A PCR device with controllable amplification speed and its construction method and use
By constructing a PCR device with controllable amplification rate and adjusting the protein concentration in the hydrogel to control the DNA polymerase release rate, the sensitivity and accuracy issues in PCR were solved, enabling precise detection on ordinary PCR instruments and improving the sensitivity of fluorescent PCR.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GUANGXI MEDICAL UNIVERSITY
- Filing Date
- 2022-08-09
- Publication Date
- 2026-05-15
AI Technical Summary
In conventional PCR, the DNA product does not increase after exponential amplification, resulting in poor specificity and sensitivity in inferring the initial DNA concentration from the final product. In real-time quantitative PCR, high fluorescence background, inhibitor content, and low and variability of target sequences limit sensitivity and accuracy.
By constructing a PCR device with controllable amplification rate, adjusting the protein concentration in the hydrogel to control the release rate of DNA polymerase, maintaining linear amplification, and combining it with fluorescent PCR to monitor the amplification rate to calibrate the cycle threshold and reduce the influence of inhibitors.
It improves the specificity, sensitivity, and accuracy of initial DNA concentration detection, reduces costs, enables precise semi-quantitative analysis of gene expression differences on ordinary PCR instruments, and enhances the detection sensitivity and accuracy of fluorescent PCR.
Smart Images

Figure CN116287154B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of nucleic acid amplification and nucleic acid detection technology, specifically relating to a PCR device with controllable amplification rate and its application in achieving more accurate detection and analysis of initial DNA template concentration. Background Technology
[0002] Polymerase chain reaction (PCR) is one of the greatest inventions of the 20th century and has been widely applied in the fields of medicine and biology. Due to its high sensitivity, specificity, and speed, PCR has always been one of the most important methods for confirming positive cases. The development of modern molecular biology techniques, such as DNA sequencing and molecular cloning, is inseparable from PCR. In other words, the advancement of polymerase chain reaction (PCR) has revolutionized molecular biology techniques.
[0003] In 1985, KB Mullis described the principle and initial concept of PCR technology: simulating DNA replication within cells in a test tube, synthesizing short-length, specific sequences of single-stranded DNA (oligonucleotides), mixing DNA templates, primers, dNTPs, and polymerase in a suitable buffer solution, and cycling through denaturation, annealing, and extension temperatures to continuously synthesize new complementary DNA strands. As we know, after specific amplification of high-copy-number DNA sequences, the most crucial step is their detection and analysis. To achieve absolute quantification, PCR technology has evolved through three stages: conventional PCR, real-time quantitative PCR (RT-PCR), and digital PCR (dPCR). First-generation conventional PCR uses agarose gel electrophoresis to analyze its final products, but it is only suitable for qualitative and semi-quantitative analysis. Its disadvantages include poor sensitivity and reproducibility. After exponential amplification, the DNA product no longer increases, i.e., the plateau phase, so the initial DNA content cannot be inferred from the final product. To monitor the entire reaction process in real time, fluorescent dyes are added to the PCR reaction system; this is commonly known as second-generation PCR, or real-time quantitative PCR. After a certain number of cycles, the fluorescence signal reaches a threshold; the number of cycles at this point is called the cycle threshold (CT). Based on the linear relationship between the cycle threshold and the CT value, the initial DNA content can be quantitatively analyzed. However, in PCR reaction systems, high fluorescence background, inhibitor content, and low or slightly different target sequence content limit sensitivity and accuracy. Currently, PCR has evolved to third-generation digital PCR (dPCR), a highly sensitive, absolutely quantitative nucleic acid analysis technique. A DNA sample is divided into dozens to tens of thousands of cells, allocated to different PCR reaction chambers. Each chamber, containing only one or no DNA molecule, can perform a PCR reaction independently. The initial amount of DNA is calculated using statistical analysis based on the Poisson distribution. This is an absolutely quantitative method that does not require endogenous controls, reference samples, or the generation of a standard curve. However, dPCR has typical disadvantages such as high cost, limited throughput, and complex operation.
[0004] The development of rapid, simple, economical, and highly sensitive PCR techniques has never ceased, and many specialized types of PCR have been developed, such as reverse transcription PCR, nested PCR, multiplex PCR, and asymmetric PCR, to meet specific needs. In molecular biology laboratories, conventional PCR and real-time qPCR are the most commonly used methods for identifying genes and their differential expression. Therefore, improving two generations of PCR techniques is highly meaningful, for example, by increasing sensitivity and accuracy. Summary of the Invention
[0005] The technical problem solved: In conventional PCR, after exponential amplification, the DNA product no longer increases, resulting in poor specificity and sensitivity inferring the initial DNA concentration from the final product. The PCR device with controllable amplification rate of this invention can extend the DNA amplification cycle and maintain linear amplification within a certain range, thereby improving the specificity and sensitivity of the initial DNA concentration. Furthermore, in real-time quantitative fluorescence PCR reaction systems, high fluorescence background, inhibitor content, and low or slightly different target sequence content limit sensitivity and accuracy. The PCR device with controllable amplification rate of this invention maintains linear amplification within a certain range, allowing for reaction rate detection and calibration of the cycle threshold (CT), leading to more accurate quantitative detection of the initial DNA concentration. Thirdly, the preparation of a hydrogel for transferring DNA polymerase better protects the enzyme from inhibitors, such as fluorescent substances, thereby increasing the content of fluorescent substances and enhancing detection sensitivity.
[0006] Technical solution: A method for constructing a PCR device with controllable amplification rate, comprising the following steps: First, preparing animal serum albumin or collagen at different concentrations, then adding DNA polymerase, template, primers, magnesium ions, PCR reaction buffer and deionized water, wherein the concentration of animal serum albumin in the final solution is 2.5 mg / mL to 50 mg / mL; then, heating at high temperature to form a gel to prepare a PCR device with controllable amplification rate.
[0007] The specific procedure is as follows: Prepare a 20% (w / w) gel-forming solution; prepare a 10×PCR buffer: 100 mM 25℃ pH 8.8 Tris-HCl, 500 mM KCl, 0.8% (v / v) Nonidet P40; MgCl2: 15 mM; DNA polymerase: Taq DNA polymerase or hot-start Taq DNA polymerase, dNTP: 2.5 mM, upstream primer: 10 mM, downstream primer: 10 mM, DNA template: cDNA; add 0.5-2 μL of gel-forming solution, 2 μL of 10×PCR buffer, 2 μL of MgCl2, 0.1 μL of DNA polymerase, 2.5 mM of dNTP, 0.1-0.5 μL of 10 mM upstream primer, 0.1-0.5 μL of 10 mM downstream primer, and 5 μL of cDNA template, and then add deionized water to a final volume of 20 μL. The accumulated liquid was placed in a PCR instrument and heated at 95°C for 5 min; the amplification rate was controlled by adjusting the concentration of the gel solution, or by adjusting the concentration of the template and primers.
[0008] The gelling solution described above is animal serum albumin or collagen protein.
[0009] The above-described method yields a PCR device with controllable amplification rate.
[0010] The above-mentioned device is used in the detection and analysis of initial DNA template concentration.
[0011] The above-mentioned device is used in PCR with controllable amplification rate.
[0012] Beneficial Effects: This invention is applicable to both conventional PCR and real-time quantitative PCR without altering existing equipment. PCR technology is widely used in molecular biology laboratories. Even in laboratories without fluorescent PCR equipment, conventional PCR instruments can be used for precise semi-quantitative analysis of gene expression differences, revealing gene expression differences currently undetectable by conventional PCR. Conventional PCR increases the sensitivity of gene expression difference detection, significantly reducing costs and enabling more affordable PCR detection of gene expression differences. This invention utilizes real-time quantitative PCR, monitoring amplification speed and ultimately calibrating the CT value to improve detection accuracy. Attached Figure Description
[0013] Figure 1 (A) Amplification curves of PCR with controllable amplification rate, and (B) amplification curves of PCR with controllable amplification rate after 20, 35 and 65 cycles; the PCR reaction process can be seen in Example 1.
[0014] Figure 2 The amplification curves for fluorescent PCR are shown, and the linear fitting scale is obtained after different cycles of R1. 2 The value indicates that the amplification rate controllable PCR has a better linear relationship, indicating that it is linear amplification within this range. This is because the amplification rate is regulated by controlling the release of enzymes; this is based on the data analysis in Example 1.
[0015] Figure 3 To further verify the theoretical basis of controllable amplification rate PCR, (A) it is assumed that the enzyme activity decreases from the beginning of PCR, and its amplification curve shifts significantly to the right, but only slightly to the right in controllable amplification rate PCR; (B) the relationship between CT value and amplification efficiency in fluorescent PCR; (C) the relationship between CT value and amplification efficiency in controllable amplification rate PCR; this indicates that controllable amplification rate PCR can control the PCR amplification rate in the later stage by regulating the release of enzymes; data analysis of Example 1.
[0016] Figure 4 The results are shown in Example 2. (A) Amplification curves of the remaining enzyme in the gel after PCR and (B) Amplification curves of the DNA polymerase released from the gel after PCR. This fully demonstrates that DNA polymerase is continuously released during the PCR cycle.
[0017] Figure 5DNA templates with different copy numbers were subjected to conventional PCR and controlled-rate PCR (VC-PCR) respectively. The endpoint was detected by gel electrophoresis for semi-quantitative analysis of the final product. The results showed that VC-PCR had high sensitivity. This is the result presentation and data analysis in Example 3.
[0018] Figure 6 (A) According to the Michaelis-Menten equation, the rate equation for the relationship between the initial rate and substrate concentration in an enzymatic reaction is that the initial rate is mainly determined by the DNA template concentration, while the later rate is mainly determined by the primer concentration; (B) The change in amplification rate in different cycle periods; (C) After adding primers of different concentrations, the PCR amplification curves show that the amplification rate in the later stage decreases as the primer concentration decreases, which is the principle analysis of how the amplification rate is changed after changing the primer concentration in Example 4.
[0019] Figure 7 (A) The relationship between amplification rates of DNA templates and primers at different concentrations; (B) The direct relationship between CT value and amplification rate; (C) R obtained by linear fitting of CT value and DNA template concentration after calibration. 2 The values were calculated and statistically analyzed (P < 0.05); this served as the analysis and validation for improving the sensitivity of fluorescent PCR in Example 4. Detailed Implementation
[0020] The following embodiments are provided to enable those skilled in the art to more fully understand the present invention, but do not limit the invention in any way.
[0021] Example 1: Investigation on the regulation of PCR amplification rate by different concentrations of hydrogels
[0022] The release rate of DNA polymerase was regulated by adjusting the concentration of proteins (mainly animal serum albumin, bovine serum albumin, biotechnology grade, Shanghai Aladdin Biochemical Technology Co., Ltd.) in the hydrogel and changing the hydrogel stiffness. Protein concentrations were set to 0, 2.5, 5, 10, 20, 30, 40, and 50 mg / mL, and PCR amplification products were detected using two different methods. Figure 1 To avoid genetic contamination from humans and common microorganisms and to truly explore the sensitivity of the detection, a gene fragment that does not overlap with human or microbial genes was designed as a template, and two primers for it were designed.
[0023] template:
[0024] TTGTGGCCATTAACGTCACCATCCAGTTCCACCAGGATCGGAACAACACCGGTAAACAATTCCTCTCCCTTGCTAACCATGCCGGAACCAGAA
[0025] Primer 1: TTTTGGCCATTAACGTCACC; Primer 2: TTTTGGTTCCGGCATGGTTA
[0026] 1) PCR endpoint products were detected by gel electrophoresis after 20, 35, and 65 cycles. The PCR apparatus with controllable amplification rate consisted of: gel forming solution: X μL (0.5 ≤ X ≤ 5), 10× PCR buffer: 2 μL, MgCl2: 2 μL, DNA polymerase: 0.1 μL, and approximately 10 μL of PCR buffer. 5 Copy / μL template DNA (or cDNA): 5μL, upstream primer: 0.5μL, downstream primer: 0.5μL, dNTP: 2μL, add deionized water to make up to 20μL of liquid and heat in a PCR instrument at 95℃ for 5 min.
[0027] Amplification in a PCR instrument:
[0028] First step pre-denaturation: 95℃ for 10 min
[0029] Second step denaturation: 95℃ for 15 seconds
[0030] Third step: Annealing / Extension: 60℃ for 60 seconds
[0031] The second and third steps are repeated 20, 35, and 65 times respectively.
[0032] After PCR, 5 μL of PCR product was mixed with 1 μL of 6×DNA loading buffer and electrophoresed at 120 V for 15 min. The band brightness of the PCR product was then analyzed using a gel imaging system.
[0033] The amplification products were dynamically monitored using fluorescent PCR. In step 1), SYBR Green dye was added to the controllable amplification rate PCR device, and the device was placed in a fluorescent PCR instrument for amplification. The amplification period was 65 minutes. The analysis results are as follows: Figure 1 , Figure 2 and Figure 3
[0034] Example 2: Controllable Amplification Rate PCR regulates the amplification rate by continuously releasing DNA polymerase during the amplification process.
[0035] Four PCR reaction systems with controllable amplification rate were prepared according to the method in Example 1, where X=2 and no template was added. Amplification was performed for 5, 15, 25, and 35 cycles, respectively, followed by centrifugation at 6000 rpm to separate the released DNA polymerase. At this point, the four systems were divided into PCR systems containing released DNA polymerase and PCR systems without released DNA polymerase, for a total of eight PCR reaction systems. Equal amounts of template were added to each of the eight PCR reaction systems, and amplification was continued for 40 cycles. The results are as follows: Figure 4The results showed that DNA polymerase was released from the gel during the amplification process.
[0036] Example 3: Detection and Sensitivity Analysis of Differential Gene Expression in Controlled-Rate PCR
[0037] Prepare and dilute the DNA template described above to a 10:1 ratio. 8 Up to 10 1 Copy / μL, add 1μL to each reaction system. Perform controlled-rate PCR as described in Example 1, simultaneously using a conventional PCR instrument and a fluorescence PCR instrument. After conventional PCR, perform semi-quantitative analysis of the final product concentration by agarose gel electrophoresis, and analyze the amplification curve by fluorescence PCR.
[0038] Simultaneously, control PCR and fluorescent PCR were designed, and the results are as follows: Figure 5
[0039] Example 4: Application of Controllable Amplification Rate PCR Combined with Fluorescent PCR Instrument
[0040] To verify the effect of primer concentration on PCR amplification rate, a rate-controlled PCR was designed with different primer concentrations, such as 250 nM, 125 nM, and 62.5 nM. The rate-controlled PCR was performed using the same method as in Example 1, conducted in a fluorescence PCR instrument. The amplification rate was represented by the slope on the amplification curve, and the relationship between the slope and the CT value was determined. Solutions were prepared by serially diluting DNA templates of different concentrations, and a linear fit was performed between the CT value and the DNA template concentration to obtain the Rt value. 2 Value. A control PCR method using conventional fluorescent PCR was also designed. Statistical analysis was performed to compare the R values of the two methods. 2 The difference in values reflects its sensitivity. Data is presented as follows: Figure 6 and Figure 7 .
Claims
1. A method for constructing a PCR device with controllable amplification rate, characterized in that, The construction steps are as follows: First, prepare bovine serum albumin at different concentrations, then add DNA polymerase, template, primers, magnesium ions, PCR reaction buffer, and deionized water. The final solution contains bovine serum albumin at concentrations ranging from 2.5 mg / mL to 50 mg / mL. Next, heat the gel at high temperature to prepare a PCR device with controllable amplification rate. The gel is configured to control the release rate of DNA polymerase during PCR thermal cycling, thereby regulating the amplification rate of the PCR reaction. A 20% (w / w) gel solution is prepared. Prepare 10×PCR buffer: 100 mM Tris-HCl, 25℃, pH 8.8, 500 mM KCl, 0.8% (v / v) Nonidet P40; MgCl2: 15 mM; DNA polymerase: Taq DNA polymerase or hot-start Taq DNA polymerase, dNTP: 2.5 mM, upstream primer: 10 mM, downstream primer: 10 mM, DNA template: cDNA; Prepare the following mixture: gelation solution: 0.5-2 μL, 10×PCR buffer: 2 μL, MgCl2: 2 μL, DNA polymerase: 0.1 μL, dNTP: 2.5 mM, upstream primer 10 mM: 0.1-0.5 μL, downstream primer 10 mM: 0.1-0.5 μL, DNA template: cDNA 5 μL; add deionized water to a volume of 20 μL. Place the mixture in a PCR instrument and heat at 95℃ for 5 minutes. The amplification rate can be controlled by adjusting the concentration of the gel solution, or by adjusting the concentration of the template and primers.
2. The PCR device with controllable amplification rate obtained by the construction method of claim 1.
3. The application of the apparatus of claim 2 in detecting and analyzing the initial DNA template concentration.
4. The application of the device according to claim 2 in PCR with controllable amplification rate.