BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with reference gene GAPDH as quality control

Abstract

The invention discloses a fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) kit for BVDV (Bovine Virus Disease Virus) nucleic acid detection by taking a reference gene GAPDH as quality control. The kit comprises an upstream primer BVDV-F as shown in SEQ ID NO. 1, a downstream primer BVDV-R as shown in SEQ ID NO. 2, an upstream primer GAPDH-F as shown in SEQ ID NO. 5, and a downstream primer GAPDH-R as shown in SEQ ID NO. 6. The invention also discloses a detection method of the kit. According to the kit disclosed by the invention, a housekeeping gene with relatively stable expression is introduced as a reference gene to correct and standardize target gene detection, so that the technical defects of false negative and false positive possibly occurring in an existing kit are avoided, and the accuracy, sensitivity and repeatability of the kit are improved; and the nucleic acids of BVDV-1, BVDV-2 and BVDV-3 in different samples can be detected at the same time.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a BVDV nucleic acid detection fluorescent quantitative RT-PCR kit using an internal reference gene GAPDH as quality control. Background Art

[0002] Bovine viral diarrhea virus (BVDV) is distributed globally and has two genotypes, namely BVDV-1 and BVDV-2. It belongs to the genus Pestivirus of the Flaviviridae family, along with swine fever virus (CSFV) and sheep border virus. In recent years, new BVDV strains different from BVDV-1 and BVDV-2 have been discovered and classified as BVDV-3 by researchers. Due to the extensive cross-antigen and serological cross-reactions between BVDV and CSFV, it is difficult to differentiate them clinically using serological methods.

[0003] The fluorescent quantitative RT-PCR method has the advantages of strong specificity, high sensitivity and a wide detection range, and is an important detection method. The existing fluorescent quantitative RT-PCR method for detecting BVDV nucleic acid can detect BVDV-1 and BVDV-2 nucleic acids at the same time, but there is a lack of fluorescent quantitative RT-PCR kits that can detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids at the same time. Because it cannot identify CSFV, it is only used for the detection of bovine samples such as bovine nasal swabs and fecal samples. There is a technical defect that "false positives" may occur when used for the detection of porcine samples. In addition, the existing fluorescent quantitative RT-PCR kits for the simultaneous detection of BVDV-1, BVDV-2 and BVDV-3 nucleic acids lack internal reference gene design, and cannot monitor the effects of samples in the collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction links, cannot avoid the occurrence of "false negatives", and cannot monitor whether the entire reaction process is proceeding smoothly. An internal reference gene is a gene that is indispensable for maintaining the minimum function of a cell. An ideal internal reference gene should have no significant difference in expression in different types of cells and tissues, and should not be affected by experimental and clinical conditions. However, since the expression of internal reference genes is species and tissue specific, the stability of their expression is relative, so choosing a suitable internal reference gene is particularly important for nucleic acid quantification. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a classic glycolytic enzyme. Since it is widely present in many organisms, it is expressed at high levels in almost all tissues. The protein expression of this enzyme in the same cell or tissue is generally constant, and it is suitable as an internal reference gene for correction and standardization of target gene detection. Therefore, the internal reference gene control setting can avoid the occurrence of "false negatives" and monitor whether the entire reaction process is going smoothly.

[0004] Therefore, a BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with the internal reference gene GAPDH as quality control and its preparation method were established to avoid the occurrence of "false negatives" and "false positives" and detect more BVDV genotypes, which is not only conducive to accurate and efficient BVDV monitoring, but also has important significance for ensuring the quality of animal vaccines, protecting the healthy development of animal husbandry, and promoting the export of my country's agricultural products. Summary of the invention

[0005] The purpose of the present invention is to provide a fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid with an internal reference gene GAPDH as a quality control, and introduce a housekeeping gene with relatively stable expression as an internal reference gene to correct and standardize the detection of the target gene, thereby avoiding the technical disadvantages of "false negative" and "false positive" that may occur in existing kits, so as to improve the accuracy, sensitivity and repeatability of the kit, and can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids in different samples.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] The fluorescent quantitative RT-PCR primer and probe combination for BVDV nucleic acid detection using the internal reference gene GAPDH as quality control includes:

[0008] 1) The primer pair sequence for amplifying BVDV 5′-UTR is:

[0009] Upstream primer BVDV-F: 5′-CAGTGAGTTCVTTGGATNGCCG-3′ (genomic position 150-171 nt);

[0010] Downstream primer BVDV-R: 5′-TRGGTTAAGATGTRCYGTGGG-3′ (genomic position 255-275 nt);

[0011] 2) The TaqMan probe sequence for detecting the amplified product of the BVDV 5′-UTR was: BVDV-P: 5′-FAM-TGAGTACAGGGDAGTCGTCAATGGTTCG-BHQ1 -3′ (genomic position 178-205 nt);

[0012] 3) The primer pair sequence for amplifying the porcine internal reference gene GAPDH is:

[0013] Upstream primer GAPDH-F: 5′-CCCCAACGTGTCGGTTGT-3′ (genomic position: 488-505 nt);

[0014] Downstream primer GAPDH-R: 5′-CTTCACCACCTTCTTGATGTCATC-3′ (genomic position: 543-566 nt);

[0015] 4) The TaqMan probe sequence for detecting the amplified product of the porcine internal reference gene GAPDH is:

[0016] GAPDH-P: 5′-VIC-ATCTGACCTGCCGCCTGGAGAAACC-BHQ1 -3′ (genomic position: 508-532 nt).

[0017] The fluorescent quantitative RT-PCR kit is a two-step TaqMan probe kit, a two-step SYBR GreenI kit, and the like.

[0018] A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid with an internal reference gene GAPDH as quality control comprises an upstream primer BVDV-F and a downstream primer BVDV-R for amplifying BVDV 5′-UTR and an upstream primer GAPDH-F and a downstream primer GAPDH-R for amplifying a porcine internal reference gene GAPDH.

[0019] Furthermore, the two-step TaqMan probe method kit comprises at least the following components:

[0020] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, GAPDH recombinant plasmid, negative control;

[0021] cDNA synthesis system: PrimeScript RT Master Mix and enzyme-free water;

[0022] TaqMan fluorescent PCR reaction system: Premix Ex Taq, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer GAPDH-F, downstream primer GAPDH-R, TaqMan probe GAPDH-P, ROXReference Dye II, enzyme-free water.

[0023] Furthermore, the two-step SYBR Green I method kit comprises at least the following components:

[0024] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, GAPDH recombinant plasmid, negative control;

[0025] cDNA synthesis system: PrimeScript RT Master Mix and enzyme-free water;

[0026] SYBR fluorescent PCR reaction system: TB Green Premix Ex TaqⅡ, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer GAPDH-F, downstream primer GAPDH-R, ROX Reference Dye II, enzyme-free water.

[0027] Furthermore, in the kit:

[0028] BVDV virus liquid positive control: BVDV virus liquid, inactivated by formaldehyde at 37°C and then aliquoted for use.

[0029] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5′-UTR gene [genomic location (1-385nt)];

[0030] GAPDH recombinant plasmid: a recombinant plasmid containing the internal reference gene GAPDH target fragment [genomic location (335-719nt)]. Non-porcine samples are added with GAPDH recombinant plasmid before nucleic acid extraction; pig samples do not need to be added with GAPDH recombinant plasmid and nucleic acid extraction can be performed directly.

[0031] Negative control: one of enzyme-free water, cell culture medium known to be BVDV-negative and GAPDH-negative, or animal tissue suspension known to be BVDV-negative and GAPDH-negative.

[0032] Furthermore, in the kit:

[0033] BVDV virus liquid positive control: BVDV AV69 strain MDBK cell passage product, its virus titer is 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL, inactivated with formaldehyde at 37℃ and then divided for use.

[0034] BVDV recombinant plasmid positive control: a recombinant plasmid containing the BVDV 5′-UTR gene target fragment [genomic location (1-385nt)], 10,000 copies / μL to 500,000 copies / μL.

[0035] GAPDH recombinant plasmid: a recombinant plasmid containing the internal reference gene GAPDH target fragment [genomic location (335-719nt)], 10,000 copies / uL to 500,000 copies / uL.

[0036] Preferably, the BVDV recombinant plasmid positive control is a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-1Oregon C24V strain (GenBank Accession No.: AF091605), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-2SH-28 strain (GenBank Accession No.: HQ258810.1), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-3Th / 04_KhonKaen strain (GenBank Accession No.: NC_012812.1).

[0037] The present invention has the following beneficial effects:

[0038] 1. The present invention establishes a fluorescent quantitative RT-PCR kit that uses the internal reference gene GAPDH as a quality control and can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids in different samples. Existing patents are mainly used to detect BVDV-1 and BVDV-2 nucleic acids. Very few fluorescent quantitative RT-PCR kits for simultaneous detection of BVDV-1, BVDV-2 and BVDV-3 nucleic acids are also unable to identify CSFV and are only used for bovine samples such as bovine nasal swabs and fecal samples. There is a technical defect that "false positives" may occur when used for porcine sample detection, see Application Example 2. Therefore, the present invention can detect more BVDV genotypes, see Application Example 1.

[0039] 2. The present invention provides a BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with an internal reference gene GAPDH as a quality control, and introduces a relatively stably expressed housekeeping gene GAPDH as an internal reference gene to calibrate and standardize the detection of the target gene. The entire process of sample collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction can be monitored. If the internal reference gene control has no amplification curve, it indicates that there is a problem in the sample collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction, and the sample detection result is invalid, avoiding the occurrence of "false negative" samples. See Application Example 3.

[0040] The existing patented kit has developed the bovine GAPDH internal standard detection primer according to the bovine GAPDH mRNA specific nucleotide sequence. The detection tissue sample is derived from cattle, and the porcine GAPDH gene cannot be amplified. It is impossible to understand whether there is a "false negative" in the collection, transportation, processing, nucleic acid extraction, reverse transcription, amplification reaction and other processes of the porcine tissue sample. It is not suitable for the detection of porcine tissue samples, and it cannot detect BVDV-3, see Application Example 3. Even the very few existing fluorescent quantitative RT-PCR kits that can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids cannot avoid the occurrence of "false negative" samples due to the lack of internal reference gene design, and cannot monitor whether the sample is smoothly progressing throughout the reaction process, see Application Example 2.

[0041] The present invention fills the technical gap in the fluorescent quantitative RT-PCR kit for simultaneous nucleic acid detection of BVDV-1, BVDV-2 and BVDV-3 based on the internal reference gene GAPDH, and is of great significance for ensuring the quality of animal vaccines, protecting the healthy development of animal husbandry, and promoting the export of my country's agricultural products.

[0042] 3. The kit of the present invention has high sensitivity, and the minimum detection limits for BVDV-1AV69 strain, BVDV-2 recombinant plasmid template, and BVDV-3 recombinant plasmid template are 10 -0.5 FAID 50 / 0.1mL, 1 copy number / uL, 10 copies / uL. The minimum detection limit of the kit of the present invention is lower than that of the existing patent, and the sensitivity is higher than that of the existing patent, see Application Examples 1-3. In addition, the detection of the kit of the present invention has a good linear relationship and a high amplification efficiency, which is conducive to accurate and efficient BVDV monitoring.

[0043] 4. The primer and probe set of the present invention can be used in a variety of fluorescent quantitative RT-PCR kits, and the kit can be selected according to actual detection needs. It has the advantages of low detection cost, high practical value, and broad application prospects, see Application Examples 1-3. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is the sensitivity result of the two-step BVDV nucleic acid TaqMan probe detection kit for detecting the BVDV-1 gene in a series of standard samples (a to g);

[0045] 1. BVDV-1 virus liquid (10 3.5 FAID 50 / 0.1mL); 2. BVDV-1 virus solution (10 2.5 FAID 50 / 0.1mL); 3. BVDV-1 virus solution (10 1.5 FAID 50 / 0.1mL); 4. BVDV-1 virus solution (10 0.5 FAID 50 / 0.1mL); 5. BVDV-1 virus solution (10 -0.5 FAID 50 / 0.1mL); 6. BVDV-1 virus solution (10 -1.5 FAID 50 / 0.1mL); 7. BVDV-1 virus solution (10 - 2.5 FAID 50 / 0.1mL).

[0046] Figure 2 It is the sensitivity result of the two-step BVDV nucleic acid TaqMan probe detection kit for detecting the GAPDH gene in a series of standard samples (a to g);

[0047] 1. GAPDH recombinant plasmid (100,000 copies / uL); 2. GAPDH recombinant plasmid (10,000 copies / uL); 3. GAPDH recombinant plasmid (1,000 copies / uL); 4. GAPDH recombinant plasmid (100 copies / uL); 5. GAPDH recombinant plasmid (10 copies / uL); 6. GAPDH recombinant plasmid (1 copy / uL); 7. GAPDH recombinant plasmid (0.1 copy / uL).

[0048] Figure 3 It is the sensitivity result of the two-step BVDV nucleic acid TaqMan probe method detection kit for detecting the BVDV-2 gene in a series of standard samples (h to m);

[0049] 1. BVDV-2 recombinant plasmid (100,000 copies / uL); 2. BVDV-2 recombinant plasmid (10,000 copies / uL); 3. BVDV-2 recombinant plasmid (1,000 copies / uL); 4. BVDV-2 recombinant plasmid (100 copies / uL); 5. BVDV-2 recombinant plasmid (10 copies / uL); 6. BVDV-2 recombinant plasmid (1 copy / uL).

[0050] Figure 4 It is the sensitivity result of the two-step BVDV nucleic acid TaqMan probe detection kit for detecting GAPDH in a series of standard samples (h to m);

[0051] 1. GAPDH recombinant plasmid (100,000 copies / uL); 2. GAPDH recombinant plasmid (10,000 copies / uL); 3. GAPDH recombinant plasmid (1,000 copies / uL); 4. GAPDH recombinant plasmid (100 copies / uL); 5. GAPDH recombinant plasmid (10 copies / uL); 6. GAPDH recombinant plasmid (1 copy / uL).

[0052] Figure 5 It is the sensitivity result of the two-step BVDV nucleic acid TaqMan probe detection kit for detecting the BVDV-3 gene in a series of standard samples (n to s);

[0053] 1. BVDV-3 recombinant plasmid (100,000 copies / uL); 2. BVDV-3 recombinant plasmid (10,000 copies / uL); 3. BVDV-3 recombinant plasmid (1,000 copies / uL); 4. BVDV-3 recombinant plasmid (100 copies / uL); 5. BVDV-3 recombinant plasmid (10 copies / uL); 6. BVDV-3 recombinant plasmid (1 copy / uL).

[0054] Figure 6 It is the sensitivity result of the two-step BVDV nucleic acid TaqMan probe detection kit for detecting the GAPDH gene in a series of standard samples (n to s);

[0055] 1. GAPDH recombinant plasmid (100,000 copies / uL); 2. GAPDH recombinant plasmid (10,000 copies / uL); 3. GAPDH recombinant plasmid (1,000 copies / uL); 4. GAPDH recombinant plasmid (100 copies / uL); 5. GAPDH recombinant plasmid (10 copies / uL); 6. GAPDH recombinant plasmid (1 copy / uL).

[0056] Figure 7 The following are typical BVDV amplification curves of negative and positive controls in the FAM channel (BVDV detection); (a) two-step TaqMan probe method kit; (b) two-step SYBR Green I method kit.

[0057] Figure 8 These are typical RPL4 amplification curves for negative and positive VIC channels (RPL4 detection); among them, (a) two-step TaqMan probe method kit; (b) two-step SYBR Green I method kit. DETAILED DESCRIPTION

[0058] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0059] According to the published genome sequences of BVDV-1 (AF091605, AF220247, AF526381, JN400273, KC695814, KJ541471, M31182, MN188074), BVDV-2 (AF502399, FJ527854, HQ258810, JF714967, KJ000672, MN527354, OP7920 28, NC_039237), BVDV-3 (KY762287, KY767958, MH410814, NC_012812, OP210314, HQ231763, JX469119, JX985409) and CSFV (AF091507, AF531433, AY568569, DQ127910, EU490425) gene sequences were analyzed using DNAStar 7.1 software was used to compare and analyze the sequences, and the conservative segment of the 5′-UTR gene was selected as the target gene for detection. According to the TaqMan probe design principles, BioEdit7.2.6.1 and Primer Express 3.0.1 software were used to design a pair of BVDV 5′-UTR primers and a specific TaqMan probe, named as upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, and their specificity was identified by BLAST. In addition, according to the internal reference gene sequence of porcine GAPDH (DQ845173.1) in GenBank, according to the TaqMan probe design principles, Primer Express 3.0.1 software was used to design a pair of internal reference gene GAPDH primers and a specific TaqMan probe, named as upstream primer GAPDH-F, downstream primer GAPDH-R, TaqMan probe GAPDH-P, and their specificity was identified by BLAST.

[0060] The BVDV nucleic acid detection fluorescence quantitative RT-PCR kit of the present invention, which uses the internal reference gene GAPDH as quality control, comprises:

[0061] 1) The primer pair sequence for amplifying BVDV 5′-UTR is:

[0062] Upstream primer BVDV-F: 5′-CAGTGAGTTCVTTGGATNGCCG-3′ (genomic position 150-171 nt);

[0063] Downstream primer BVDV-R: 5′-TRGGTTAAGATGTRCYGTGGG-3′ (genomic position 255-275 nt);

[0064] 2) The TaqMan probe sequence for detecting the amplified product of the BVDV 5′-UTR was: BVDV-P: 5′-FAM-TGAGTACAGGGDAGTCGTCAATGGTTCG-BHQ1 -3′ (genomic position 178-205 nt);

[0065] The genomic positions of the primers and probes in 1) and 2) above refer to the BVDV strain XJ-04 (GenBank accession number: FJ527854);

[0066] 3) The primer pair sequence for amplifying the porcine internal reference gene GAPDH is:

[0067] Upstream primer GAPDH-F: 5′-CCCCAACGTGTCGGTTGT-3′ (genomic position: 488-505 nt);

[0068] Downstream primer GAPDH-R: 5′-CTTCACCACCTTCTTGATGTCATC-3′ (genomic position: 543-566 nt);

[0069] 4) The TaqMan probe sequence for detecting the amplified product of the porcine internal reference gene GAPDH is:

[0070] GAPDH-P: 5′-VIC-ATCTGACCTGCCGCCTGGAGAAACC-BHQ1 -3′ (genomic position: 508-532 nt);

[0071] In the above 3) and 4), the genomic positions of primers and probes refer to the internal reference gene GAPDH (GenBank accession number: DQ845173.1).

[0072] A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid with an internal reference gene GAPDH as quality control comprises an upstream primer BVDV-F and a downstream primer BVDV-R for amplifying BVDV 5′-UTR and an upstream primer GAPDH-F and a downstream primer GAPDH-R for amplifying a porcine internal reference gene GAPDH.

[0073] The fluorescent quantitative RT-PCR kit is a two-step TaqMan probe kit, a two-step SYBR GreenI kit, and the like.

[0074] Furthermore, the two-step TaqMan probe method kit comprises at least the following components:

[0075] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, GAPDH recombinant plasmid, negative control;

[0076] cDNA synthesis system: PrimeScript RT Master Mix and enzyme-free water;

[0077] TaqMan fluorescent PCR reaction system: Premix Ex Taq, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer GAPDH-F, downstream primer GAPDH-R, TaqMan probe GAPDH-P, ROXReference Dye II, enzyme-free water.

[0078] Refer to the instructions of the nucleic acid extraction or purification kit for operation. Each non-porcine sample (200-400uL) needs to be added with 5-20uL of GAPDH recombinant plasmid during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add GAPDH recombinant plasmid and nucleic acid extraction can be performed directly.

[0079] The cDNA synthesis reaction system was prepared according to Table 1.

[0080] Table 1 Two-step TaqMan probe kit cDNA synthesis reaction system

[0081] Components system PrimeScript RT Master Mix 2μL RNA ≤6μL Enzyme-free water Make up to 10 μL

[0082] The reaction conditions were: 37°C for 15 min (reverse transcription reaction); 85°C for 5 sec (inactivation reaction of reverse transcriptase); 4°C.

[0083] Note: The obtained RT reaction solution is added to the Real Time PCR reaction system in the next step, and the amount added should not exceed 1 / 10 (V / V) of the Real Time PCR reaction volume.

[0084] The reaction system was prepared according to Table 2.

[0085] Table 2 Two-step TaqMan probe kit reaction system

[0086] Components system Premix Ex Taq 10×(N+1)μL Upstream primer BVDV-F (10 μM) 0.4 to 2.4×(N+1)μL Downstream primer BVDV-R (10 μM) 0.4 to 2.4×(N+1)μL TaqMan probe BVDV-P (10 μM) 0.4 to 0.8×(N+1)μL Upstream primer GAPDH-F (10 μM) 0.4 to 2.4×(N+1)μL Downstream primer GAPDH-R (10 μM) 0.4 to 2.4×(N+1)μL TaqMan probe GAPDH-P (10 μM) 0.2 to 0.8×(N+1)μL ROX Reference Dye II 0.05 to 0.2×(N+1)μL DNA ≤2×(N+1)μL Enzyme-free water Fill to 20×(N+1)μL Overall system 20μL

[0087] The optimized reaction conditions are:

[0088] Stage 1: pre-denaturation at 95°C for 30 seconds;

[0089] The second stage: PCR reaction was performed at 95°C for 5 seconds, 60°C for 34 seconds, and 45 cycles. In the second stage of each cycle (60°C for 34 seconds), fluorescence signals were collected (BVDV reporter group "FAM", quencher group "BHQ1", GAPDH reporter group "VIC", quencher group "BHQ1").

[0090] After the test is completed, the results are comprehensively determined based on the collected dynamic fluorescence signal curve and CT value.

[0091] Result judgment:

[0092] (1) Setting of analysis conditions: The threshold value was adjusted according to the instrument noise, so that the threshold line just exceeded the highest point of the negative control amplification line.

[0093] (2) The test is valid if the quality control standard meets the following three conditions at the same time. Otherwise, the test is considered invalid:

[0094] ① The negative control of the FAM channel (BVDV detection) should have no Ct value and no BVDV amplification curve (see Appendix A);

[0095] ② The Ct value of the positive control in the FAM channel (BVDV detection) should be ≤35, and a typical BVDV amplification curve should appear (see Appendix A);

[0096] ③The negative control of the VIC channel (GAPDH detection) should have no Ct value and no GAPDH amplification curve (see Appendix B).

[0097] (3) The test results were judged according to the Ct values ​​of the FAM channel (BVDV detection) and the VIC channel (GAPDH detection). The judgment was divided into:

[0098] (3-1) When the VIC channel (GAPDH detection) sample has no Ct value and no GAPDH amplification curve, or when the VIC channel (GAPDH detection) sample Ct value is >35 and a typical GAPDH amplification curve appears (see Appendix B), it indicates that there are inhibitory components or nucleic acid loss in the reaction system, and resampling, extraction or further purification of nucleic acid is required before retesting.

[0099] (3-2) When the Ct value of the VIC channel (GAPDH detection) sample is ≤35 and a typical GAPDH amplification curve appears, the test result is determined based on the Ct value of the FAM channel (BVDV detection):

[0100] ① The sample in the FAM channel (BVDV detection) has no Ct value and no BVDV amplification curve, indicating that there is no BVDV nucleic acid in the sample and it is judged as negative;

[0101] ② The sample Ct value of the FAM channel (BVDV detection) is ≤42, and a typical BVDV amplification curve appears, indicating that BVDV nucleic acid exists in the sample and is judged as positive;

[0102] ③ Samples with a Ct value of >42 in the FAM channel (BVDV detection) and a typical BVDV amplification curve need to be retested. If the above results are still present after retesting, it is considered positive, otherwise it is considered negative.

[0103] Furthermore, the two-step SYBR Green I method kit comprises at least the following components:

[0104] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, GAPDH recombinant plasmid, negative control;

[0105] cDNA synthesis system: PrimeScript RT Master Mix and enzyme-free water;

[0106] SYBR fluorescent PCR reaction system: TB Green Premix Ex TaqⅡ, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer GAPDH-F, downstream primer GAPDH-R, ROX Reference Dye II, enzyme-free water.

[0107] Refer to the instructions of the nucleic acid extraction or purification kit for operation. Each non-porcine sample (200-400uL) needs to be added with 5-20uL of GAPDH recombinant plasmid during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add GAPDH recombinant plasmid and nucleic acid extraction can be performed directly.

[0108] The cDNA synthesis reaction system was prepared according to Table 3.

[0109] Table 3 Two-step SYBR Green I kit cDNA synthesis reaction system

[0110] Components system PrimeScript RT Master Mix 2μL RNA ≤6μL Enzyme-free water Make up to 10 μL

[0111] The reaction conditions were: 37°C for 15 min (reverse transcription reaction); 85°C for 5 sec (inactivation reaction of reverse transcriptase); 4°C.

[0112] Note: The obtained RT reaction solution is added to the Real Time PCR reaction system in the next step. The amount added should not exceed 1 / 10 (V / V) of the Real Time PCR reaction volume.

[0113] The reaction system was prepared according to Table 4.

[0114] Table 4 Two-step SYBR Green I kit reaction system

[0115]

[0116]

[0117] The optimized reaction conditions are:

[0118] Stage 1: pre-denaturation at 95°C for 30 seconds;

[0119] The second stage: PCR reaction at 95°C for 5 seconds, 60°C for 34 seconds, 45 cycles, collecting the fluorescence signal (reporter group "SYBR", quencher group "None") in the second stage of each cycle (60°C for 34 seconds);

[0120] The third stage: Melting curve acquisition program. The melting curve acquisition program of different PCR instruments is different. Generally, the default melting curve acquisition program of the instrument is used. The melting temperature of BVDV is 86.35±0.30℃, and the melting temperature of GAPDH is 82.42±0.30℃.

[0121] After the test is completed, the results are comprehensively determined based on the collected dynamic fluorescence signal curve and CT value.

[0122] Result judgment:

[0123] (1) The test is valid if the quality control standard meets the following four conditions at the same time. Otherwise, the test is considered invalid:

[0124] ① The negative control should have no BVDV target melting curve;

[0125] ② The positive control showed a typical BVDV target melting curve (BVDV melting temperature was 86.35±0.30℃);

[0126] ③ The positive control showed a typical GAPDH target melting curve (GAPDH melting temperature was 82.42±0.30℃);

[0127] ④ The negative control should not have a GAPDH target melting curve.

[0128] (2) The test results are judged based on whether a typical BVDV target melting curve or a typical GAPDH target melting curve appears. The judgment is divided into:

[0129] (2-1) If the sample does not have a GAPDH melting curve, it indicates that there are inhibitory components in the reaction system or nucleic acid is lost. It is necessary to resample, extract or further purify the nucleic acid before retesting.

[0130] (2-2) When the sample shows a typical GAPDH target melting curve (GAPDH melting temperature is 82.42±0.30℃) (see Appendix B), the test results are judged based on whether a typical BVDV target melting curve appears:

[0131] ① There is no BVDV target melting curve, indicating that there is no BVDV nucleic acid in the sample, which is judged as negative;

[0132] ② The appearance of a typical BVDV target melting curve (see Appendix A) indicates the presence of BVDV nucleic acid in the sample, which is judged as positive.

[0133] Furthermore, in the kit:

[0134] BVDV virus liquid positive control: BVDV virus liquid, inactivated by formaldehyde at 37°C and then aliquoted for use. BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5′-UTR gene [genomic location (1-385nt)];

[0135] GAPDH recombinant plasmid: a recombinant plasmid containing the internal reference gene GAPDH target fragment [genomic location (335-719nt)]. Non-porcine samples are added with GAPDH recombinant plasmid before nucleic acid extraction; pig samples do not need to be added with GAPDH recombinant plasmid and nucleic acid extraction can be performed directly.

[0136] Negative control: enzyme-free water, cell culture medium known to be BVDV-negative and GAPDH-negative, or animal tissue suspension known to be BVDV-negative and GAPDH-negative.

[0137] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize under high pressure at 121°C ± 2°C for 30 minutes, cool and refrigerate for later use;

[0138] PrimeScript RT Master Mix, Premix Ex Taq, TB Green Premix Ex TaqⅡ, and ROXReference Dye II are all products of Dalian Baobio Biotechnology Co., Ltd.

[0139] Furthermore, in the kit:

[0140] BVDV virus liquid positive control: BVDV AV69 strain MDBK cell passage product, its virus titer is 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL, inactivated with formaldehyde at 37℃ and then divided for use.

[0141] BVDV recombinant plasmid positive control: a recombinant plasmid containing the BVDV 5′-UTR gene target fragment [genomic location (1-385nt)], 10,000 copies / μL to 500,000 copies / μL.

[0142] GAPDH recombinant plasmid: a recombinant plasmid containing the internal reference gene GAPDH target fragment [genomic location (335-719nt)], 10,000 copies / uL to 500,000 copies / uL.

[0143] Preferably, the BVDV recombinant plasmid positive control is a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-1Oregon C24V strain (GenBank Accession No.: AF091605), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-2SH-28 strain (GenBank Accession No.: HQ258810.1), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-3Th / 04_KhonKaen strain (GenBank Accession No.: NC_012812.1).

[0144] Example 1

[0145] Two-step TaqMan probe kit for BVDV nucleic acid detection, including:

[0146] (1) Kit control

[0147] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the 5′-UTR gene of the BVDV-3Th / 04_KhonKaen strain (GenBank accession number: NC_012812.1), 500,000 copies / uL.

[0148] GAPDH recombinant plasmid: a recombinant plasmid containing the target fragment of the GAPDH internal reference gene, 500,000 copies / uL.

[0149] Negative control: spleen tissue suspension from an animal known to be BVDV negative and GAPDH negative.

[0150] (2) cDNA synthesis system

[0151] PrimeScript RT Master Mix is ​​a product of Dalian Bao Biotechnology Co., Ltd.

[0152] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0153] (3) TaqMan fluorescent PCR reaction system

[0154] Premix Ex Taq and ROX Reference Dye II are both products of Dalian Baobio Biotechnology Co., Ltd.

[0155] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0156] Upstream primer BVDV-F: 5′-CAGTGAGTTCVTTGGATNGCCG-3′.

[0157] Downstream primer BVDV-R: 5′-TRGGTTAAGATGTRCYGTGGG-3′.

[0158] TaqMan probe BVDV-P: 5′-FAM-TGAGTACAGGGDAGTCGTCAATGGTTCG-BHQ1-3′.

[0159] Upstream primer GAPDH-F: 5′-CCCCAACGTGTCGGTTGT-3′.

[0160] Downstream primer GAPDH-R: 5′-CTTCACCACCTTCTTGATGTCATC-3′.

[0161] TaqMan probe GAPDH-P: 5′-VIC-ATCTGACCTGCCGCCTGGAGAAACC-BHQ1-3′.

[0162] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (400uL), 10uL of GAPDH recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add GAPDH recombinant plasmid and nucleic acid extraction can be performed directly.

[0163] Prepare the cDNA synthesis reaction system according to Table 5.

[0164] Table 5 Two-step TaqMan probe kit cDNA synthesis reaction system

[0165] Components Volume (μL) PrimeScript RT Master Mix 2 DNA / RNA 2 Enzyme-free water 6

[0166] The reaction conditions were: 37°C for 15 min (reverse transcription reaction); 85°C for 5 sec (inactivation reaction of reverse transcriptase); 4°C.

[0167] Note: The obtained RT reaction solution is added to the Real Time PCR reaction system in the next step. The amount added should not exceed 1 / 10 (V / V) of the Real Time PCR reaction volume.

[0168] Prepare the TaqMan fluorescent PCR reaction system according to Table 6.

[0169] Table 6 Reaction system of TaqMan probe kit for BVDV nucleic acid detection (two-step method)

[0170] Components Volume (μL) Premix Ex Taq 10 Upstream primer BVDV-F (10 μM) 1.6 Downstream primer BVDV-R (10 μM) 1.6 TaqMan probe BVDV-P (10 μM) 0.8 Upstream primer GAPDH-F (10 μM) 0.4 Downstream primer GAPDH-R (10 μM) 0.4 TaqMan probe GAPDH-P (10 μM) 0.2 ROX Reference Dye II 0.2 cDNA 2 Enzyme-free water 2.8 Overall system 20

[0171] The optimized reaction conditions are:

[0172] Stage 1: pre-denaturation at 95°C for 30 seconds;

[0173] The second stage: PCR reaction was performed at 95°C for 5 sec, 60°C for 34 sec, for 45 cycles, and the fluorescence signal (reporter group "FAM", quencher group "BHQ1") was collected in the second stage (60°C for 34 sec) of each cycle.

[0174] After the test is completed, the results are comprehensively determined based on the collected dynamic fluorescence signal curve and CT value.

[0175] Result judgment:

[0176] (1) Setting of analysis conditions: The threshold value was adjusted according to the instrument noise, so that the threshold line just exceeded the highest point of the negative control amplification line.

[0177] (2) The test is valid if the quality control standard meets the following three conditions at the same time. Otherwise, the test is considered invalid:

[0178] ① The negative control of the FAM channel (BVDV detection) should have no Ct value and no BVDV amplification curve (see Appendix A);

[0179] ② The Ct value of the positive control in the FAM channel (BVDV detection) should be ≤35, and a typical BVDV amplification curve should appear (see Appendix A);

[0180] ③The negative control of the VIC channel (GAPDH detection) should have no Ct value and no GAPDH amplification curve (see Appendix B).

[0181] (3) The test results were judged according to the Ct values ​​of the FAM channel (BVDV detection) and the VIC channel (GAPDH detection). The judgment was divided into:

[0182] (3-1) When the VIC channel (GAPDH detection) sample has no Ct value and no GAPDH amplification curve, or when the VIC channel (GAPDH detection) sample Ct value is >35 and a typical GAPDH amplification curve appears (see Appendix B), it indicates that there are inhibitory components or nucleic acid loss in the reaction system, and resampling, extraction or further purification of nucleic acid is required before retesting.

[0183] (3-2) When the Ct value of the VIC channel (GAPDH detection) sample is ≤35 and a typical GAPDH amplification curve appears, the test result is determined based on the Ct value of the FAM channel (BVDV detection):

[0184] ① The sample in the FAM channel (BVDV detection) has no Ct value and no BVDV amplification curve, indicating that there is no BVDV nucleic acid in the sample and it is judged as negative;

[0185] ② The sample Ct value of the FAM channel (BVDV detection) is ≤42, and a typical BVDV amplification curve appears, indicating that BVDV nucleic acid exists in the sample and is judged as positive;

[0186] ③ Samples with a Ct value of >42 in the FAM channel (BVDV detection) and a typical BVDV amplification curve need to be retested. If the above results are still present after retesting, it is considered positive, otherwise it is considered negative.

[0187] Example 2

[0188] Two-step SYBR Green I kit for BVDV nucleic acid detection, including:

[0189] (1) Kit control

[0190] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the 5′-UTR gene of the BVDV-3Th / 04_KhonKaen strain (GenBank accession number: NC_012812.1), 500,000 copies / uL.

[0191] GAPDH recombinant plasmid: a recombinant plasmid containing the target fragment of the GAPDH internal reference gene, 500,000 copies / uL.

[0192] Negative control: cell culture medium known to be BVDV negative and GAPDH negative.

[0193] (2) cDNA synthesis system

[0194] PrimeScript RT Master Mix is ​​a product of Dalian Bao Biotechnology Co., Ltd.

[0195] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0196] (3) SYBR fluorescent PCR reaction system

[0197] TB Green Premix Ex TaqⅡ and ROX Reference Dye II are both products of Dalian Bao Biotechnology Co., Ltd.

[0198] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to act for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0199] Upstream primer BVDV-F: 5′-CAGTGAGTTCVTTGGATNGCCG-3′.

[0200] Downstream primer BVDV-R: 5′-TRGGTTAAGATGTRCYGTGGG-3′.

[0201] Upstream primer GAPDH-F: 5′-CCCCAACGTGTCGGTTGT-3′.

[0202] Downstream primer GAPDH-R: 5′-CTTCACCACCTTCTTGATGTCATC-3′.

[0203] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (400uL), 10uL of GAPDH recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add GAPDH recombinant plasmid and nucleic acid extraction can be performed directly.

[0204] Prepare the cDNA synthesis reaction system according to Table 7.

[0205] Table 7 Two-step SYBR Green I kit cDNA synthesis reaction system

[0206] Components Volume (μL) PrimeScript RT Master Mix 2 RNA 2 Enzyme-free water 6

[0207] The reaction conditions were: 37°C for 15 min (reverse transcription reaction); 85°C for 5 sec (inactivation reaction of reverse transcriptase); 4°C.

[0208] Note: The obtained RT reaction solution is added to the Real Time PCR reaction system in the next step. The amount added should not exceed 1 / 10 (V / V) of the Real Time PCR reaction volume.

[0209] Prepare the SYBR fluorescent PCR reaction system according to Table 8.

[0210] Table 8 Two-step SYBR Green I kit reaction system

[0211] Components Volume (μL) TB Green Premix Ex TaqⅡ 10 Upstream primer BVDV-F (10 μM) 1 Downstream primer BVDV-R (10 μM) 1 Upstream primer GAPDH-F (10 μM) 0.4 Downstream primer GAPDH-R (10 μM) 0.4 ROX Reference Dye II 0.2 cDNA 2 Enzyme-free water 5 Overall system 20

[0212] The optimized reaction conditions are:

[0213] Stage 1: pre-denaturation at 95°C for 30 seconds;

[0214] The second stage: PCR reaction was performed at 95°C for 5 sec, 60°C for 34 sec, for 45 cycles, and the fluorescence signal (reporter group "SYBR", quencher group "None") was collected in the second stage (60°C for 34 sec) of each cycle.

[0215] The third stage: melting curve collection program. The melting curve collection programs of different PCR instruments are different. Generally, the default melting curve collection program of the instrument is used.

[0216] After the test is completed, the results are comprehensively determined based on the collected dynamic fluorescence signal curve and CT value.

[0217] Result judgment:

[0218] (1) The test is valid if the quality control standard meets the following four conditions at the same time. Otherwise, the test is considered invalid:

[0219] ① The negative control should have no BVDV target melting curve;

[0220] ② The positive control showed a typical BVDV target melting curve (BVDV melting temperature was 86.35±0.30℃);

[0221] ③ The positive control showed a typical GAPDH target melting curve (GAPDH melting temperature was 82.42±0.30℃);

[0222] ④ The negative control should not have a GAPDH target melting curve.

[0223] (2) The test results are judged based on whether a typical BVDV target melting curve or a typical GAPDH target melting curve appears. The judgment is divided into:

[0224] (2-1) If the sample does not have a GAPDH melting curve, it indicates that there are inhibitory components in the reaction system or nucleic acid is lost. It is necessary to resample, extract or further purify the nucleic acid before retesting.

[0225] (2-2) The sample shows a typical GAPDH melting curve (GAPDH melting temperature is 82.42±0.30℃). The test results are judged based on whether a typical BVDV melting curve appears:

[0226] ① There is no BVDV target melting curve, indicating that there is no BVDV nucleic acid in the sample, which is judged as negative;

[0227] ② The appearance of a typical BVDV target melting curve indicates the presence of BVDV nucleic acid in the sample, which is judged as positive.

[0228] Application Example 1

[0229] The kit of the present invention detects the sensitivity, linear relationship and amplification efficiency of "BVDV-1 and GAPDH gene", "BVDV-2 and GAPDH gene" and "BVDV-3 and GAPDH gene".

[0230] 1. Preparation of a series of standard samples

[0231] 1.1 A series of standard samples related to sensitivity, linear relationship and amplification efficiency of "BVDV-1 and GAPDH gene"

[0232] The BVDV-1AV69 strain MDBK cell subculture product was inactivated with formaldehyde at 37°C and then mixed with the GAPDH recombinant plasmid to prepare a series of standard samples (a to g), as shown in Table 9.

[0233] Table 9 Series of standard samples (BVDV-1 virus liquid and GAPDH gene)

[0234] Standard sample a <![CDATA[BVDV-1 AV69 strain 10 3.5 FAID 50 / 0.1 mL and the mixture of GAPDH recombinant plasmid at 100,000 copies / μL]]> Standard sample b <![CDATA[BVDV-1 AV69 strain 10 2.5 FAID 50 / 0.1 mL and the mixture of 10,000 copies / uL of GAPDH recombinant plasmid]]> Standard sample c <![CDATA[BVDV-1 AV69 strain 10 1.5 FAID 50 / 0.1 mL and the mixture of 1000 copies / uL of GAPDH recombinant plasmid]]> Standard sample d <![CDATA[BVDV-1 AV69 strain 10 0.5 FAID 50 / 0.1 mL and the mixture of 100 copies / μL of GAPDH recombinant plasmid]]> Standard sample <![CDATA[BVDV-1 AV69 strain 10 -0.5 FAID 50 / 0.1 mL and the mixture of 10 copies / uL of GAPDH recombinant plasmid]]> Standard sample f <![CDATA[BVDV-1 AV69 strain 10 -1.5 FAID 50 / 0.1 mL and the mixture of 1 copy number / μL of GAPDH recombinant plasmid]]> Standard sample g <![CDATA[BVDV-1 AV69 strain 10 -2.5 FAID 50 / 0.1 mL and the mixture of 0.1 copy number / μL of GAPDH recombinant plasmid]]>

[0235] 1.2 A series of standard samples related to sensitivity, linear relationship and amplification efficiency of “BVDV-2 and GAPDH gene”

[0236] The recombinant plasmid of BVDV-2SH-28 strain and the recombinant plasmid of GAPDH were mixed to prepare a series of standard samples (h to m), as shown in Table 10.

[0237] Table 10 Series of standard samples (BVDV-2 and GAPDH gene)

[0238] Standard sample h Mixture of BVDV-2 recombinant plasmid 100 000 copies / uL and GAPDH recombinant plasmid 100 000 copies / uL Standard sample i Mixture of BVDV-2 recombinant plasmid 10 000 copies / uL and GAPDH recombinant plasmid 10 000 copies / uL Standard sample Mixture of BVDV-2 recombinant plasmid 1 000 copies / uL and GAPDH recombinant plasmid 1 000 copies / uL Standard sample k Mixture of BVDV-2 recombinant plasmid 100 copies / uL and GAPDH recombinant plasmid 100 copies / uL Standard sample Mixture of BVDV-2 recombinant plasmid 10 copies / uL and GAPDH recombinant plasmid 10 copies / uL Standard sample m Mixture of BVDV-2 recombinant plasmid 1 copy / uL and GAPDH recombinant plasmid 1 copy / uL

[0239] 1.3 A series of standard samples related to the sensitivity, linear relationship and amplification efficiency of the primer pair and probe set of the present invention for detecting "BVDV-3 and GAPDH gene"

[0240] The BVDV-3Th / 04_KhonKaen strain recombinant plasmid and the GAPDH recombinant plasmid were mixed to prepare a series of standard samples (n to s), as shown in Table 11.

[0241] Table 11 Series of standard samples (BVDV-3 and GAPDH gene)

[0242] Standard sample n Mixture of BVDV-3 recombinant plasmid 100 000 copies / uL and GAPDH recombinant plasmid 100 000 copies / uL Standard sample Mixture of BVDV-3 recombinant plasmid 10 000 copies / uL and GAPDH recombinant plasmid 10 000 copies / uL Standard sample p Mixture of BVDV-3 recombinant plasmid 1 000 copies / uL and GAPDH recombinant plasmid 1 000 copies / uL Standard sample q Mixture of BVDV-3 recombinant plasmid 100 copies / uL and GAPDH recombinant plasmid 100 copies / uL Standard sample r Mixture of BVDV-3 recombinant plasmid 10 copies / uL and GAPDH recombinant plasmid 10 copies / uL Standard samples Mixture of BVDV-3 recombinant plasmid 1 copy / uL and GAPDH recombinant plasmid 1 copy / uL

[0243] 2. Viral nucleic acid extraction

[0244] Take 400 μL of the positive control and 400 μL of the negative control in Example 1;

[0245] Another virus titer of 10 2.5 FAID 50 / 0.1mL of CSFV Thiverval strain 400μL, as virus control (GAPDH recombinant plasmid was added during nucleic acid extraction);

[0246] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0247] 3RT-PCR amplification

[0248] 3.1 Sensitivity, linear relationship and amplification efficiency of “BVDV-1 and GAPDH gene”

[0249] The nucleic acids of the obtained series of standard samples (a to g) were amplified by RT-PCR according to the two-step TaqMan probe method kit in Example 1, and positive controls, negative controls and virus controls were set up respectively.

[0250] 3.2 Sensitivity, linear relationship and amplification efficiency of “BVDV-2 and GAPDH gene”

[0251] The nucleic acids of the obtained series of standard samples (h to m) were amplified by RT-PCR according to the two-step TaqMan probe method kit in Example 1, and positive controls, negative controls and virus controls were set up.

[0252] 3.3 Sensitivity, linear relationship and amplification efficiency of “BVDV-3 and GAPDH gene”

[0253] The nucleic acids of the obtained series of standard samples (n to s) were amplified by RT-PCR according to the two-step TaqMan probe method kit in Example 1, and positive controls, negative controls and virus controls were set up.

[0254] 4 Results

[0255] The quality control standards in the experiment simultaneously met the three conditions described in Example 1, and the experiment was effective. The virus control test results showed that the Ct value of the virus control in the VIC channel (GAPDH detection) was ≤35 and a typical GAPDH amplification curve appeared, indicating that the virus control nucleic acid extraction, reverse transcription and amplification effects were good; the virus control in the FAM channel (BVDV detection) had no Ct value and no BVDV amplification curve, indicating that the kit in Example 1 of the present invention can distinguish between BVDV nucleic acid and CSFV nucleic acid, with strong specificity.

[0256] 4.1 Results of sensitivity, linear relationship and amplification efficiency of “BVDV-1 and GAPDH gene”

[0257] The detection was performed on a series of diluted BVDV-1 virus liquid and GAPDH recombinant plasmid template (a to g). The sensitivity results showed that the minimum detection limit of the two-step TaqMan probe method kit for BVDV-1 virus liquid was 10 - 0.5 FAID 50 / 0.1mL, the minimum detection limit for GAPDH recombinant plasmid template is 0.1 copy number / uL, see Figure 1 and Figure 2 The linear relationship and amplification efficiency results show that the BVDV nucleic acid detection TaqMan probe method kit (two-step method) of the present invention is effective in 10 - 0.5 FAID 50 / 0.1mL~10 3.5 FAID 50 / 0.1mL virus titer showed a good linear relationship, and its correlation coefficient (R 2 ) was 0.986, the amplification efficiency was 113.465, and the standard curve was: y = -3.036x + 46.601; in the range of 0.1 copies / uL to 100000 copies / uL, the GAPDH template copy number showed a good linear relationship, and its correlation coefficient (R 2 ) is 0.998, the amplification efficiency is 105.547, and the standard curve is: y=-3.196x+40.935. These indicate that the standard curve of the TaqMan probe method kit (two-step method) of the present invention for detecting "BVDV-1 and GAPDH gene" has good linearity and high credibility.

[0258] 4.2 Results of sensitivity, linear relationship and amplification efficiency of detection of “BVDV-2 and GAPDH gene”

[0259] The detection was performed on serially diluted BVDV-2 and GAPDH recombinant plasmid templates (h to m). The sensitivity results showed that the minimum detection limit of the TaqMan probe method kit (two-step method) of the present invention for the BVDV-2 recombinant plasmid template was 1 copy number / uL, and the minimum detection limit for the GAPDH recombinant plasmid template was 1 copy number / uL, see Figure 3 and Figure 4 . The results of linear relationship and amplification efficiency show that the BVDV nucleic acid detection TaqMan probe method kit (two-step method) of the present invention presents a good linear relationship in the range of 1 copy number / uL to 100,000 copies / uL BVDV-2 template copy number, with a correlation coefficient (R2) of 0.999, an amplification efficiency of 97.724, and a standard curve of y=-3.378x+41.564; and presents a good linear relationship in the range of 1 copy number / uL to 100,000 copies / uL GAPDH template copy number, with a correlation coefficient (R2) of 0.999, an amplification efficiency of 101.034, and a standard curve of y=-3.297x+40.722. These indicate that the standard curve of the BVDV nucleic acid detection TaqMan probe method kit (two-step method) of the present invention for detecting "BVDV-2 and GAPDH gene" has good linearity and high credibility.

[0260] 4.3 Results of sensitivity, linear relationship and amplification efficiency of detection of “BVDV-3 and GAPDH gene”

[0261] The detection was performed on serially diluted BVDV-3 and GAPDH recombinant plasmid templates (n to s). The sensitivity results showed that the minimum detection limit of this two-step TaqMan probe method kit for BVDV-3 recombinant plasmid template was 10 copies / uL, and the minimum detection limit for GAPDH recombinant plasmid template was 1 copy / uL, see Figure 5 and Figure 6 The results of linear relationship and amplification efficiency showed that the BVDV nucleic acid detection TaqMan probe method kit (two-step method) of the present invention showed a good linear relationship in the range of 10 copies / uL to 100,000 copies / uL BVDV-3 template copies, and its correlation coefficient (R 2 ) was 0.999, the amplification efficiency was 95.222, and the standard curve was: y = -3.442x + 46.026; the GAPDH template copy number showed a good linear relationship in the range of 1 copy number / uL to 100 000 copies / uL, and the correlation coefficient (R 2) is 0.999, the amplification efficiency is 109.218, and the standard curve is: y=-3.181x+39.696. These indicate that the standard curve of the BVDV nucleic acid detection TaqMan probe method kit (two-step method) of the present invention for detecting "BVDV-3 and GAPDH gene" has good linearity and high credibility.

[0262] Application Example 2

[0263] The two-step TaqMan probe method kit prepared in Example 1 was compared with the existing fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid (patent application number is 202011330477.8).

[0264] 1 Sample

[0265] 1.1 Porcine samples

[0266] 300 mg each of kidney (a1), spleen (b1), mesenteric lymph node (C1), inguinal lymph node (d1), and lung (e1) of suckling piglets were taken, and 300 mg each of kidney (a2), spleen (b2), mesenteric lymph node (C2), inguinal lymph node (d2), and lung (e2) of nursery pigs were taken, and 10% tissue homogenate was made respectively. After repeated freezing and thawing for 3 times, the supernatant was centrifuged and used for later use.

[0267] 1.2 Non-porcine samples

[0268] 300 mg of the feces sample (f1) of the growing cattle was prepared into a 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of peripheral blood leukocytes (g1) of the growing cattle were collected, and 2.0 mL of PBS was added to the nasal swab (h1) of the growing cattle, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0269] 300 mg of adult bovine feces sample (f2) was prepared into 10% homogenate, and the mixture was frozen and thawed three times before centrifugation to obtain the supernatant for later use. 2.0 mL of adult bovine blood was collected to separate bovine peripheral blood leukocytes (g2), and 2.0 mL of adult bovine nasal swab (h2) was placed in 2.0 mL of PBS, and the mixture was frozen and thawed three times before centrifugation to obtain the supernatant for later use.

[0270] 300 mg of the fecal sample (I1) of the growing sheep was prepared into a 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of bovine peripheral blood leukocytes (J1) was collected from the blood of the growing sheep, and 2.0 mL of PBS was added to the nasal swab (K1) of the growing sheep, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0271] 300 mg of adult sheep feces sample (I2) was prepared into 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of bovine peripheral blood leukocytes (J2) was collected from adult sheep blood, and 2.0 mL of PBS was added to the nasal swab (K2) of adult sheep, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0272] 2. Viral nucleic acid extraction

[0273] Take 400 μL of the positive control and 400 μL of the negative control in Example 1;

[0274] Take 400 μL of mixed plasmid positive control and 400 μL of negative control of the same concentration of BVDV-1, BVDV-2, and BVDV-3 in the existing patented kit;

[0275] Another virus titer of 10 2.5 FAID 50 / 0.1mL of CSFV Thiverval strain 400μL, as a virus control (GAPDH recombinant plasmid needs to be added to non-porcine samples during nucleic acid extraction using the kit of Example 1);

[0276] Porcine samples a1, b1, C1, d1, e1, a2, b2, C2, d2, e2;

[0277] Non-porcine samples f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2 (GAPDH recombinant plasmid needs to be added to non-porcine samples during nucleic acid extraction using the kit of Example 1);

[0278] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0279] 3cDNA synthesis

[0280] The extracted nucleic acid was reverse transcribed according to the cDNA synthesis system described in the kit of Example 1 and the prior patented kit.

[0281] 4RT-PCR amplification

[0282] RT-PCR amplification was performed according to the method described in the kit of Example 1 and the existing patent kit, respectively. Among them, positive control and negative control were set up according to the method described in the kit of Example 1; mixed plasmid positive control and negative control of the same concentration of BVDV-1, BVDV-2, and BVDV-3 were set up according to the method described in the existing patent kit.

[0283] 5 Results

[0284] 5.1 Quality control standard test results

[0285] The quality control standard of the two-step TaqMan probe method kit prepared in Example 1 of the present invention meets the three conditions described in Example 1 at the same time, so the kit test in Example 1 is effective.

[0286] The quality control standard test results of the existing patented test kit show that the positive control amplification results of mixed plasmids of the same concentration of BVDV-1, BVDV-2, and BVDV-3 are all positive, and no amplification curve is observed in the negative control, so the existing patented test kit is valid.

[0287] 5.2 Sample test results

[0288] The test results of the kit prepared in Example 1 of the present invention showed that (1) the Ct values ​​of the porcine samples a1, b1, C1, d1, and e1 in the VIC channel (GAPDH detection) were ≤35, and a typical GAPDH amplification curve appeared, indicating that the sampling, transportation, sample processing, nucleic acid extraction, reverse transcription, and amplification of the porcine samples a1, b1, C1, d1, and e1 were good; the Ct values ​​of the non-porcine samples (f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, and K2) in the VIC channel (GAPDH detection) were ≤ 35 and a typical GAPDH amplification curve appeared, indicating that the nucleic acid extraction, reverse transcription and amplification of non-porcine samples were good; FAM channel (BVDV detection) samples a1, b1, C1, d1, e1, f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2 had no Ct value and no BVDV amplification curve, indicating that samples a1, b1, C1, d1, e1, f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2 did not contain BVDV nucleic acid and were judged to be negative. (2) In the VIC channel (GAPDH detection), there were no Ct values ​​and no GAPDH amplification curves for the porcine samples a2, b2, C2, d2, and e2, indicating that there were inhibitory components or nucleic acid loss in the reaction system for the porcine samples a2, b2, C2, d2, and e2, and there was a risk of "false negative". In the FAM channel (BVDV detection), there were no Ct values ​​and no BVDV amplification curves for the porcine samples a2, b2, C2, d2, and e2. However, because there were no Ct values ​​and no GAPDH amplification curves for the VIC channel (GAPDH detection), the porcine samples a2, b2, C2, d2, and e2 needed to be resampled, extracted, or the nucleic acids further purified before retesting. (3) The Ct value of the virus control in the VIC channel (GAPDH detection) was ≤35 and a typical GAPDH amplification curve appeared, indicating that the nucleic acid extraction, reverse transcription and amplification of the virus control were good; the virus control in the FAM channel (BVDV detection) had no Ct value and no BVDV amplification curve, indicating that there was no BVDV nucleic acid in the virus control and it was judged to be BVDV negative.

[0289] The results of the samples tested by the existing patented kit showed that (1) no amplification curves were observed for porcine samples a1, b1, C1, d1, e1, a2, b2, C2, d2, e2 and non-porcine samples f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2, and they were judged as negative. (2) The virus control in the ROX channel (BVDV-3 test) produced an amplification curve, and the amplification result was positive, indicating that the existing patented kit would misdetect CSFV and may produce "false positives" when testing porcine samples.

[0290] 6 Discussions

[0291] Because there is a possibility of "false negative" in the process of sample collection, transportation, processing, nucleic acid extraction, reverse transcription, amplification reaction, etc., in order to avoid "false negative", Example 1 of the present invention has a primer pair for amplifying the internal reference gene GAPDH, a TaqMan probe sequence for detecting the amplified product of GAPDH, and a GAPDH recombinant plasmid. Therefore,

[0292] (1) When testing porcine samples, Example 1 of the present invention can monitor the effects of sampling, transportation, sample processing, nucleic acid extraction, reverse transcription and amplification, such as monitoring whether epithelial cells are collected, monitoring whether a sufficient amount of sample cells are collected, and monitoring the accuracy of the entire experimental operation process such as sampling, extraction, amplification and detection. In this experiment, the VIC channel (GAPDH detection) porcine samples a2, b2, C2, d2, and e2 have no Ct value and no GAPDH amplification curve, indicating that porcine samples a2, b2, C2, d2, and e2 have the risk of causing "false negatives" and need to be re-sampled, extracted, or further purified nucleic acids before re-testing, while the existing patented kit cannot monitor the sampling, transportation, and sample processing processes.

[0293] (2) When testing non-porcine samples, Example 1 of the present invention can monitor the nucleic acid extraction, reverse transcription and amplification effects of each sample, while the existing patented kit cannot perform such monitoring.

[0294] In addition, the samples to be tested by the existing patented kit are bovine nasal swabs and fecal samples. If the samples are from pigs, the CSFV that may exist in the pig samples will cause the existing patented kit to misdetect and may result in a "false positive". The virus control CSFV nucleic acid detected by the kit prepared in Example 1 of the present invention is negative, and has better specificity.

[0295] Application Example 3

[0296] The two-step SYBR Green I method kit prepared in Example 2 was compared with the existing BVDV nucleic acid detection kit (patent application number: 201310516849.X).

[0297] 1 sample

[0298] Take 300 mg each of the kidney (A1), spleen (B1), mesenteric lymph node (C1), inguinal lymph node (D1), and lung (E1) of a suckling pig, and take 300 mg each of the kidney (A2), spleen (B2), mesenteric lymph node (C2), inguinal lymph node (D2), and lung (E2) of a nursery pig, make them into 10% tissue homogenate, freeze-thaw repeatedly for 3 times, and then centrifuge to obtain the supernatant for later use.

[0299] 2. Viral nucleic acid extraction

[0300] Take 400 μL of the positive control and 400 μL of the negative control in Example 2;

[0301] Samples A1, B1, C1, D1, E1, A2, B2, C2, D2, E2;

[0302] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0303] 3cDNA synthesis

[0304] The extracted nucleic acid was reverse transcribed according to the cDNA synthesis system described in the kit of Example 2 and the prior patented kit.

[0305] 4RT-PCR amplification

[0306] RT-PCR amplification was performed according to the method described in the kit of Example 2 and the existing patented kit, respectively. Among them, positive control and negative control were set up according to the method described in the kit of Example 2; BVDVI positive plasmid, BVDVII positive plasmid, GAPDH positive plasmid and negative control were set up according to the method described in the existing patented kit.

[0307] 5 Results

[0308] 5.1 Quality control standard test results

[0309] The quality control standard of the kit prepared in Example 2 of the present invention satisfies the four conditions described in Example 2 at the same time, so the test of the kit in Example 2 is effective.

[0310] The quality control standard test results of the existing patented kit show that the BVDVI-positive plasmid, BVDVII-positive plasmid and GAPDH-positive plasmid can all obtain the target dissolution curve, and the negative control has no amplified dissolution curve, so the existing patented kit test is effective.

[0311] 5.2 Sample test results

[0312] The results of the sample detection by the SYBR Green I method kit (two-step method) for detecting BVDV nucleic acid prepared in Example 2 of the present invention showed that: (1) for GAPDH detection, the melting temperature of the melting curve of samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2 was 82.42±0.30°C and a typical GAPDH amplification curve appeared, indicating that the sampling, transportation, sample processing, nucleic acid extraction, reverse transcription and amplification effects of samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2 were good; (2) for BVDV detection, samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2 had no melting curve and no BVDV amplification curve, indicating that samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2 did not contain BVDV nucleic acid and were judged to be negative.

[0313] The results of sample testing with the existing patented kit showed that there was no amplification melting curve for the target template and internal standard template detection of samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2.

[0314] 6 Discussions

[0315] The existing patented test kit has developed a bovine GAPDH internal standard detection primer according to the specific nucleotide sequence of bovine GAPDH mRNA. The tissue sample detected is from cattle, and the porcine GAPDH gene cannot be amplified. Therefore, the internal standard template detection of samples A1, B1, C1, D1, E1, A2, B2, C2, D2, and E2 has no amplified melting curve, and it is impossible to understand whether there is a "false negative" in the porcine tissue samples during the collection, transportation, processing, nucleic acid extraction, reverse transcription, amplification reaction and other processes. The existing patented test kit is not suitable for the detection of porcine tissue samples, and cannot detect BVDV-3. The test kit prepared in Example 2 of the present invention is not only suitable for the detection of porcine tissue samples, avoiding the occurrence of "false negatives" and "false positives", but also can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids in the sample.

[0316] Appendix A Typical amplification curves of BVDV nucleic acid negative and positive

[0317] Typical BVDV amplification curves for negative and positive controls in the FAM channel (BVDV detection) are shown in Figure 7 :(a) Two-step TaqMan probe kit; (b) Two-step SYBR Green I kit. Appendix B Typical amplification curves of negative and positive GAPDH nucleic acid

[0318] VIC channel (GAPDH detection) negative and positive typical GAPDH amplification curves are shown in Figure 8:(a) Two-step TaqMan probe method kit; (b) Two-step SYBR Green I method kit.

Claims

1. A fluorescent quantitative RT-PCR primer and probe combination for detecting BVDV nucleic acid using the internal reference gene GAPDH as quality control, characterized in that: include: 1) Primer pairs for amplifying BVDV 5´-UTR Upstream primer BVDV-F: 5´- CAGTGAGTTCVTTGGATNGCCG -3´; Downstream primer BVDV-R: 5´- TRGGTTAAGATGTRCYGTGGG -3´; 2) TaqMan probe for detecting BVDV 5´-UTR amplification products BVDV-P: 5´- FAM-TGAGTACAGGGDAGTCGTCAATGGTTCG-BHQ1 -3´; 3) Primer pair for amplifying the porcine internal reference gene GAPDH Upstream primer GAPDH-F: 5´- CCCCAACGTGTCGGTTGT -3´; Downstream primer GAPDH-R: 5´- CTTCACCACCTTCTTGATGTCATC -3´; 4) TaqMan probe for detecting the amplified product of the porcine internal reference gene GAPDH: GAPDH-P: 5´- VIC- ATCTGACCTGCCGCCTGGAGAAACC-BHQ1 -3´.

2. A BVDV nucleic acid detection fluorescence quantitative RT-PCR kit using the internal reference gene GAPDH as quality control, characterized in that: It includes upstream primer BVDV-F and downstream primer BVDV-R for amplifying BVDV 5'-UTR and upstream primer GAPDH-F and downstream primer GAPDH-R for amplifying porcine internal reference gene GAPDH, and the sequences are as follows: Upstream primer BVDV-F: 5´-CAGTGAGTTCVTTGGATNGCCG-3´; Downstream primer BVDV-R: 5´-TRGGTTAAGATGTRCYGTGGG-3´; Upstream primer GAPDH-F: 5´-CCCCAACGTGTCGGTTGT-3´; Downstream primer GAPDH-R: 5´-CTTCACCACCTTCTTGATGTCATC-3´.

3. The BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with internal reference gene GAPDH as quality control according to claim 2, characterized in that: The fluorescent quantitative RT-PCR kit is a two-step TaqMan probe method kit or a two-step SYBR Green I method kit.

4. A BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with internal reference gene GAPDH as quality control according to claim 3, characterized in that: The two-step TaqMan probe method kit comprises at least the following components: Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, GAPDH recombinant plasmid, negative control; cDNA synthesis system: PrimeScript RT Master Mix and enzyme-free water; TaqMan fluorescent PCR reaction system: Premix Ex Taq, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer GAPDH-F, downstream primer GAPDH-R, TaqMan probe GAPDH-P, ROX ReferenceDye II, enzyme-free water.

5. The BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with internal reference gene GAPDH as quality control according to claim 3, characterized in that: The two-step SYBR Green I method kit comprises at least the following components: Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, GAPDH recombinant plasmid, negative control; cDNA synthesis system: PrimeScript RT Master Mix and enzyme-free water; SYBR fluorescent PCR reaction system: TB Green Premix Ex Taq Ⅱ, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer GAPDH-F, downstream primer GAPDH-R, ROX Reference Dye II, enzyme-free water.

6. A BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with internal reference gene GAPDH as quality control according to claim 3, characterized in that: In the kit, the BVDV virus liquid positive control is: BVDV virus liquid; The BVDV recombinant plasmid positive control is a recombinant plasmid containing the BVDV 5´-UTR gene target fragment; The GAPDH recombinant plasmid is a recombinant plasmid containing the internal reference gene GAPDH target fragment; The negative control is one of enzyme-free water, a cell culture fluid known to be BVDV negative and GAPDH negative, or an animal tissue suspension known to be BVDV negative and GAPDH negative.

7. The BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with internal reference gene GAPDH as quality control according to claim 6, characterized in that: The BVDV virus liquid positive control is a BVDV AV69 strain MDBK cell passage product, and its virus titer is 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL; The concentration of the BVDV recombinant plasmid positive control is 10,000 copies / mL to 500,000 copies / mL; The concentration of the GAPDH recombinant plasmid is 10,000 copies / uL to 500,000 copies / uL.

8. The BVDV nucleic acid detection fluorescent quantitative RT-PCR kit with internal reference gene GAPDH as quality control according to claim 6, characterized in that: The BVDV recombinant plasmid positive control is one of a recombinant plasmid containing the target gene fragment of the 5'-UTR of the BVDV-1 Oregon C24V strain, a recombinant plasmid containing the target gene fragment of the 5'-UTR of the BVDV-2 SH-28 strain, and a recombinant plasmid containing the target gene fragment of the 5'-UTR of the BVDV-3 Th / 04_KhonKaen strain.

Images