Primer set of KASP molecular markers tightly linked to major QTL of wheat grain weight per ear and its application

Abstract

The invention discloses a primer set of a KASP molecular marker tightly linked to a major effect QTL of wheat single ear grain weight and its application, and relates to the technical field of molecular marker-assisted breeding. The molecular marker is KASP-AX-109431092, and its primer set comprises 3 primers, and its nucleotide sequences are shown in SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 respectively. The molecular marker provided by the invention can assist in the screening of high-ear grain weight wheat in wheat breeding, can save breeding costs, improve breeding efficiency, and is of great significance for high-yield wheat breeding.

Description

Technical Field

[0001] The invention relates to the technical field of molecular marker-assisted breeding, and in particular to a primer set of a KASP molecular marker tightly linked to a major effect QTL of wheat single ear grain weight and an application thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is one of the most important food crops in the world, providing the main food for about one-third of the world's population. Wheat yield is mainly affected by three yield factors, namely grain weight, number of grains per ear and number of ears. There is a trade-off between grain weight and number of grains per ear, and wheat grain weight per ear is the weight of all grains on a single wheat ear, which is determined by grain weight and number of grains per ear, reflecting the balanced constraint of grain weight and number of grains per ear. Breeders believe that grain weight per ear has a more positive effect on wheat yield and is the dominant factor affecting wheat yield per unit area. When other yield factors remain unchanged, increasing grain weight per ear will lead to an increase in yield. Therefore, identifying and introducing favorable alleles of wheat grain weight per ear in wheat breeding projects and conducting in-depth research to clarify its genetic mechanism can lay a genetic foundation for high-yield wheat breeding.

[0003] Traditional breeding methods often produce the desired ideal traits by hybridizing different varieties or strains. The hybridization process also involves the gradual integration of excellent genes from different materials. However, the molecular mechanism of the inheritance of these traits is not very clear, and the identification of phenotypes requires a lot of time and effort, which not only leads to increased breeding costs, but also low breeding efficiency. With the continuous development of molecular sequencing technology, molecular marker-assisted selection provides an effective solution to the defects of traditional breeding methods. It can select target traits in the early generation, shorten the selection process, and provide accurate, stable and convenient results. Single nucleotide polymorphism (SNP) molecular markers are one of the common molecular markers in plants, with the characteristics of large quantity, wide distribution, genetic stability, and easy genotyping. With the advancement of modern sequencing technology, more and more SNP molecular markers have been discovered and used in genetic studies of various agronomic traits of wheat, including the currently commonly used SNP gene chips, such as 9K, 90K, 15K, 660K, 55K, 820K, 35K and 50K SNP gene chips (Sun C, Dong Z, Zhao L, et al. The Wheat 660K SNP array demonstrates great potential for marker-assisted selection in polyploid wheat [J]. Plant Biotechnology Journal, 2020, 18 (6).). These gene chips combine thousands of SNP molecular markers to improve the quality of genetic profiles.

[0004] Competitive allele-specific PCR (Kompetitive Allele-Specific PCR, KASP) technology is based on the specific matching of primer terminal bases to accurately determine the double allele of SNP sites. This is one of the commonly used SNP genotyping methods at home and abroad. This technology is based on two different fluorescent probes, combined with multiple SNP-PCR primers for specific sites. This technology can detect multiple sites at the same time. And compared with traditional methods, the cost is greatly reduced. In addition, KASP technology has low detection error, extremely high stability and accuracy, and has obvious advantages in the detection of large-scale markers. Therefore, for the main effect QTL or gene that controls the single ear grain weight of wheat, the development of KASP molecular markers linked to it and the use of this molecular marker to breed wheat varieties with high ear grain weight are of great significance for laying a theoretical foundation for high-yield wheat breeding and providing molecular marker-assisted breeding methods. Summary of the invention

[0005] The present invention aims to provide a primer set of KASP molecular markers tightly linked to the major effect QTL of wheat single ear grain weight and its application, wherein the primer set of the molecular markers can assist in the screening of high ear grain weight wheat in molecular breeding and improve the breeding efficiency of wheat.

[0006] In order to achieve the above-mentioned object, the present invention provides a primer set of a KASP molecular marker tightly linked to a major effect QTL of single ear grain weight of wheat, the primer set of the molecular marker comprising three primers with nucleotide sequences as shown in SEQ ID NO.10 (forward primer 1), SEQ ID NO.11 (forward primer 2) and SEQ ID NO.12 (universal primer R); the major effect QTL is named QKwps.sau-2D.1, which is located on wheat chromosome 2D, the forward primer 1 comprises an F probe capable of binding to a FAM fluorescent group, the nucleotide sequence of the F probe is as shown in SEQ ID NO.19; the forward primer 2 comprises an H probe capable of binding to a HEX fluorescent group, the nucleotide sequence of the H probe is as shown in SEQ ID NO. As shown in NO.20; when the wheat material to be tested shows the fluorescent signal of the fluorescent probe of forward primer 2 of KASP primers, but does not contain the fluorescent signal of the fluorescent probe of forward primer 1, the wheat material to be tested contains the main effect QTL site QKwps.sau-2D.1 that controls the single ear grain weight of wheat; when the wheat material to be tested shows the fluorescent signal of the fluorescent probe of forward primer 1 of KASP primers, but does not contain the fluorescent signal of the fluorescent probe of forward primer 2, the wheat material to be tested does not contain the main effect QTL site QKwps.sau-2D.1 that controls the single ear grain weight of wheat.

[0007] Preferably, when the above primer set is used for fluorescence quantitative PCR amplification, the reaction system for PCR amplification is: 4.5 μL of KASP Mastermix, 2 μL of KASPAssay Mix, 50 ng of template DNA, and RNase-free deionized water added to a total of 10 μL.

[0008] Preferably, when the above primer set is used for fluorescent quantitative PCR amplification, the PCR reaction procedure is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s; annealing and extension at 61°C for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; denaturation at 95°C for 20 s; annealing and extension at 55°C for 40 s; 30 cycles; and insulation at 25°C.

[0009] The present invention also provides a kit for identifying single ear grain weight of wheat, and the kit comprises the three KASP molecular marker primers.

[0010] The primer set or kit of the KASP molecular marker provided by the present invention can be used for wheat breeding, including genotyping of wheat single ear grain weight, screening of high ear grain weight wheat or creation of high ear grain weight wheat strains.

[0011] The KASP molecular marker tightly linked to the major effect QTL of wheat single ear grain weight of the present invention solves the problem of slow trait screening and identification in the wheat breeding process and has the following advantages:

[0012] The present invention discloses for the first time a KASP molecular marker tightly linked to a major QTL site QKwps.sau-2D.1 of single-ear grain weight on a 2D chromosome of wheat and an application thereof. The KASP molecular marker KASP-AX-109431092 is tightly linked to the major QTL site QKwps.sau-2D.1 of single-ear grain weight of wheat, presents a co-segregation marker characteristic, can accurately detect the major QTL site QKwps.sau-2D.1 of single-ear grain weight, realizes efficient gene tracking and detection, has the characteristics of stable amplification, and convenient and fast detection, can assist in the screening of high-ear grain weight wheat in molecular marker breeding, greatly reduces phenotypic identification work, can be applied in the wheat seedling stage, thereby eliminating non-target plants, saving breeding costs, and improving breeding efficiency, and is of great significance for high-yield wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is the position of the KASP-AX-109431092 molecular marker and its closely linked major effect QTLQKwps.sau-2D.1 on the chromosome.

[0014] Figure 2 This is the genotyping result of the parents Chuannong 18 and T1208 using fluorescence quantitative PCR with the KASP-AX-109431092 molecular marker in the present invention.

[0015] Figure 3 This is a diagram showing the results of genotyping the progeny of the advanced self-pollinated population of Sichuan Agricultural University 18×T1208 using fluorescent quantitative PCR using the KASP-AX-109431092 molecular marker in the present invention. DETAILED DESCRIPTION

[0016] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0017] Experimental Example 1 Development of Molecular Markers

[0018] (1) By searching for SNP molecular markers located in the molecular marker interval of the main effect QTL QKwps.sau-2D.1 controlling single ear grain weight (SNP molecular markers were selected from 660,000 SNP markers detected by the wheat 660KSNP chip developed by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences and Affymetrix), a total of 6 SNP molecular markers were found, and their nucleotide sequences are shown in Table 1 below. Among them, the 36th base of AX-108773653 has A or G polymorphism, which is represented by N in the sequence table; the 36th base of AX-111148128 has C or G polymorphism, which is represented by N in the sequence table; the 36th base of AX-174239365 has A or G polymorphism, which is represented by N in the sequence table; -109431092 has an A or C polymorphism at the 36th base, which is indicated by N in the sequence table; AX-110073027 has a T or G polymorphism at the 36th base, which is indicated by N in the sequence table; AX-109283238 has a C or T polymorphism at the 36th base, which is indicated by N in the sequence table. Subsequently, the sequences of the SNP molecular markers were used to design KASP molecular marker primers on the PolyMarker website. A total of 6 SNP markers were targeted, and their sequences were converted into KASP molecular marker primers, with a total of 6 sets of primers. Each set of primers consisted of 3 sequences, and the specific sequences are shown in Table 2 below. In the sequences in Table 2, the 5' ends of all forward primers 1 were connected to F probes that bound to FAM fluorescent groups, and the nucleotide sequence of the F probes was shown in SEQ ID NO.19; the 5' ends of all forward primers 2 were connected to H probes that bound to HEX fluorescent groups, and the nucleotide sequence of the H probes was shown in SEQ ID NO.20. The specific sequences are as follows:

[0019] F probe: SEQ ID NO.19 (5'→3')

[0020] GAAGGTGACCAAGTTCATGCT;

[0021] H probe: SEQ ID NO.20 (5'→3')

[0022] GAAGGTCGGAGTCAACGGATT.

[0023] Table 1 Six SNP marker sequences

[0024]

[0025] Table 2 Six pairs of KASP primer sequences

[0026]

[0027]

[0028] Experimental Example 2 Screening of primers for KASP molecular marker polymorphism between parents

[0029] The present invention selects two wheat varieties 'Chuannong 18' and 'T1208', uses the CTAB method to extract DNA of the two parents at the three-leaf stage, uses the primers designed and synthesized in Experimental Example 1 to perform fluorescent quantitative PCR amplification, and performs polymorphism analysis on the parents according to the PCR amplification results. The selected reaction system for fluorescent quantitative PCR amplification is: 4.5 μL of KASP Mastermix, 2 μL of KASPAssay Mix, 50 ng of template DNA, and RNase-free deionized water is added to a total of 10 μL. Among them, the nucleotide sequence of each set of primers contained in KASPAssay Mix is ​​shown in Table 1, and the volume ratio of the three primers (KASP-1: KASP-2: KASP-3) for each SNP molecular marker is 2:2:5.

[0030] The fluorescence quantitative PCR reaction procedure was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 20 s; annealing and extension at 61°C for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; denaturation at 95°C for 20 s; annealing and extension at 55°C for 40 s; 30 cycles; insulation at 25°C, and collection of fluorescence signals.

[0031] According to the screening of polymorphic primers between parents, a pair of primers was finally screened out that was polymorphic between parents 'Chuannong 18' (CN18) and 'T1208'. The name of this KASP molecular marker is KASP-AX-109431092, and the location of the major effect QTL QKwps.sau-2D.1 closely linked to it on the chromosome is as follows Figure 1 As shown in the figure, the primers of the molecular markers have the following results for the genotyping of the parents: Figure 2 As shown, the genotype of the parent 'T1208' has a fluorescence type of HEX fluorescent group type, and the genotype of the parent 'Chuannong 18' has a fluorescence type of FAM fluorescent group type, wherein the genotype of the tested wheat material containing the main effect QTL locus QKwps.sau-2D.1 controlling the single ear grain weight of wheat is recorded as genotype A, and the genotype of the tested wheat material without the main effect QTL locus QKwps.sau-2D.1 controlling the single ear grain weight of wheat is recorded as genotype B, and the single ear grain weight of the wheat line of genotype A is significantly higher than that of the wheat line of genotype B. .

[0032] Experimental Example 3 Application of KASP-AX-109431092 molecular marker in the high-generation selfing population of Sichuan Agricultural University 18×T1208

[0033] The same method as in Experimental Example 2 was used to randomly select 359 strains (excluding the two parents) from the high-generation self-pollination population of 'Chuannong 18'×'T1208', extract DNA from all samples, and use the primer set of KASP-AX-109431092 molecular marker to perform fluorescence quantitative PCR genotyping. The typing results that were the same as the fluorescence signal of 'T1208' were recorded as genotype A, and the same as the fluorescence signal of 'Chuannong 18' were recorded as genotype B. The genotyping results were as follows: Figure 3 As shown in Table 3, there are 203 strains with genotype A and 156 strains with genotype B. Statistics and t-tests were conducted on the grain weight per ear of the two parents and 359 strains for three consecutive years. The results are shown in Table 3 and Table 4. The grain weight per ear of the strain with genotype A is significantly higher than that of the strain with genotype B.

[0034] Table 3 Genotyping of 359 lines in the advanced self-pollination population of 'Chuannong 18' and 'T1208'

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044] Note: Genotype A is the same as T1208; Genotype B is the same as Sichuan Agricultural University 18.

[0045] Table 4 t test results

[0046]

[0047] Note: The numbers in brackets indicate the number of strains carrying the corresponding genotype.

[0048] In summary, the primer set of the KASP-AX-109431092 molecular marker provided by the present invention can be used for genotype analysis of single-ear grain weight of wheat. The molecular marker is stable and reliable, can assist in the screening of high-ear grain weight wheat in molecular marker breeding, and can be used to create high-ear grain weight wheat lines, so as to save breeding costs and improve breeding efficiency, which is of great significance for high-yield wheat breeding.

[0049] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A primer set for a KASP molecular marker tightly linked to a major QTL for wheat grain weight per ear, characterized in that: The primer set of the molecular marker has three primers with nucleotide sequences as shown in SEQ ID NO.10 of forward primer 1, SEQ ID NO.11 of forward primer 2 and SEQ ID NO.12 of universal primer R; The major QTL is named QKwps.sau-2D.1, which is located on wheat chromosome 2D; The 5' end of the forward primer 1 is connected to an F probe that binds to a FAM fluorescent group, and the nucleotide sequence of the F probe is shown in SEQ ID NO.19; the 5' end of the forward primer 2 is connected to an H probe that binds to a HEX fluorescent group, and the nucleotide sequence of the H probe is shown in SEQ ID NO.20; When the wheat material to be tested shows the fluorescent signal of the fluorescent probe of forward primer 2 of KASP primers, but does not contain the fluorescent signal of the fluorescent probe of forward primer 1, the wheat material to be tested contains the main effect QTL site QKwps.sau-2D.1 that controls the single ear grain weight of wheat; when the wheat material to be tested shows the fluorescent signal of the fluorescent probe of forward primer 1 of KASP primers, but does not contain the fluorescent signal of the fluorescent probe of forward primer 2, the wheat material to be tested does not contain the main effect QTL site QKwps.sau-2D.1 that controls the single ear grain weight of wheat.

2. The primer set for KASP molecular marker according to claim 1, characterized in that: When the primer set is used for fluorescent quantitative PCR amplification, the reaction system of the PCR amplification is: 4.5 μL of KASP Mastermix, 2 μL of KASPAssay Mix, 50 ng of template DNA, and RNase-free deionized water is added to a total amount of 10 μL.

3. The primer set for KASP molecular marker according to claim 1, characterized in that: When the primer set is used for fluorescence quantitative PCR amplification, the PCR reaction procedure is as follows: pre-denaturation at 95°C for 10 min; Denaturation at 95°C for 20 s; annealing and extension at 61°C for 40 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C each cycle; denaturation at 95°C for 20 s; annealing and extension at 55°C for 40 s; 30 cycles; insulation at 25°C.

4. A kit for identifying single ear weight of wheat, characterized in that: The kit comprises the primer set for the KASP molecular marker as claimed in claim 1.

5. Use of the primer set of KASP molecular markers according to claim 1 or the kit according to claim 4 in wheat breeding, characterized in that: The application includes any one of the following: 1) for genotyping of wheat single-ear grain weight; 2) for screening of high-ear grain weight wheat; or, 3) for creating high-ear grain weight wheat lines.

Images