly blow and beat to dissolve the cells, and place them in an ice box for 20 to 30 minutes. Take them out every 10 minutes and flick them to mix. After lysis is completed, centrifuge at 12000r / min in a 4℃ centrifuge for 10 minutes, and transfer the supernatant to a new 1.5mL sterile enzyme-free centrifuge tube;

[0050] Cooking samples: After preparing 5×SDS Loading Buffer, add a certain amount to the cell lysis supernatant according to the proportion, mix thoroughly, cook the sample in a water bath for 10 minutes, and take it out to run SDS-PAGE electrophoresis;

[0051] SDS-PAGE electrophoresis: Prepare SDS-PAGE gel according to the requirements, with the upper and lower layers being 5% concentrated gel and 12% separation gel respectively. After the gel solidifies, assemble the gel rack, spot samples in order, first run the stacking gel at 100V and then adjust to 200V to continue;

[0052] Transfer: After SDS-PAGE electrophoresis, take out the gel and put it into the transfer solution. Immerse the cut PVDF membrane in methanol for 15 seconds to fully activate it. Place the clips, sponges, filter paper, gel, PVDF membrane, filter paper, sponges, and clips in a sandwich shape, and remove all bubbles between the membrane and gel to ensure the transfer effect. Transfer the membrane at a constant voltage of 100V for 60 to 100 minutes according to the size of the protein to be tested;

[0053] Blocking: After the transfer is completed, pick up the PVDF membrane and quickly place it into the prepared 5% skim milk powder blocking solution with the front side facing up, and block it at room temperature for 2 hours;

[0054] Incubate with primary antibody: dilute the required primary antibody PRRSV-N protein monoclonal antibody (1:2000), PPARγ polyclonal antibody (1:500), and tubulin monoclonal antibody (1:2000) with 5% skim milk powder. Transfer the PVDF membrane to the primary antibody incubation solution and rotate in an incubator at 4°C overnight;

[0055] Washing the membrane: Take out the PVDF membrane incubated with primary antibody, wash the membrane with 1×PBST on a shaker, 5 times for 5 minutes each time;

[0056] Incubate the secondary antibody: Use 5% skim milk powder to dilute the Goat@Mouse IgG or Goat@Rabbit IgG corresponding to the primary antibody species, and the dilution ratio is 1:2500. Place the washed PVDF membrane in the secondary antibody incubation solution and place it in an incubator and rotate at room temperature for 1 hour;

[0057] Washing the membrane: Take out the PVDF membrane incubated with the secondary antibody, and wash the membrane with 1×PBST on a shaker for 5 minutes each time, for a total of 5 times;

[0058] Color development: Immerse the washed PVDF membrane in ECL luminescent color development solution, incubate it at room temperature for 1 min, then take it out and use Bio-Rad gel imager to develop color, take pictures, and analyze the knockout effect of PPARγ;

[0059] The results are as follows Figure 2 As shown, no PPARγ protein expression was detected in the constructed PPARγ knockout cells, indicating that the cell line was successfully constructed.

[0060] Example 2 Effect of PPARγ gene knockout MARC-145 cells on the replication of highly pathogenic PRRSV GD-HD 1. Cell inoculation

[0061] MARC-145 normal cells in good condition and MARC-145 cells with PPARγ knockout were plated into 12-well cell plates and placed in a 5% CO 2 The cells were cultured in a constant temperature incubator at 37°C for 12 hours and inoculated with virus when the cell confluence was about 50%. According to the formula PFU = number of cells × MOI = 0.7 × TCID 50 Calculate the required virus solution. Take out the 12-well plate, wash it with PBS, add PRRSV GD-HD virus dilution solution, and culture at 37℃.

[0062] 2. Collect samples

[0063] Cell samples and cell culture supernatant were collected 36h and 48h after infection and stored at -80°C. Cell samples were used to detect the expression level of PRRSV-N protein in cells, and cell culture supernatant was used to detect the titer of virus released into the culture supernatant.

[0064] 3. Western blot detection to determine the expression level of PRRSV-N protein in cell samples

[0065] The cell sample lysis, electrophoresis, membrane transfer, antibody incubation and color development were the same as in Example 1.

[0066] The results are as follows Figure 3 As shown, compared with the normal cell control group, the expression level of PRRSV-N protein in MARC-145 cells with PPARγ knockout was significantly increased after infection with HP-PRRSV GD-HD strain, indicating that knocking out the PPARγ gene can significantly promote the replication of PRRSV.

[0067] 4.TCID 50 Determination of PRRSV titer in supernatant samples

[0068] Plating: Take MARC-145 normal cells in good condition and MARC-145 cells with PPARγ knockout, and plate them at 1×10 5 The cells were plated in a 96-well plate at a density of 100 μL per well and placed in a 37°C incubator with 5% CO 2 in a cell culture incubator for 12 h;

[0069] Virus dilution: The collected samples were diluted 10-fold in DMEM medium containing 3% FBS, starting from 10 -1 -10 -10 Three identical samples were diluted for each sample for biological replicates;

[0070] Inoculation: Discard the old culture medium in the 96-well plate, add 100 μL of the gradient diluted virus solution to each well of the cell plate, and place it at 37°C with 5% CO 2 The cells were continuously cultured in a cell culture incubator;

[0071] Observe and record CPE: Observe continuously for 5 to 7 days and record the lesions in each well;

[0072] TCID 50 Calculation: TCID of each test sample according to Karber method 50 Perform calculations.

[0073] The results are as follows Figure 4 As shown, compared with the normal cell control group, the viral titer in the cell culture supernatant of MARC-145 cells with PPARγ knockout infected with HP-PRRSV GD-HD strain was increased by 1-log and 0.6-log at 36hpi and 48hpi, respectively (P<0.05).

[0074] The above results indicate that knocking out the PPARγ gene can significantly promote the replication of the highly pathogenic PRRSV GD-HD strain in MARC-145 cells, and the cell line constructed by inhibiting / interfering / silencing / knocking out the PPARγ gene in the host cells can be used as a PRRSV or PRRSV vaccine production cell line to promote the production of PRRSV or PRRSV vaccine; secondly, the PPARγ gene can be used as a target for screening drugs for preventing or treating PRRS, for developing drugs for preventing and treating PRRSV and for research on PRRSV-resistant transgenic pigs, and has broad application prospects.

[0075] In this specification, each embodiment is described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the embodiments can be referred to each other. For the device disclosed in the embodiment, since it corresponds to the method disclosed in the embodiment, the description is relatively simple, and the relevant parts can be referred to the method part.

[0076] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of PPARγ gene knockout or deletion cell lines as cell lines for the production of porcine reproductive and respiratory syndrome virus or virus vaccines.

2. Application of reagents that inhibit, silence or interfere with PPARγ gene expression in the preparation of porcine reproductive and respiratory syndrome virus or virus vaccine production cell lines.

3. The use according to claim 2, characterized in that The agent for inhibiting, silencing or interfering with the expression of the PPARγ gene is a sgRNA that specifically targets the PPARγ gene, and the sequence of the sgRNA is as follows: Sense strand: CACCGGGCTGCCAGTTTCGCTCCG; Antisense strand: AAACCGGAGCGAAACTGGCAGCCC.

4. The use according to claim 3, characterized in that The production cell line is constructed by using the CRISPR / Cas9 system and the sgRNA to knock out the PPARγ gene in the host cell.

5. The use according to claim 4, characterized in that The method for constructing the production cell line comprises the following steps: (1) Preparation of sgRNA specifically targeting the PPARγ gene; (2) annealing the sgRNA prepared in step (1) and connecting it to a lentiviral knockout plasmid to obtain a lentiviral knockout plasmid that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence; (3) The lentiviral knockout plasmid prepared in step (2) was transfected into MARC-145 cells, and the PPARγ gene knockout / deficient MARC-145 cell line was obtained by puromycin antibiotic selection and cell limiting dilution method.

Images