Peanut U6 Promoter and Its Application in Peanut CRISPR-Cas9 Gene Editing

Abstract

The present invention discloses a peanut U6 promoter and its application in peanut CRISPR-Cas9 gene editing, belonging to the technical field of molecular biology. The peanut U6 promoters of the present invention are AhA3U6 or AhB9U6, and the nucleic acid sequences are shown in SEQ ID NO:1 and SEQ ID NO:2 respectively. By replacing the GmU6 promoter in the pBGK041-GmU6 vector with the promoters AhA3U6 and AhB9U6 and performing gene editing on the peanut PEPC1 gene, the results show that the editing efficiency of the gene editing vector containing the peanut U6 promoter is significantly higher than that of the GmU6 promoter, and AhA3U6 is superior to AhB9U6. Therefore, using the AhA3U6 promoter lays a foundation for further improving the editing efficiency of peanuts and constructing an efficient peanut gene editing system.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a peanut U6 promoter and its application in peanut CRISPR-Cas9 gene editing. Background Art

[0002] The CRISPR / Cas9 editing system is currently the most widely used gene editing tool. Using this system, site-directed editing of target genes can be achieved, thereby changing related phenotypic traits. Using this technology, efficient and precise single-base site-directed mutations have been achieved in the three major crops of rice, wheat, and corn, and corresponding phenotypic traits such as the resistance of rice to bacterial blight have been significantly improved. Using this technology, an effective editing vector needs to be constructed first. The vector contains sgRNA (guide RNA) designed according to the target gene sequence and the Cas9 protein coding sequence. The Cas9 protein can achieve precise modification of the target gene under the guidance of sgRNA. Therefore, the transcription level of sgRNA (guide RNA) and the translation level of Cas9 protein directly affect the editing efficiency of the target gene.

[0003] Currently, for editing vectors of monocotyledonous plants, promoters such as OsU3, AtU6, and ZmU6 are mainly used to drive the transcription of sgRNA, while for dicotyledonous plants, promoters such as AtU3 and GmU6 are mainly used to drive the transcription of sgRNA. Transferring current editing vectors containing common promoters such as OsU3 and GmU6 into other heterologous recipient plants, the transcription level of sgRNA driven by the foreign promoter in the recipient species may be inhibited to a certain extent, and further affect the editing efficiency of the target gene. Therefore, for a specific recipient species, selecting a high-efficiency promoter and designing an editing vector containing this promoter are effective means to improve the editing efficiency of the recipient species. Summary of the Invention

[0004] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide a peanut U6 promoter and its application in peanut CRISPR-Cas9 gene editing.

[0005] A peanut U6 promoter, the peanut U6 promoter is AhA3U6 or AhB9U6, the nucleic acid sequence of the promoter AhA3U6 is shown in SEQ ID NO:1, and the nucleic acid sequence of the promoter AhB9U6 is shown in SEQ ID NO:2.

[0006] Application of the promoter AhA3U6 with the nucleic acid sequence shown in SEQ ID NO:1 or the promoter AhB9U6 with the nucleic acid sequence shown in SEQ ID NO:2 in improving the peanut CRISPR-Cas9 gene editing efficiency.

[0007] A peanut CRISPR-Cas9 gene editing vector, wherein the promoter in the peanut CRISPR-Cas9 gene editing vector is AhA3U6 or AhB9U6, the nucleic acid sequence of the promoter AhA3U6 is shown in SEQ ID NO:1, and the nucleic acid sequence of the promoter AhB9U6 is shown in SEQ ID NO:2.

[0008] In a specific embodiment, the peanut CRISPR-Cas9 gene editing vector is obtained by replacing the GmU6 promoter in the pBGK041-GmU6 vector with AhA3U6 or AhB9U6.

[0009] The application of the above peanut CRISPR-Cas9 gene editing vector in peanut gene editing.

[0010] A method for peanut CRISPR-Cas9 gene editing, the steps are as follows:

[0011] Construct the nucleic acid sequence of the target gene target site into the above peanut CRISPR-Cas9 gene editing vector to obtain a CRISPR-Cas9 gene editing recombinant plasmid; transform the CRISPR-Cas9 gene editing recombinant plasmid into Agrobacterium to prepare an infection solution, infect peanuts, and screen for positive transformants to achieve CRISPR-Cas9 gene editing of the peanut target gene.

[0012] In a specific embodiment, the method for Agrobacterium to infect peanuts is the hairy root Agrobacterium transformation method or the pollen tube pathway transformation method.

[0013] In a specific embodiment, the Agrobacterium used in the hairy root Agrobacterium transformation method is Agrobacterium rhizogenes, and the Agrobacterium used in the pollen tube pathway transformation method is Agrobacterium tumefaciens.

[0014] A method for editing the peanut PEPC1 gene, design the target site sequence of the peanut PEPC1 gene, construct the nucleic acid sequence of the target site into the peanut CRISPR-Cas9 gene editing vector described in claim 3 or 4 to obtain a CRISPR-Cas9 gene editing recombinant plasmid; transform the CRISPR-Cas9 gene editing recombinant plasmid into Agrobacterium to prepare an infection solution, infect peanuts, and screen for positive transformants to achieve CRISPR-Cas9 gene editing of the peanut target gene.

[0015] In a specific embodiment, the target site sequence of the peanut PEPC1 gene is a base sequence shared by Aradu.A52DW and Araip.RUX3H gene sequences; wherein, the nucleic acid sequence of the Aradu.A52DW gene is as shown in SEQ ID NO:7, and the nucleic acid sequence of the Araip.RUX3H gene is as shown in SEQ ID NO:8.

[0016] A method for quickly verifying the gene editing efficiency of peanut CRISPR-Cas9 is as follows:

[0017] Construct the nucleic acid sequence of the target site into the peanut CRISPR-Cas9 gene editing vector to obtain the peanut CRISPR-Cas9 gene editing recombinant plasmid. Transform the recombinant plasmid into Agrobacterium rhizogenes, and infect peanut seedlings with the hypocotyls and roots removed by the Agrobacterium rhizogenes transformation method. After the infection is completed, culture the peanut seedlings in an aqueous solution with a Basta concentration of 0.75 mg / L to grow new roots; cut the newly grown roots to extract DNA for screening of transgenic positives and detection of gene editing efficiency; induce callus from the peanut seedlings with the roots cut off and then culture them in an aqueous solution with a Basta concentration of 4.5 mg / L for root regeneration.

[0018] Advantages of the technical solution of the present invention

[0019] In the present invention, two peanut endogenous U6 promoters, AhA3U6 and AhB9U6, are cloned. The peanut U6 promoter is used to replace the GmU6 promoter in the original vector to construct an editing vector containing sgRNA driven by the peanut endogenous promoter. The CRISPR-Cas9 gene editing vector containing the peanut U6 promoters AhA3U6 and AhB9U6 is used to edit the peanut PEPC1 gene. The results show that the gene editing efficiency using the CRISPR-Cas9 gene editing vector containing the peanut U6 promoter is significantly higher than that of the GmU6 promoter, and AhA3U6 is better than AhB9U6. Therefore, using the AhA3U6 promoter lays a foundation for further improving the editing efficiency of peanuts and then constructing an efficient peanut gene editing system. Description of the drawings

[0020] Figure 1 CRISPR-Cas9 vector map and basic process of recombinant vector construction;

[0021] Figure 2Identification of the CRISPR-Cas9 recombinant vector (where M: DL2000 marker; 1: H2O; 2: pBGK041-GmU6-AhPEPC1; 3: pBGK041-AhA3U6-AhPEPC1; 4: pBGK041-AhB9U6-AhPEPC1);

[0022] Figure 3 Determination of the Basta screening pressure for peanut hairy roots;

[0023] Figure 4 Genetic transformation steps of peanut hairy roots (where A: young seedlings of peanut seeds hydroponically cultured for 10 days; B: upper part of the young seedlings with hypocotyls and roots cut off; C: infecting the suspension of Agrobacterium rhizogenes for 10 - 15 minutes; D: dark culture overnight; E: untransformed control plants after culturing in 0.75 mg / L Basta aqueous solution for 10 days; F: transformed plants after culturing in 0.75 mg / L Basta aqueous solution for 10 days; G - H: enlarged view);

[0024] Figure 5 PCR positive electrophoresis pattern of the CRISPR-Cas9 vector transformed into the hairy roots of Huayu 23 (where M: DL2000 marker; 1: pBGK041-AhA3U6-AhPEPC1 plasmid; 2: WT; 3: pBGK041-GmU6-AhPEPC1; 4: pBGK041-AhA3U6-AhPEPC1; 5: pBGK041-AhB9U6-AhPEPC1). Detailed implementation manners

[0025] The terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art, unless otherwise specified.

[0026] The present invention will be further described in detail below with reference to specific examples and data. The following examples are only for illustrating the present invention and do not limit the scope of the present invention in any way.

[0027] In the following examples,

[0028] Huayu 23 is preserved by the Peanut Molecular Breeding Laboratory of Qingdao Agricultural University;

[0029] The linear vector pBGK041-GmU6 is purchased from Baige Biotech Co., Ltd.;

[0030] Agrobacterium rhizogenes Ar.1193 and Agrobacterium tumefaciens (GV3101) are purchased from Weidi Biotech Co., Ltd. (Shanghai);

[0031] Basta (glufosinate-ammonium, PPT) is purchased from Sangon Biotech Co., Ltd. (Shanghai).

[0032] Example 1

[0033] Cloning of Peanut U6 Promoter

[0034] Genomic DNA of Huayu 23 was extracted and used as a PCR template. The peanut U6 promoter was cloned by PCR using specific primers. The PCR products were separated by gel electrophoresis, and the target bands were recovered and purified. After purification, they were ligated into the TaKaRa pMD18-T vector to obtain pMD 18-T Vector-AhA3U6 and pMD 18-T Vector-AhB9U6. Then they were transformed into DH5α, and single colonies were picked for PCR identification. The plasmids of positive clones were extracted. After enzymatic digestion verification, they were sent to Sangon Biotech for sequencing.

[0035] The nucleic acid sequence of the cloned promoter AhA3U6 is shown in SEQ ID NO:1, and the nucleic acid sequence of the promoter AhB9U6 is shown in SEQ ID NO:2.

[0036] SEQ ID NO:1 (5’→3’)

[0037] CCTTGGTGAAATATTATCCATCGTGGACTGGTTTTCCTTGATAGATGATGTTCATATGCTGGCAAGGCTTTGGTTTTTATTTCTTCCAACTTATAAATGAGGTATGATTCAAATGTATCCTTTCTTGGTAGAGCCTTAATAATGGGAAGATCTATTAGAAATATACACATGTTCCCTAGCTACAATGTTCTCTTCTCATTCTTCTAATTCATAGATATGGAGATTGATGTAAAATGATTTCATAAATATTGAAATTATATCAAAATGTTTGATACATTCTGGCTAGCAAATCATCTGCTTCTGAGAGAAAGGTGATGCCTCTGGTTCTCCATTATTTGGTTTCATGAAGGTGATTCCAATTATTTTCAGCTGAGTGGAAGGTAGAACTTGACCCAAAAATGTATGATATCCTCCTTATTTTGTGCTGTGGGTTTCAAAAGAAGCTCTTTTAGAAGTACCACATCGAGTAGTATTACGTCCCTCTGACAGAATATATGGCAGAGGGAGCATAGAAGGCTT

[0038] SEQ ID NO:2 (5’→3’)

[0039] GTCAAAAGTCAAAACGCTTTTAATTTATGACATAATTGCAACAAATTAAACACCTTATAGCATGAGTCAGATTTTGATTGTTTCTGGTGAGACATATTGACAGTGGTGTACATTTGCAAATAATTGATTATTTTATTATGTGAAAAATTTTATATTTGATTATATTTATAGGATAATTTGAAGTTGCTTATGTTGGTTGTTGGAGGACAATTTCTATTAATTATAACCTTTTCATTCTATTTACTAGTTACTAATTTGTCTTGTTCATTCATAAAAAAATGAGAGCAGTAGGAATAATAGAAGGATAACCTGAAATGGCTATGCATGCAACCACCAACAAGGCAGAACCACCGAAATGAACACAGAAACCACACAACTAGTTGTATCCCCTCCTTCATTTTTCATAAAGCGAGGTTGAGAACTTGTTGATATTCTTCAGCTGCTCTCAATGGCAAACAAGTCTCACATCGCCCAAGTTTTGAGAAACCAATAATTTATATATAAGAGGCGAATGCAAAGGCTC

[0040] The nucleic acid sequences of the specific primers used are as follows:

[0041] A3-F: 5′-CCTTGGTGAAATATTATCCA-3′ (SEQ ID NO:3);

[0042] A3-R: 5'-AAGCCTTCTATGCTCCCTC-3' (SEQ ID NO:4);

[0043] B9-F: 5'-GTCAAAAGTCAAAACGCTTT-3' (SEQ ID NO:5);

[0044] B9-R: 5'-GAGCCTTTGCATTCGCCTCT-3' (SEQ ID NO:6).

[0045] Example 2

[0046] Construction of the peanut CRISPR-Cas9 gene editing vector

[0047] The construction of the CRISPR-Cas9 gene editing vectors of Aradu.A52DW and Araip.RUX3H is taken as an example for illustration as follows:

[0048] Input the CDS regions of the Aradu.A52DW and Araip.RUX3H gene sequences into the CRISPR-Cas9 target site design website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / SCORE). Note that the CDS input should be entered into the website separately according to the actual segmentation of the CDS sequence in the gene. Among the given target site sequences, the selected target sites in the experiment should be selected according to the principle that the score is as high as possible (minimum > 0.5), the CG range is 40%-60%, as much as possible in the CDS part, and as close as possible to the 5' upstream. After determining the target site, perform a comparison to ensure that the target site is continuous in the target gene and does not contain this sequence in other homologous genes. Meeting these conditions can be preliminarily selected as the target site. In addition, the target site selected in this embodiment is a base sequence shared by the two target genes.

[0049] Among them, the nucleic acid sequence of the Aradu.A52DW gene is as shown in SEQ ID NO:7, and the nucleic acid sequence of the Araip.RUX3H gene is as shown in SEQ ID NO:8.

[0050] SEQ ID NO:7 (5’→3’)

[0051]

[0052] SEQ ID NO:8 (5’→3’)

[0053]

[0054] The nucleic acid sequence of the target site is as follows:

[0055] sgRNA-p: 5'-CAAATCCTGAAGAATGTCA-3' (SEQ ID NO:9);

[0056] Input the designed target site above into the website of Biogle Biotechnology Co., Ltd. (http: / / biogle.cn / index / excrispr) to generate the Oligo sequence online. As follows:

[0057] sgRNA-F: 5'-GGGTTGCAAATCCTGAAGAATGTCA-3' (SEQ ID NO:10);

[0058] sgRNA-R: 5'-AAACTGACATTCTTCAGGATTTGCA-3′ (SEQ ID NO:11).

[0059] The above sequences were synthesized by Sangon Biotech Co., Ltd.

[0060] Then connect the target site sequence with the linear vector pBGK041-GmU6 (purchased from Biogle Biotechnology Co., Ltd.), as Figure 1 shown, to obtain the peanut CRISPR-Cas9 gene editing vector pBGK041-GmU6-AhPEPC1.

[0061] Example 3

[0062] Construction of the CRISPR-Cas9 gene editing vector containing the peanut U6 promoter, the steps are as follows:

[0063] (1) Replace the promoter in the pBGK041-GmU6-AhPEPC1 vector with the AhA3U6 and AhB9U6 promoters in peanut. Use the restriction enzymes HindⅢ and SmaⅠ to excise the part of the vector containing the target site, sgRNA backbone sequence and GmU6 promoter sequence to obtain a linear vector.

[0064] (2) Design an insert fragment containing the target site and sgRNA backbone sequence. The forward and reverse sequences of this fragment are as follows:

[0065] Forward sequence: 5′-AACGACGGCCAGTGCCAAGCTTGCAAATCCTGAAGAATGTCAGTTTTAGAGCTAGAAATAGCA-3′ (SEQ ID NO:12);

[0066] Reverse sequence: 5′-CCACCATGTTGACCTGCAGGCCCGGGGCCATTTGTCTGCAGAATTG

[0067] -3′ (SEQ ID NO:13);

[0068] Using the Vazyme seamless cloning kit, the above-mentioned inserted fragment was ligated into the linear vector obtained in step (1) to obtain an intermediate vector.

[0069] (3) Design amplification primers for the AhA3U6 promoter and the AhB9U6 promoter. The primer sequences are as follows:

[0070] A3U6-F: 5′-GTAAAACGACGGCCAGTGCCAAGCTTCCTTGGTGAAATATTATC-3′ (SEQ ID NO:14);

[0071] A3U6-R: 5′-TGCTATTTCTAGCTCTAAAACTGACATTCTTCAGGATTTG-3′ (SEQ ID NO:15);

[0072] B9U6-F: 5′-GTAAAACGACGGCCAGTGCCAAGCTTGTCAAAAGTCAAAACGC-3′ (SEQ ID NO:16);

[0073] B9U6-R: 5′-TGCTATTTCTAGCTCTAAAACTGACATTCTTCAGGATTTG-3′ (SEQ ID NO:17);

[0074] Using the pMD 18-T Vector-AhA3U6 and pMD 18-T Vector-AhB9U6 vectors constructed in Example 1 as templates respectively for amplification, the amplification products of the AhA3U6 promoter and the AhB9U6 promoter were obtained.

[0075] (4) The intermediate vector obtained in step (2) was digested with HindⅢ, and then the digested products were respectively ligated with the amplification products of the AhA3U6 promoter and the AhB9U6 promoter in step (3) to construct the CRISPR-Cas9 gene editing vectors pBGK041-AhA3U6-AhPEPC1 and pBGK041-AhB9U6-AhPEPC1 containing the peanut U6 promoter.

[0076] Using the CRISPR-Cas9 gene editing vectors pBGK041-GmU6-AhPEPC1, pBGK041-AhA3U6-AhPEPC1, and pBGK041-AhB9U6-AhPEPC1 constructed in Example 2 and Example 3 respectively as templates, primers were designed according to the sequence differences as shown in SEQ ID NO:18 - SEQ ID NO:23. The reverse primers contain the sequences of the target sites and are used to determine the successful construction of the vectors.

[0077] The primer sequences were designed as follows:

[0078] GmU6-F: 5′-CCAGTGCCAAGCTTTAGTCTTAATC-3′ (SEQ ID NO:18);

[0079] GmU6-R: 5′-CTGACATTCTTCAGGATTTGC-3′ (SEQ ID NO:19);

[0080] A3U6T-F: 5′-CAGTGCCAAGCTTCCTTGGTG-3' (SEQ ID NO:20);

[0081] A3U6T-R: 5'-CTGACATTCTTCAGGATTTGC-3' (SEQ ID NO:21);

[0082] B9U6T-F: 5'-CCAGTGCCAAGCTTGTCAAAAGTC-3' (SEQ ID NO:22);

[0083] B9U6T-R: 5'-CTGACATTCTTCAGGATTTGC-3' (SEQ ID NO:23);

[0084] The amplification results were as Figure 2 shown. The sizes of the PCR fragments GmU6T (565bp), A3U6T (553bp), and B9U6T (558bp) were all consistent with the target fragments, and it could be preliminarily judged that the recombinant vectors were successfully constructed. Then, the PCR products were subjected to Sanger sequencing to confirm that the sequences were exactly the same as the target sequences, indicating the successful construction of the recombinant vectors.

[0085] Example 4

[0086] Application of the CRISPR-Cas9 gene editing vector containing the peanut U6 promoter in peanut gene editing - Agrobacterium rhizogenes transformation method

[0087] In this embodiment, peanut PEPC1 gene editing is used as an example for explanation. In practical applications, it can also be used to edit other genes in peanuts. When editing other genes in peanuts, it is only necessary to replace the target site in the above peanut CRISPR-Cas9 gene editing vector with the target site sequence of the gene to be edited.

[0088] (1) Determination of Basta screening pressure for peanut rooting

[0089] The seeds of Huayu 23 were germinated in a 30℃ water culture box for 1 day, and the sprouted seeds were placed on the plastic plate of the hydroponic box and placed in a 28℃ light culture room for cultivation. They grew into seedlings in about 10 days. Select peanut seedlings with good and consistent growth status, cut off the hypocotyl and roots, and put the upper seedlings in sterilized culture bottles, one seed per bottle. Set different concentrations of Basta solution, set 3 replicates for each group, change the Basta solution every day, and observe that the peanuts do not take root when the Basta concentration reaches a certain value. This concentration is the rooting Basta screening pressure of Huayu 23 hydroponic culture.

[0090] The results are as follows Figure 3 As shown, on the 7th day of cultivation in Basta solution, it was found that when the Basta concentration was 0.75 mg / L, the peanut seedlings did not grow roots ( Figure 3 ), this concentration was recorded as the Basta screening pressure for Huayu 23 rooting hydroponics.

[0091] (2) Transformation of recombinant plasmid into Agrobacterium rhizogenes

[0092] ① Thaw the Ar.1193 Agrobacterium rhizogenes competent cells stored at -80°C and place them in ice.

[0093] ② Add 0.01-1 μg of pBGK041-GmU6-AhPEPC1, pBGK041-AhA3U6-AhPEPC1 and pBGK041-AhB9U6-AhPEPC1 plasmids to every 100 μL competent medium. After adding, vigorously stir the bottom of the tube to mix or pipette to mix. Place on ice for 5 minutes; in liquid nitrogen for 5 minutes; in a 37°C constant temperature water bath for 5 minutes; and on ice for 5 minutes.

[0094] ③ Add 850 μL LB culture medium and culture at 28℃ and 200 rpm for 2 hours.

[0095] ④ Centrifuge at 6000rpm for 2 minutes and remove the supernatant; add 100μL new LB, gently blow to resuspend the bacterial block, and spread it on the LB plate containing Kana antibiotics; culture upside down in a 28℃ incubator for 2-3 days.

[0096] (3) Peanut rooting genetic transformation method

[0097] Preparation of Bacterial Solution:

[0098] ① Visually observe and stop shaking the Agrobacterium rhizogenes bacterial solution transformed with the recombinant plasmid in step (2) when the OD600 value reaches between 0.8 - 1.0.

[0099] ② Add 0.1 mL of AS with a concentration of 100 μmol / mL, 1 mL of 1 mmol / mL MES, and 1 mL of 1 mmol / mL MgCl2 to every 100 mL of LB liquid medium. Then add 10 μL of 10,000×Silwet L - 77 and mix well to obtain the infection suspension.

[0100] ③ Transfer the bacterial solution into a centrifuge tube. Centrifuge at 5500 rpm for 12 minutes and discard the supernatant. Adjust the OD600 value to between 0.8 - 1.0 by adding the corresponding infection suspension prepared in step ② according to the OD600 value measured in the first step, and resuspend the cells to obtain the infection solution.

[0101] Infection Step, as Figure 4 shown:

[0102] ① Soak peanut seeds for three days. Make holes in the foam board, insert the peanut seeds with the embryo facing down into the foam board, and place them in water for floating culture for one week to grow roots ( Figure 4 in A).

[0103] ② Cut off the lower hypocotyl and root from the middle and lower part of the hypocotyl of the peanut with roots ( Figure 4 in B). Infect 15 peanut seedlings in each group, soak the cut in a petri dish filled with the infection solution for 10 - 15 minutes ( Figure 4 in C); at the same time, set up a blank control (infection suspension without adding Agrobacterium rhizogenes).

[0104] ③ Add an appropriate amount of the infection solution to a sterilized culture bottle lined with cotton at the bottom, carefully place the peanut seedlings into the culture bottle with the cut facing down and in contact with the cotton, and co - culture overnight ( Figure 4 in D).

[0105] ④ Place the co - cultured peanut seedlings back on the foam board and culture them in an aqueous solution with a Basta concentration of 0.75 mg / L for about 10 days to grow new roots ( Figure 4 in F).

[0106] (4) Detection of Transgenic Positive Roots

[0107] Take the newly grown roots in step (3) and place them in 2 - mL centrifuge tubes respectively, and extract the root DNA by the CTAB method;

[0108] Design primers according to a specific sequence (779 bp) of the Cas9 gene in the vector, and identify whether it is a positive transgenic root by PCR. The designed sequence is as follows:

[0109] YANG-F: 5′-TGACCCTGACACTGTTTGAG-3′(SEQ ID NO:24);

[0110] YANG-R: 5′-CTTCATCTTCTTCACGACCTC-3′(SEQ ID NO:25);

[0111] The electrophoresis diagram of the positive detection result is as Figure 5 shown. According to the peanut root hair PCR detection results, the positive rates of the pBGK041-GmU6-AhPEPC1 vector, pBGK041-AhA3U6-AhPEPC1 vector, and pBGK041-AhB9U6-AhPEPC1 vector transformed root hairs were 78.4% (58 / 74), 83.5% (71 / 85), and 83.0% (77 / 93), respectively. Thus, it can be seen that the transformation efficiency of peanut root hairs is relatively ideal, which can ensure the number of detection samples for the CRISPR-Cas9 editing efficiency.

[0112] Positive rate of root hairs = (number of positive root hairs / total number of detected root hairs) × 100% / total number of detected root hairs

[0113] (5) Gene editing detection of peanut root hairs

[0114] Perform PCR amplification on the DNA samples of the positive transgenic root hairs. The amplified fragment is the sequence shared by the two genes and containing the target site. The primers used for PCR are as follows:

[0115] Ar-F: 5′-GGAGTGAGTACGGTGTGCGTTGAGTATGATGCTTTGTTGC-3′(SEQ ID NO:26);

[0116] Ar-R: 5′-GAGTTGGATGCTGGATGGGAAACATTGAAGTACTACCATGATAG-3′(SEQ ID NO:27);

[0117] After the PCR reaction is completed, take a small amount of the PCR product for detection.

[0118] Send the correctly detected PCR amplification product to the Hi-TOM platform (China National Rice Research Institute, Hangzhou) for high-throughput sequencing to analyze the editing results.

[0119] The results are shown in Table 1: One A base insertion was detected in the transgenic hairy root DNA sample of the pBGK041-GmU6-AhPEPC1 vector (original vector), and this mutation occurred in Aradu.A52DW. Three mutation sites were found in the transgenic hairy root DNA sample of the pBGK041-AhA3U6-AhPEPC1 vector. Among them, a sequence deletion of three bases CAT occurred in Araip.RUX3H, and the other two mutations were base substitutions, namely, base T was changed to base C, and base A was changed to base C. These two mutations both occurred in the Aradu.A52DW gene. Two mutation sites were detected in the transgenic hairy root DNA sample of the pBGK041-AhB9U6-AhPEPC1 vector, and both occurred in the Araip.RUX3H gene. One of them was a change from base A to base G, and the other was a deletion of two bases AC.

[0120] Table 1 Transformation efficiency and editing of recombinant CRISPR-Cas9 vectors in hairy roots

[0121]

[0122] (6) Determination of the screening pressure for callus

[0123] The regeneration of peanut hairy roots needs to be carried out by means of tissue culture, and transgenic chimeras are likely to occur in tissue culture. The solution is to carry out screening culture. Therefore, determining the screening pressure of peanut callus can provide a certain reference basis for the regeneration of peanut hairy roots. In this example, the screening marker gene of the CRISPR-Cas9 vector used is Bar. Therefore, it is necessary to determine the Basta screening concentration for Huayu 23. Specifically, callus of peanut hairy roots induced from Huayu 23 was obtained, and the obtained callus was placed in MSB5 solid medium containing different Basta concentrations, and its growth state changes were observed. When the callus turned brown and apoptotic, the concentration used at this time was the Basta screening pressure for the callus of Huayu 23 hairy roots.

[0124] The specific steps are as follows:

[0125] (1) Sterilization: The peanut hairy roots were successively placed in 75% alcohol for 20 seconds; placed in 0.1% mercuric chloride for 6 minutes; rinsed with sterile water and then soaked in sterile water for 10 minutes.

[0126] (2) Transfer to a sterile petri dish containing filter paper, hold the peanut hairy roots with sterile forceps, and cut them into uniform small segments with a scalpel.

[0127] (3) Transfer the cut small segments of hairy roots to the MSB5 solid medium for inducing callus, and culture for 4 - 8 weeks to grow callus.

[0128] (4) Then transfer the induced callus to a screening medium containing Basta and culture it until phenotypic differences appear.

[0129] After screening with different Basta concentration gradients, it was found that the callus grew better at low Basta concentrations in the screening medium. On the 7th day of culture, the callus with a Basta concentration of 4.5 mg / L showed browning, and was completely browned and stopped growing on the 31st day. Therefore, the Basta screening pressure for the callus of Huayu 23 was 4.5 mg / L.

[0130] Example 5

[0131] Application of the CRISPR-Cas9 gene editing vector containing the peanut U6 promoter in peanut gene editing - pollen tube pathway transformation method

[0132] (1) Transformation of recombinant plasmid into Agrobacterium tumefaciens

[0133] ① Take out the GV3101 competent cells and place them in an ice box when they are just completely melted.

[0134] ② Add 0.01 - 0.5 μg of pBGK041-GmU6-AhPEPC1, pBGK041-AhA3U6-AhPEPC1, and pBGK041-AhB9U6-AhPEPC1 plasmids to each 100 μL of GV3101 competent cells respectively. After mixing, place them on ice for 5 minutes in sequence; in liquid nitrogen for 5 minutes; in a 37 °C constant temperature water bath for 5 minutes; then let them stand on ice for 5 minutes.

[0135] ③ Add 850 μL of LB culture medium. Culture at 28 °C and 200 rpm for 2 hours.

[0136] ④ Centrifuge at 6000 rpm for 2 minutes and pour off the supernatant. Add 100 μL of new culture medium, gently pipette and mix with a pipette gun, and then spread it on an LB plate containing Kana antibiotic and culture it in an incubator at 28 °C for about 2 days.

[0137] (2) Genetic transformation by pollen tube pathway

[0138] Germinate the peanut kernels to be planted in advance, select the kernels with good and uniform germination status, and plant 4 kernels in each pot. After emergence, remove the two plants with poor growth in each pot. From the initial flowering, remove the flower buds before 8 o'clock every morning and continue to pick flowers for about 10 days. After the full bloom period, injection transformation can be carried out, that is, the pollen tube pathway method. The injection requires the preparation of Agrobacterium liquid in advance, that is, adding an appropriate amount of the liquid to the liquid medium; after shaking the bacteria for about 10 h, detect the OD600 value; when the OD600 is 0.6 - 0.8, 1 mL of the liquid can be aspirated and stored in a 4 °C refrigerator, and the remaining liquid is centrifuged at 5000 rpm and the supernatant is discarded; add the infection suspension to the bacterial cells to obtain the infection liquid, and after sufficient oscillation, infection transformation can be carried out. Complete the infection transformation before 8 o'clock in the morning. The specific method is to suck the bacterial cell suspension with a syringe and inject it into the keel petals of the peanuts, and it needs to be continuously injected for about 10 days. Subsequently, pick flowers for about 10 days, tie ropes to mark the emerging peg, and these marked pods can be directly harvested for subsequent experiments during harvesting.

[0139] (3) Extract the DNA of peanut kernels by the CTAB method, detect the transgenic positive kernels by the PCR method, and determine the transformation efficiency and gene editing of the kernels. The method is the same as that in Example 4.

[0140] The PCR detection results showed that the transformation efficiencies of the kernels corresponding to the pBGK041 - GmU6 - AhPEPC1, pBGK041 - AhA3U6 - AhPEPC1, and pBGK041 - AhB9U6 - AhPEPC1 vectors were 30.0% (65 / 217), 33.7% (93 / 276), and 29.2% (77 / 264), respectively.

[0141] The transgenic positive peanut kernels obtained by transforming three vectors were sequenced respectively, and the results are shown in Table 2. Two mutations occurred in the Aradu.A52DW gene were detected in the transgenic kernels of the pBGK041-AhA3U6-AhPEPC1 vector: one mutation was a frameshift mutation caused by the insertion of a base C at the 135th site of the nucleotide sequence of the first exon, resulting in a stop codon (TGA) at the 53rd codon, which caused premature termination of translation; the other mutation was the substitution of base A with base G at the 143rd site of the nucleotide sequence of the first exon, resulting in the change of amino acid Q (CAG) at the 48th position to amino acid R (CGG). One mutation was detected in the transgenic kernels of the pBGK041-AhB9U6-AhPEPC1 vector, which occurred in the Araip.RUX3H gene. This mutation was a frameshift mutation caused by the deletion of a base A at the 134th site of the nucleotide sequence of the first exon, resulting in a stop codon (TAA) at the 85th codon, which caused premature termination of translation. No editing was detected in the transgenic kernels corresponding to the original vector pBGK041-GmU6-AhPEPC1.

[0142] Table 2 Kernel conversion rate and editing status of recombinant CRISPR-Cas9 vectors

[0143]

[0144] In summary, the peanut CRISPR-Cas9 gene editing vector constructed in the present invention can perform gene editing on peanut target genes through the Agrobacterium rhizogenes transformation method and the pollen tube pathway method. Among them, the pollen tube pathway method can stably inherit and express. However, the experimental period of this peanut transformation method is relatively long and is not suitable for the rapid detection of the editing efficiency of the peanut CRISPR-Cas9 vector. The Agrobacterium rhizogenes genetic transformation method for peanut hydroponics has the characteristics of simple operation, short cycle, low cost, etc., and the transformation efficiency can reach about 80%. This simple and efficient peanut hairy root transformation system will greatly simplify the related research on peanut transgenesis, etc., and at the same time can quickly identify the editing efficiency of the CRISPR-Cas9 vector, providing convenience for optimizing the peanut CRISPR-Cas9 gene editing system. Secondly, the transformation efficiency of Agrobacterium rhizogenes on peanut (81.7%) is significantly higher than that of the pollen tube pathway method mediated by Agrobacterium tumefaciens on peanut (31%). The reason for this difference may be that the Basta screening agent is added in the Agrobacterium rhizogenes transformation method. In addition, in peanuts, the editing efficiency of the CRISPR-Cas9 vector driven by the endogenous promoters AhA3U6 and AhB9U6 is higher than that of the CRISPR-Cas9 vector driven by the GmU6 promoter, and AhA3U6 is superior to AhB9U6. Therefore, using the AhA3U6 promoter lays a foundation for further improving the editing efficiency of peanuts and then constructing an efficient peanut gene editing system.

[0145] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention in any other form. Any person skilled in the art may use the technical content disclosed above to make changes or modifications into equivalent embodiments with equivalent changes. However, any simple modification, equivalent change, and modification made to the above embodiments based on the technical essence of the present invention without departing from the technical solution content of the present invention still belong to the protection scope of the technical solution of the present invention.

Claims

1. A peanut U6 promoter, characterized in that, The peanut U6 promoter is AhA3U6 or AhB9U6. The nucleic acid sequence of the promoter AhA3U6 is shown as SEQ ID NO:1, and the nucleic acid sequence of the promoter AhB9U6 is shown as SEQ ID NO:

2.

2. Use of the promoter AhA3U6 with a nucleic acid sequence as shown in SEQ ID NO:1 or the promoter AhB9U6 with a nucleic acid sequence as shown in SEQ ID NO:2 in improving the gene editing efficiency of peanut CRISPR-Cas9.

3. A peanut CRISPR-Cas9 gene editing vector, characterized in that, The promoter in the peanut CRISPR-Cas9 gene editing vector is AhA3U6 or AhB9U6. The nucleic acid sequence of the promoter AhA3U6 is shown as SEQ ID NO:1, and the nucleic acid sequence of the promoter AhB9U6 is shown as SEQ ID NO:

2.

4. The peanut CRISPR-Cas9 gene editing vector according to claim 3, characterized in that, It is obtained by replacing the GmU6 promoter in the pBGK041-GmU6 vector with AhA3U6 or AhB9U6.

5. Use of the peanut CRISPR-Cas9 gene editing vector according to claim 3 or 4 in peanut gene editing.

6. A method for peanut CRISPR-Cas9 gene editing, characterized in that, The steps are as follows: Construct the nucleic acid sequence of the target gene target site into the peanut CRISPR-Cas9 gene editing vector described in claim 3 or 4 to obtain a CRISPR-Cas9 gene editing recombinant plasmid; transform the CRISPR-Cas9 gene editing recombinant plasmid into Agrobacterium to prepare an infection solution, infect peanuts, and screen for positive transformants to achieve CRISPR-Cas9 gene editing of the peanut target gene.

7. The method for peanut CRISPR-Cas9 gene editing according to claim 6, characterized in that, The method for Agrobacterium to infect peanuts is the hairy root Agrobacterium transformation method or the pollen tube pathway transformation method.

8. The method for peanut CRISPR-Cas9 gene editing according to claim 7, characterized in that, The Agrobacterium used in the hairy root Agrobacterium transformation method is Agrobacterium rhizogenes, and the Agrobacterium used in the pollen tube pathway transformation method is Agrobacterium tumefaciens.

9. A method for editing the peanut PEPC1 gene, characterized in that, Design the target site sequence of the peanut PEPC1 gene, construct the nucleic acid sequence of the target site into the peanut CRISPR-Cas9 gene editing vector described in claim 3 or 4 to obtain a CRISPR-Cas9 gene editing recombinant plasmid; transform the CRISPR-Cas9 gene editing recombinant plasmid into Agrobacterium to prepare an infection solution, infect peanuts, and screen for positive transformants to achieve CRISPR-Cas9 gene editing of the peanut target gene.

10. The method for editing the peanut PEPC1 gene according to claim 9, characterized in that, The target site sequence of the peanut PEPC1 gene is a common base sequence designed according to the Aradu.A52DW and Araip.RUX3H gene sequences; among them, the nucleic acid sequence of the Aradu.A52DW gene is shown as SEQ ID NO:7, and the nucleic acid sequence of the Araip.RUX3H gene is shown as SEQ ID NO:8.

Images