Nocardia nucleic acid conservative double housekeeping genes, primers and application

Abstract

The application discloses a nucleic acid conservative double housekeeping gene of Nocardia, which is 16S rDNA and topA, the topA housekeeping gene comprises a full-length gene topAQ and a core identification fragment topAH of the topA, and the nucleotide sequences of the three genes are shown as SEQ ID NO:7-9, and primers for amplifying the nucleic acid conservative double housekeeping gene of Nocardia are disclosed, the primers comprise 16S rDNA primers, topAQ primers and topAH primers, and the upstream and downstream sequences of the three pairs of primers are shown as SEQ ID NO:1-6 in sequence. The double housekeeping gene and the primers can effectively distinguish the differences between Nocardia species and within the species in sequence, effectively shorten the intermediate identification steps, and greatly improve the accuracy of identification. The application further discloses application of the primers and a kit containing the primers in preparation of a medicine with the effect of detecting Nocardiosis.

Description

Technical Field

[0001] This invention belongs to the field of Nocardia detection technology, specifically relating to a conserved double housekeeping gene of Nocardia nucleic acid, primers for amplifying the conserved double housekeeping gene of Nocardia nucleic acid, and its application. Background Technology

[0002] "Snakehead fish" can refer to the snakehead fish, commonly known as blackfish. Due to its large size, rapid growth, high yield, and economic value, snakehead fish has long been considered a nourishing delicacy for those recovering from illness and those with weak constitutions in southern my country. In recent years, with the development of domestic aquaculture and the needs of international trade, snakehead fish has gradually become a popular aquaculture species with booming production and sales, and its farming techniques have attracted widespread attention. According to incomplete statistics, in 2021, the total national snakehead fish production was approximately 700,000 tons, with Guangdong accounting for about 60%, of which the Pearl River Delta region, including Shunde, Zhongshan, Jiangmen, and Qingyuan, accounted for 400,000 tons. As is well known, seedling cultivation is a crucial stage in the artificial breeding of aquatic animals. For most fish, the larval stage is considered the most critical stage in the entire breeding cycle, especially for snakehead fish. Even in Shunde, the region with the highest level of aquaculture, the average survival rate of seedlings is only 20%. Among them, the increase of aquatic pathogens and disease outbreaks are among the main limiting factors for the low survival rate of snakehead fry, which seriously restricts the development of the snakehead fry breeding industry.

[0003] Nocardiosis is a typical and serious chronic bacterial disease that has been spreading widely in southern my country, such as Guangdong, Fujian, and Zhejiang provinces, in recent years, causing increasingly severe damage. It is prevalent in major farmed species such as largemouth bass, black bass, and spotted bass. Some believe that the prevalence of this disease is closely related to the aquaculture environment, stocking density, feed, fry quality, and overuse of drugs. Currently, there are no effective drugs to control it, and aquaculture disease control units and farmers should pay close attention. Early diagnosis, early detection of latent Nocardia infection in fry, and early implementation of hygiene management and drug prevention are key to the prevention and control of this disease.

[0004] Housekeeping genes are a class of genes that are stably expressed in all cells, and their products are essential for maintaining basic cellular life activities. Therefore, the use of housekeeping genes for bacterial species identification has been widely applied in the field of bioidentification and has shown promising prospects. Currently, the most common housekeeping gene in bacterial species identification is 16S rDNA. However, 16S rRNA sequences are highly conserved, generally only allowing for differentiation at the species level and below; differentiation at the subspecies level is difficult, and even subspecies differentiation is challenging. Therefore, when using 16S rRNA for bacterial species identification, it is necessary to combine colony morphology observation with the physiological and biochemical characteristics described in the Bergers Manual to determine the final species. Furthermore, classification errors frequently occur, providing incorrect information for subsequent disease prevention and scientific treatment, missing the optimal treatment window, and leading to serious consequences. Summary of the Invention

[0005] The purpose of this invention is to provide a conserved dual housekeeping gene for Nocardia nucleic acid, which has the characteristics of dual identification within and between species.

[0006] The present invention also aims to provide a primer for amplifying the conserved dual housekeeping gene of Nocardia nucleic acid. This primer has high binding and specificity, and can specifically bind to the Nocardia nucleic acid housekeeping gene. It can effectively distinguish the differences between and within Nocardia species, effectively shorten the intermediate identification steps, and greatly improve the accuracy of identification.

[0007] Another objective of this invention is to provide the application of the above primers in the preparation of a drug that can detect nocardiosis.

[0008] To achieve the aforementioned first objective, the present invention adopts the following technical solution: a conserved dual housekeeping gene for Nocardia nucleic acid, wherein the dual housekeeping gene is a 16S rDNA and a topA housekeeping gene, the topA housekeeping gene includes the full-length topA gene topAQ and the topA core identification fragment topAH, the nucleotide sequence of the 16S rDNA is shown in SEQ ID NO: 7, the nucleotide sequence of the full-length topA gene topAQ is shown in SEQ ID NO: 8, and the nucleotide sequence of the topA core identification fragment topAH is shown in SEQ ID NO: 9.

[0009] To achieve the second objective mentioned above, the present invention adopts the following technical solution: a primer for amplifying the above-mentioned conserved dual housekeeping gene of Nocardia nucleic acid, wherein the primer includes a 16S rDNA primer for amplifying the 16S rDNA housekeeping gene, a topAQ primer for amplifying the full-length topA gene topAQ, and a topAH primer for amplifying the topA core identification fragment topAH, wherein the upstream and downstream sequences of the 16S rDNA primer, the topAQ primer, and the topAH primer are shown in SEQ ID NO: 1 to 6 respectively.

[0010] Specifically:

[0011] 16S rDNA primers:

[0012] 16S-F: TCACGGAGAGTTTGATCCTGG (as shown in SEQ ID NO: 1);

[0013] 16S-R: AAAGGAGGTGATCCAGCCG (shown as SEQ ID NO: 2);

[0014] topAQ primers:

[0015] topAQ-F: GTGATTGTCGAGTCGCCGACGAAGG (as shown in SEQ ID NO: 3);

[0016] topAQ-R: TCAGGACTTGGCCGCGGCGGCGGTC (shown in SEQ ID NO: 4).

[0017] topAH primers:

[0018] topAH-F: TGGTGGGCGAACGGCTCGACGGCAT (shown in SEQ ID NO: 5);

[0019] topAH-R: TCAGGACTTGGCCGCGGCGGCGGTC (shown in SEQ ID NO: 6).

[0020] This invention uses in vitro screening technology to screen for the conserved double housekeeping genes 16S rDNA and topA of Nocardia from 16S rDNA, merB, rctB, rpoD, topA and topR genes, and designs and screens the above-mentioned specific primers based on the conserved double housekeeping genes 16S rDNA and topA of Nocardia.

[0021] The dual housekeeping gene in this invention has the characteristics of dual identification within and between species. The specific primers have high binding and specificity and can specifically bind to the Nocardia nucleic acid housekeeping gene. It has the characteristics of being fast, simple, convenient, accurate, rapid and low cost.

[0022] The present invention also provides a kit for detecting Nocardia, containing the above-mentioned primers.

[0023] To achieve the third objective mentioned above, the present invention adopts the following technical solution: the application of the above primers or kits in the preparation of drugs that have the effect of detecting nocardiac disease.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] (1) The two sets of housekeeping genes screened in this invention can effectively distinguish between interspecific and intraspecific differences. Compared with existing methods, it is no longer necessary to use morphological observation and Bergers manual physiological and biochemical characteristics to identify species directly, which effectively shortens the intermediate identification steps and greatly improves the accuracy of identification.

[0026] (2) This invention is fast, simple, convenient, accurate and low cost. It can play a huge application role in the detection and identification of pathogenic microorganisms and has great application potential. Attached Figure Description

[0027] Figure 1 It is the conserved housekeeping gene amplification sequence obtained in Example 1 that can effectively distinguish between intraspecific and interspecific genes;

[0028] Figure 2 The results are from 0.8% agarose gel electrophoresis analysis of the amplification products in Example 1;

[0029] Figure 3 This is as shown in the 16S rDNA sequence alignment results of Example 2;

[0030] Figure 4 This is the result of topAQ sequence alignment shown in Example 2;

[0031] Figure 5 The results of the topAH sequence alignment are shown in Example 2. Detailed Implementation

[0032] The technical solution of the present invention will be described in detail below with reference to specific embodiments, so that those skilled in the art can better understand and implement the technical solution of the present invention. Unless otherwise specified, the reagents or materials used in the embodiments are all from commercial sources.

[0033] Example 1

[0034] The primers provided in this embodiment for amplifying the conserved dual housekeeping gene of Nocardia nucleic acid were obtained by the following method:

[0035] (1) Screening for nucleic acid matching housekeeping genes includes the following steps:

[0036] The screening of housekeeping genes follows these principles: ANI (average nucleotide identity) analysis, which is a comparative analysis at the whole genome level, is particularly suitable for identifying new strains and species. This involves obtaining the amplified sequence information of the housekeeping gene, comparing it with all gene sequences of multiple strains at the nucleic acid sequence level, i.e., performing homologous gene sequence analysis, and identifying core genome genes through certain screening conditions such as similarity and coverage. Based on this, core genes are selected to form a gene set, and the intersection of intraspecific and intermediate sequences is obtained through comparative analysis, which is the matching result.

[0037] Once the housekeeping gene is identified, the designed primers include the middle random sequence and the primer sequences at both ends, partial sequences of the double housekeeping gene, and combination primers. These primers amplify intraspecific differences, harmonize the homology of interspecific differences, and have advantages over traditional identification methods, such as simple operation, short cycle, low cost, ease of operation, and high accuracy.

[0038] Specifically, it includes:

[0039] (1) Cut off the diseased parts of the diseased live fish fry, grind the tissue and spread it on a plate. After culturing for 48 hours, observe the colony morphology.

[0040] (2) Pick a single colony and inoculate it into a 250mL Erlenmeyer flask containing 100mL of nutrient broth for liquid culture. After 48h of culture, collect the bacteria by centrifugation and extract the genomic DNA using the Tiangen Bacterial Genomic DNA Extraction Kit. For specific operation steps, refer to the instructions of the Tiangen Bacterial DNA Extraction Kit. Store the DNA sample at -80℃ for later use.

[0041] (3) The housekeeping genes of Nocardia in GeneBank were analyzed using BLAST software in NCBI. The amplified sequences of 16S rDNA and topA housekeeping genes were compared and analyzed with the Nucleotide collection (nr / nt) sequences. The housekeeping genes that can be used for identification were 16S rDNA, merB, rctB, rpoD, topR, and topA. The housekeeping genes were then compared and analyzed. Sequences within the effective intersection can effectively distinguish conserved housekeeping genes within and between species. That is, the similarity rate between two housekeeping genes should be higher than 95% within the species and lower than 90% between the species. Housekeeping genes with a similarity rate higher than 95% can be basically identified to the genus name, while housekeeping genes with a similarity rate lower than 90% within and between species can be identified to the species name.

[0042] Screening principles are based on Figure 1 The process involves identifying the genus name first, and then determining the species name, based on the following criteria: the housekeeping gene topA contains 16S, and the intraspecific and interspecific similarity rate of the 16S housekeeping gene is greater than 95%, while the intraspecific and interspecific similarity rate of the topA housekeeping gene is less than 90%.

[0043] (4) The 16S rDNA (SEQ ID NO: 7) and the topA housekeeping gene sequence (SEQ ID NO: 8) obtained through screening were compared using BLAST software in NCBI. Specific sequence analysis was used to identify differential sequences and core sequences, which were then used as the core fragment for amplification to select the optimal amplification and identification fragment. Simultaneously, because rapid PCR amplification fragments exceeding 2000 bp are prone to base mutations and are difficult to amplify, while fragments below 1000 bp result in short amplified fragments, leading to errors such as alignment discrepancies in subsequent matching, the amplification and identification fragment size was designed with a variable region of 1000-2000 bp as the core fragment for amplification. The core region of the topA housekeeping gene (topAH, SEQ ID NO: 9) was screened through alignment, and specific primers were designed. The length of the amplified product fragment was optimized to achieve the PCR amplification reaction, ultimately designing an amplified fragment length of 1067 bp.

[0044] Primers were designed for specific conserved fragments and at both ends of gene sequences, and the correctness of the primers was confirmed.

[0045] The primers obtained are as follows:

[0046] 16S rDNA primers:

[0047] 16S-F: TCACGGAGAGTTTGATCCTGG (as shown in SEQ ID NO: 1);

[0048] 16S-R: AAAGGAGGTGATCCAGCCG (shown as SEQ ID NO: 2);

[0049] topAQ primers:

[0050] topAQ-F: GTGATTGTCGAGTCGCCGACGAAGG (as shown in SEQ ID NO: 3);

[0051] topAQ-R: TCAGGACTTGGCCGCGGCGGCGGTC (shown in SEQ ID NO: 4).

[0052] topAH primers:

[0053] topAH-F: TGGTGGGCGAACGGCTCGACGGCAT (shown in SEQ ID NO: 5);

[0054] topAH-R: TCAGGACTTGGCCGCGGCGGCGGTC (SEQ ID NO: 6);

[0055] The amplified sequence is as follows:

[0056] 16S rDNA housekeeping gene amplification sequence (SEQ ID NO: 7):

[0057]

[0058] The full-length amplified sequence of the topA housekeeping gene (topAQ, SEQ ID NO: 8) is as follows:

[0059]

[0060] The core sequence of the topA housekeeping gene amplification (topAH, SEQ ID NO: 9) is as follows:

[0061]

[0062] These primers can also be designed into kits for easy use.

[0063] Example 2

[0064] (1) Tissue samples were taken from diseased fish fry bred by Zhuhai Yuanrun Aquatic Technology Co., Ltd., and after being minced, the samples were spread on nutrient broth solid plates and cultured for 48 hours.

[0065] (2) Pick a single colony and inoculate it into a 250 mL Erlenmeyer flask containing 100 mL of nutrient broth for liquid culture for 48 h:

[0066] (3) Collect the cultured liquid bacterial solution and then extract the genomic DNA using the Tiangen Bacterial Genomic DNA Extraction Kit. For specific operating steps, refer to the Tiangen Bacterial DNA Extraction Kit instruction manual.

[0067] (4) Using the extracted bacterial genomic DNA as a template, the genomic DNA was amplified using the 16S and topAH primers designed in Example 1.

[0068] The amplification system used was a 50 μL PCR amplification reaction system:

[0069] 16S-F: TCAACGGAGAGTTTGATCCTGG;

[0070] 16S-R:AAAGGAGGTGATCCAGCCG;

[0071] topAQ-F: GTGATTGTCGAGTCGCCGACGAAGG;

[0072] topAQ-R: TCAGGACTTGGCCGCGGCGGCGGTC;

[0073] topAH-F: TGGTGGGCGAACGGCTCGACGGCAT;

[0074] topAH-R: 5 μL each of TCAGCAGGACTTGGCCGCGGCGGCGGTC (10 μmol / L), 3 μL of template DNA, 25 μL of 2×PCR buffer, and sterile double-distilled water to a final volume of 50 μL.

[0075] The amplification programs for 16S rDNA, topAQ, and topAH are as follows:

[0076] 1) 16S rDNA amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 100 s, 30 cycles; 72℃ extension for 5 min.

[0077] 2) TopAQ amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 100 s, 30 cycles; 72℃ extension for 5 min.

[0078] 3) TopAH amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 100 s, 30 cycles; 72℃ extension for 5 min.

[0079] (5) Using the genomic DNA extracted in step (2) as a template, the DNA template was amplified using the primers designed in step (4) of Example 1. The amplification products were analyzed by 0.8% agarose gel electrophoresis (see...). Figure 2 The PCR amplification products were then sent to Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing and analysis.

[0080] (6) The obtained amplified sequences were first aligned to 16S rDNA using the NCBI-BLAST-Nucleotide BLAST program to screen for interspecific relationships. Then, intraspecific relationships were identified by topAH sequence alignment.

[0081] The comparison results are shown in the figure:

[0082] (1) After identification, the 16S rDNA sequence alignment results showed that ( Figure 3The top four matches were all *Nocardia nova*, with a match rate of over 99.8%. However, in the top 100 comparison results, the following appeared: *Nocardia sp* (99.66%), *Nocardia aurantia* (97.96%), *Nocardia vinacea* (98.26%), *Nocardia niigatensis* (98.32%), *Nocardia crassostreae* (97.88%), *Nocardia cyriacigeorgica* (97.82%), *Nocardia pseudosporangifera* (99.8%), *Nocardia albiluteola* (98.81%), *Nocardia titidiscaviarum* (98.55%), *Nocardia aobensis* (98.54%), *Nocardia macrotermitis* (98.54%), *Nocardia coffeae* (98.79%), and *Nocardia...* The bacterial counts were: *SeFiolae* (97.96%), *Nocardia cyriacigeorgica* (97.96%), *Nocardia huaxiensis* (98.22%), and *Nocardia terpenica* (97.83%). This step confirms that the strain belongs to the genus *Nocardia*, thus narrowing its classification to the genus *Nocardia* (Nocardia bacteria). However, the specific species name is still uncertain.

[0083] (2) After determining the species range in (1), the results of topAQ sequence alignment show ( Figure 4 The top five matches were all *Nocardia seriolae*, with a matching rate of over 99.97%. The sixth match was *Nocardia yunnanensis*, with a matching rate of 92.43%, showing a significant difference in homology from the top five. Therefore, the final species name was determined to be *Nocardia seriolae*.

[0084] (3) Because the full-length topAQ amplification product is 2880 bp, while conventional PCR amplification exceeding 2000 bp is prone to base mutations and is difficult to amplify. Therefore, the core region (topAH) of the topA housekeeping gene was screened by comparison, and specific primers were designed to amplify a fragment of 1067 bp. The results of topAH sequence alignment showed that ( Figure 5The top five matches were all *Nocardia seriolae*, with a matching rate of over 99.91%. The sixth match was *Nocardia yunnanensis*, with a matching rate of 92.60%, showing a significant difference in homology from the top five. However, this result was very close to the matching rate of the full-length amplified strain, indicating consistency. Therefore, the final species name was determined to be *Nocardia seriolae*, and rapid identification of the species could be performed using only 16S rDNA, topAH, and corresponding primers.

[0085] Therefore, traditional methods for identifying fungal strains include:

[0086] (1) 16S rDNA sequencing and alignment: Determine the genus name (this process can only determine the genus);

[0087] (2) Colony morphology observation and staining: This process can identify whether a colony is Gram-positive or Gram-negative, whether it produces gas, whether it secretes extracellular products, whether it loses water, whether it is regular, etc., but it has little auxiliary effect on the identification of bacterial species.

[0088] (3) Identification of physiological and biochemical characteristics using the Bergers Manual: This step is often quite different even between different strains of the same bacteria, and it is difficult to define the characteristics as negative or positive. Traditional bacterial identification methods require a lot of manpower, material resources, time, and money, and cannot obtain accurate bacterial names. The current methods for bacterial identification and final determination mainly rely on genome sequencing and comparison.

[0089] Traditional methods for bacterial strain identification and genome sequencing are of great reference value for academic research, but they have significant drawbacks for enterprises or for strain screening. The method described in this invention can effectively solve these problems, featuring speed, simplicity, convenience, accuracy, and low cost. It provides an important identification tool for strain screening, rapid identification of pathogens, and microbial detection, and has enormous application market potential.

[0090] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure. Any improvements and modifications made based on the concept of the present invention fall within the scope of protection of the present invention, the specific scope of protection being as described in the claims.

Claims

1. A type of Nocardia amberjack ( Nocardia seriolae Nucleic acid conserved dual housekeeping genes are characterized by: The dual housekeeping genes include 16S rDNA and the topA housekeeping gene. The topA housekeeping gene includes the full-length topA gene topAQ and the topA core identification fragment topAH. The nucleotide sequence of the 16S rDNA is shown in SEQ ID NO: 7, the nucleotide sequence of the full-length topA gene topAQ is shown in SEQ ID NO: 8, and the nucleotide sequence of the topA core identification fragment topAH is shown in SEQ ID NO:

9.

2. A method for amplifying Nocardia amberjack as described in claim 1 ( Nocardia seriolae Primers for conserved dual housekeeping genes in nucleic acids, characterized by: The primers include 16S rDNA primers for amplifying the 16S rDNA housekeeping gene, topAQ primers for amplifying the full-length topA gene topAQ, and topAH primers for amplifying the topA core identification fragment topAH, wherein the upstream and downstream sequences of the 16S rDNA primers, topAQ primers, and topAH primers are shown in SEQ ID NO: 1-6, respectively.

3. A method for detecting Nocardia in yellowtail ( Nocardia seriolae Nucleic acid reagent kits, characterized by: It contains the primers described in claim 2.

4. The primers described in claim 2 are used in the preparation of primers for detecting Nocardia amberjack (…). Nocardia seriolae Application in the kit.

Images