A fluorescent biosensor for detecting DON and its preparation method
Through the fluorescent biosensor composed of streptavidin magnetic beads and DNA strands, the problem of high cost and low throughput detection in the prior art is solved, and low cost, high sensitivity and high selectivity DON detection is achieved, which is suitable for rapid detection in the food industry.
Patent Information
- Application Number
- CN202310339814.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-31
- Publication Date
- 2025-08-15
- Estimated Expiration
- 2043-03-31
AI Technical Summary
The method of detecting deoxyfusarium enol (DON) in the prior art has strict pre-processing requirements, expensive instruments, small detection throughput, high cost, and difficult to meet the toxin detection needs of the grain industry.
A fluorescent biosensor composed of streptavidin magnetic beads, substrate streptavidin ssDNA, cDNA-FAM and aptamer streptavidin chain DON-Apt was prepared by biological method, and the selective recognition and detection of DON was performed using the high binding ability of streptavidin magnetic beads and the response intensity of cDNA-FAM.
It realizes low-cost, fast and high sensitivity DON detection, simplifies sample pre-processing, reduces detection costs, improves detection efficiency, and has high selectivity and high recovery rate.
Smart Images

Figure CN116466068B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of fluorescent biosensors, in particular to a fluorescent biosensor for detecting deoxynivalenol and a preparation method thereof. Background Art
[0002] Deoxynivalenol (DON), also known as vomitoxin, belongs to the trichothecene family of compounds and is primarily produced by fungi such as Fusarium graminearum, Fusarium moniliforme, and Fusarium oxysporum. Consuming grains and oils containing certain amounts of DON can cause symptoms such as stomach discomfort, dizziness, abdominal distension, headache, nausea, vomiting, numbness in the hands and feet, and general fatigue. DON contamination has a significant impact on human health and the economy. The World Health Organization's International Agency for Research on Cancer lists DON as a Group 3 carcinogen. China has established a maximum residue limit (MRL) of 1000 μg / kg for DON in cereals and their processed products, and the European Commission (EC Regulation 1126 / 2007) has set a MRL of 750 μg / kg for DON in cereals intended for direct human consumption. Therefore, DON detection and analysis methods are crucial and have become a research hotspot in various countries.
[0003] Currently, many methods have been developed to detect DON, including ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS), high-performance liquid chromatography, gas chromatography, and gas chromatography-mass spectrometry. However, these methods require stringent sample pretreatment, are expensive, have low detection throughput, and require specialized training for testers. These methods are costly and cannot meet the toxin detection needs of the food industry. Therefore, it is necessary to develop a highly sensitive and specific fluorescent biosensor for DON. Summary of the Invention
[0004] The present invention first provides a fluorescent biosensor for detecting DON, which is composed of streptavidin magnetic beads, substrate chain ssDNA, cDNA-FAM and aptamer chain DON-Apt;
[0005] The particle size of the streptavidin magnetic beads is 1 μm;
[0006] The sequence of the substrate strand ssDNA (5′ to 3′) is the sequence of SEQ NO. 1, and a biotin group is modified at its 3′ end. The specific sequence is: TCATCATCATCATTTTTTTTTTTT-biotin;
[0007] The sequence of cDNA-FAM (5′ to 3′) is the sequence of SEQ NO. 2, and the FAM group is modified at its 5′ end. The specific sequence is: FAM-TTTTTTTTTTTTTGATGCCCGCCG;
[0008] The sequence (5′ to 3′) of the aptamer chain DON-Apt is the sequence of SEQ NO. 3, and the specific sequence is: AAAAAATGATGATGATGACGGCGGGCATCACTACAGTCATTACGCATCGTAGGGGG GATCGTTAAGGAAGTGCCCGGAGGCGGTATCGTGTGAAGTGCTGTCCC
[0009] The present invention also provides a method for preparing the above-mentioned fluorescent biosensor for detecting DON, which comprises the following steps:
[0010] (1) Streptavidin magnetic beads (100 μL, 10 mg / mL) were rinsed three times with PBS phosphate buffer (pH = 7.4, the same below), and 480 μL PBS phosphate buffer and 20 μL substrate strand ssDNA solution (prepared with TE buffer to a 50 μmol / L solution) were added. The beads were shaken at 130 rpm and 25°C for 30 min. The beads were then washed three times with buffer solution and set aside.
[0011] (2) Add the streptavidin magnetic beads connected to ssDNA, 20 μL of cDNA-FAM solution (prepared from TE buffer solution to a 50 μmol / L solution) and 20 μL of DON-Apt solution (prepared from TE buffer solution to a 50 μmol / L solution) into a 10 mL centrifuge tube, then add 960 μL of buffer solution, shake at 130 r / min, 37°C for 120 min, rinse three times with PBS phosphate buffer solution (pH = 7.4), redisperse in 100 μL of PBS phosphate buffer solution (pH = 7.4), and store at 4°C for later use;
[0012] The buffer solution is: 120mmol / L NaCl, 10mmol / L Tris-HCl, 5mmol / L KCl, 20mmol / LMgCl2, pH = 7.4;
[0013] The TE buffer solution is: 10mmol / L Tris-HCl, 1mmol / L EDTA.
[0014] ssNDA, cDNA-FAM and DON-Apt were all prepared into 50 μmol / L solutions using TE buffer solution.
[0015] The present invention also provides a fluorescent biosensor for detecting DON prepared by the above method.
[0016] The method for detecting DON in a solution using the fluorescent biosensor comprises the following steps:
[0017] All fluorescence detection experiments were performed on a Hitachi F-7000 fluorescence spectrophotometer; all experiments were completed at room temperature;
[0018] During the measurement, the prepared fluorescent biosensor was used, with the cDNA-FAM response intensity as the indicator target, to determine the DON concentration in the test solution by a fluorescence scanning method; the reaction solution was PBS phosphate buffer solution (pH = 7.4), the scanning voltage was 500V, and the wavelength range was from 502nm to 700nm; before the fluorescence scanning measurement, the fluorescent biosensor was incubated in the reaction solution for 50 minutes; finally, the DON concentration in the test solution was calculated using a standard curve between the DON concentration in the solution and the change in fluorescence intensity (ΔF).
[0019] Beneficial effects of the present invention:
[0020] (1) The present invention is the first to use streptavidin magnetic beads to connect three DNA chains to establish a detection platform, which has low preparation conditions and uses biological methods to prepare a fluorescent biosensor that selectively recognizes DON.
[0021] (2) The streptavidin magnetic beads of the present invention have a large specific surface area and high binding capacity, which can improve the sensitivity of the biosensor.
[0022] (3) The present invention uses the cDNA-FAM response intensity as the indicator target to detect DON, reducing the interference caused by the addition of other indicators during the detection.
[0023] In summary, the fluorescent biosensor provided by the present invention is simple to prepare and inexpensive. It can effectively and rapidly determine the content of deoxynivalenol in cereal samples with high sensitivity, high recovery, and good selectivity. The detection process does not require expensive large-scale instrumentation, and pretreatment is simple. While ensuring accurate results, it achieves rapid detection, significantly saving costs and improving detection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 Schematic diagram of the structure of the fluorescent biosensor in Example 1.
[0025] Figure 2 This is the fluorescence spectrum of the fluorescent biosensor in Example 1.
[0026] Figure 3 The fluorescent biosensor in Example 1 used PBS phosphate buffer solution (pH = 7.4) as the reaction solution, and DON was added at 0.1, 0.5, 1, 5, 10, 20, 30, 40, and 50 μg L -1Standard curve plot between concentration and change in fluorescence intensity (ΔF) at 500 V.
[0027] Figure 4 In Example 2, the fluorescence biosensor was -1 Fluorescence intensity responses of different interferents (OTA, FB1, ZEN, AFB1, T-2, 3A-DON, 15A-DON and mixed solutions). DETAILED DESCRIPTION
[0028] The following examples are provided to further illustrate the present invention. The present invention is described in conjunction with the preferred embodiments. However, after reading the present examples, those skilled in the art will appreciate that many variations in the disclosed embodiments can be made to obtain the same or similar results, all of which fall within the scope and spirit of the present invention. More specifically, some reagents can be substituted for the reagents disclosed herein and obtain the same or similar results. All similar substitutions or modifications are considered to be within the scope and spirit of the present invention, and all such equivalents are within the scope of the claims.
[0029] Source of raw materials:
[0030] Streptavidin magnetic beads (particle size 1 μm) were purchased from Shanghai Shenger Biotechnology Co., Ltd.
[0031] The substrate strand ssDNA (modified with biotin at the 3′ end), cDNA-FAM, and aptamer DON-Apt were synthesized by Shanghai Sangon Biotechnology Co., Ltd.;
[0032] The sequence of the substrate strand ssDNA (5′ to 3′) is the sequence of SEQ NO. 1, with a biotin group modified at its 3′ position. The specific sequence is: TCATCATCATCATTTTTTTTTTTTTT-biotin;
[0033] The sequence of cDNA-FAM (5′ to 3′) is the sequence of SEQ NO. 2, with a FAM group modified at its 5′ position. The specific sequence is: FAM-TTTTTTTTTTTTTGATGCCCGCCG;
[0034] The sequence (5′ to 3′) of the aptamer chain DON-Apt is the sequence of SEQ NO. 3, and the specific sequence is: AAAAAATGATGATGATGACGGCGGGCATCACTACAGTCATTACGCATCGTAGGGGG GATCGTTAAGGAAGTGCCCGGAGGCGGTATCGTGTGAAGTGCTGTCCC
[0035] PBS phosphate buffer solution (pH = 7.4) was purchased from Shanghai Yuanye Biotechnology Co., Ltd.;
[0036] Ochratoxin A (OTA), fumonisin B1 (FB1), zearalenone (ZEN), aflatoxin B1 (AFB1), T-2 toxin (T-2toxin, T-2), deoxynevalenol (DON), 3-acetyldeoxynivalenol (3A-Deoxynevalenol, 3A-DON), and 15-acetyldeoxynivalenol (15A-Deoxynevalenol, 15A-DON) were purchased from Qingdao Puruibang Biotechnology Co., Ltd.
[0037] The water used in the experiment was secondary deionized water;
[0038] Rice and wheat were collected from Shanghai Pujiang Warehousing Co., Ltd., and corn was purchased from Shanghai Jiakeduo Life Supermarket.
[0039] All fluorescence detection experiments were performed on a Hitachi F-7000 fluorescence spectrophotometer (Hitachi High-Technologies Science, Ltd., Japan).
[0040] Example 1
[0041] The preparation of fluorescent biosensors is mainly divided into the following two steps:
[0042] 1. Rinse streptavidin magnetic beads (100 μL, 10 mg / mL) three times with PBS phosphate buffer (pH = 7.4), add 480 μL PBS phosphate buffer (pH = 7.4) and 20 μL ssDNA solution (50 μmol / L dissolved in TE buffer), and react on a shaker at 130 rpm and 25°C for 30 min. Then, wash three times with buffer solution and set aside.
[0043] 2. Add the ssDNA-linked streptavidin magnetic beads, 20 μL of cDNA-FAM solution (50 μmol / L dissolved in TE buffer solution), and 20 μL of DON-Apt solution (50 μmol / L dissolved in TE buffer solution) to a 10 mL centrifuge tube, then add 960 μL of buffer solution. Incubate in a shaker at 130 r / min and 37°C for 120 min. Rinse three times with PBS buffer solution (PH = 7.4), redisperse in 100 μL of PBS phosphate buffer solution (PH = 7.4), and store at 4°C for later use.
[0044] The buffer solution is: 120mmol / L NaCl, 10mmol / L Tris-HCl, 5mmol / L KCl, 20mmol / LMgCl2, pH = 7.4;
[0045] The TE buffer solution is: 10mmol / L Tris-HCl, 1mmol / L EDTA.
[0046] Experimental results:
[0047] (1) Schematic diagram of the structure of the fluorescent biosensor is attached. Figure 1 The sensor mainly consists of four parts, including streptavidin magnetic beads, substrate chain ssDNA, cDNA-FAM and adapter chain DON-Apt.
[0048] (2) By the attached Figure 2 It can be seen that the fluorescence intensities of streptavidin magnetic beads and streptavidin magnetic beads linked to ssDNA are very low, while the fluorescence intensity of the synthesized biosensor is significantly enhanced to 2141 a.u., indicating that cDNA-FAM and DON-Apt are successfully linked to the magnetic beads.
[0049] Example 2
[0050] Determination of DON in cereal samples using a fluorescent biosensor
[0051] All fluorescence detection experiments were performed on a Hitachi F-7000 fluorescence spectrophotometer (Hitachi High-Technologies Science, Ltd., Japan).
[0052] All experiments were performed at 25°C.
[0053] The fluorescence scanning method was used for testing. The reaction solution was PBS phosphate buffer solution (pH = 7.4), the scanning potential was 500V, and the wavelength range was from 502nm to 700nm. Before the fluorescence scanning measurement, the fluorescent biosensor and the test solution were incubated in the reaction solution at 25℃ for 50min. Finally, the DON concentration in the solution (μg L -1 The DON concentration in the test solution was determined by calculating the standard curve between the fluorescence intensity change (ΔF).
[0054] Rice, wheat, and corn were pretreated as follows: 2.0 g of grain sample was ground into powder and ultrasonically extracted with 20 mL of acetonitrile / water (84 / 16, v / v) for 30 minutes. The sample was then vortexed for 30 minutes and centrifuged at 5000 rpm for 10 minutes. 5 mL of the supernatant was aspirated, dried with nitrogen, and reconstituted with 1 mL of acetonitrile / water (84 / 16, v / v). 10 μL of the test solution was added to 10 μL of the prepared fluorescent biosensor and 180 μL of PBS phosphate buffer (pH 7.4). The solution was incubated at 25°C for 50 minutes. The solution was magnetically separated for 1 minute, and the supernatant was collected for determination of DON concentration.
[0055] Experimental results:
[0056] (1) The detection method was used for the detection of actual samples: the present method was used to detect two samples of rice, wheat and corn, and the results were as follows: rice (4.80±0.36μg / kg; 29.32±1.93μg / kg), wheat (7.50±0.25μg / kg; 10.24±0.42μg / kg), corn (30.43±1.77μg / kg; 14.94±0.61μg / kg). The samples were detected by UPLC-MS / MS method (Fan Kai, Journal of Food Safety and Quality, 2020, 11: 7019-7029), and the measurement results were: rice (4.65±0.22μg / kg; 28.09±0.98μg / kg), wheat (7.49±0.21μg / kg; 10.79±0.29μg / kg), and corn (32.25±1.98μg / kg; 14.76±0.59μg / kg), which were basically consistent with the results measured by the method of this embodiment, indicating that the detection results of the fluorescent biosensor in Example 1 are accurate and reliable.
[0057] (2) Verification of the linearity and sensitivity of the detection method: The fluorescence intensity response of DON at different concentrations was studied using the fluorescence scanning method.
[0058] Different concentrations of DON (0, 0.1, 0.5, 1, 5, 10, 20, 30, 40 and 50 ng / mL) were added to PBS phosphate buffer solution (pH = 7.4) and then tested. The results are shown in the attached figure. Figure 3 As shown in Figure 2, with the increasing concentration of DON, at 0.1 μg L -1 -50 μg L -1 Within the concentration range, its concentration (C DON ) is linearly related to the change in fluorescence intensity (ΔF) at 500 V, and the standard curve equation is ΔF(au)=33.948C DON (μg L -1)+83.526, the linear correlation coefficient was 0.9972, and the minimum detection limit of this method was 0.03333 μg L -1 (S / N=3), indicating that the fluorescent biosensor of Example 1 has high sensitivity and can be used to detect trace amounts of DON in samples.
[0059] (2) Selectivity verification of fluorescent biosensor: In order to examine the selectivity of the invented fluorescent biosensor, 20 μg L -1 DON or 20 μg L -1 The interfering substances (OTA, FB1, ZEN, AFB1, T-2, 3A-DON, 15A-DON and mixed mycotoxin solution (a mixture of the above toxins and DON, each toxin concentration is 20 μg L -1 )), compared the fluorescence biosensor of Example 1 to 20 μg L -1 DON and its 20 μg L -1 The fluorescence intensity of the interfering substance changes with the corresponding signal, expressed as ΔF. The smaller the ΔF, the less interference there is.
[0060] As attached Figure 4 As indicated, 20 μg L -1 When DON was used, ΔF was 770.542, while when other interfering substances were added, ΔF changed slightly. -1 Mix the mycotoxin solution with 20 μg L -1 The DON fluorescence response intensity was relatively consistent. These results demonstrate that the fluorescent biosensor of Example 1 has good selectivity. This is because the aptamer specifically recognizes DON toxin and the streptavidin magnetic beads have a large specific surface area. The fluorescent biosensor prepared with the DON aptamer selectively recognizes only DON molecules in solution and has little response to other interfering substances.
[0061] (4) Recovery verification of the detection method: The recovery of the method was investigated by using the matrix spike method. Blank rice extract, wheat extract, and corn extract samples were spiked with three concentration levels (0.5 μg L -1 , 10 μg L -1 and 40 μg L -1 ) of DON standards, the recovery results were 95.19-112.37%.
[0062] The protection scope of the present invention is not limited to the description in the embodiments, and modifications that do not deviate from the core of the present invention are all within the protection scope of the present invention.
Claims
1. A fluorescent biosensor for detecting DON, characterized in that It consists of streptavidin magnetic beads, substrate chain ssDNA, cDNA-FAM and adapter chain DON-Apt; The particle size of the streptavidin magnetic beads is 1 μm; The sequence of the substrate strand ssDNA from 5′ to 3′ is the sequence of SEQ NO. 1, and a biotin group is modified at its 3′ end; The sequence of cDNA-FAM from 5′ to 3′ is the sequence of SEQ NO.2, and the FAM group is modified at its 5′ end; The sequence 5′ to 3′ of the aptamer chain DON-Apt is the sequence of SEQ NO.
3.
2. A method for preparing a fluorescent biosensor for detecting DON, the method comprising the following steps: (1) 100 μL of streptavidin magnetic beads (10 mg / mL) were washed with PBS phosphate buffer solution, and 480 μL of PBS phosphate buffer solution and 20 μL of substrate strand ssDNA solution were added. The beads were shaken at 130 rpm and 25°C for 30 min, and then washed with buffer solution for later use. (2) Add the streptavidin magnetic beads linked to ssDNA, 20 μL of cDNA-FAM solution, and 20 μL of DON-Apt solution to a 10 mL centrifuge tube, then add 960 μL of buffer solution, shake at 130 rpm, 37°C for 120 min, rinse with PBS phosphate buffer solution, redisperse in 100 μL of PBS phosphate buffer solution, and store at 4°C for later use; The substrate chains ssDNA, cDNA-FAM and DON-Apt were all prepared into 50 μmol / L solutions using TE buffer solution; The TE buffer solution is: 10 mmol / L Tris-HCl, 1 mmol / L EDTA; The buffer solution is: 120mmol / L NaCl, 10mmol / L Tris-HCl, 5mmol / L KCl, 20mmol / LMgCl2, pH=7.4; The particle size of the streptavidin magnetic beads is 1 μm; The sequence of the substrate strand ssDNA from 5′ to 3′ is the sequence of SEQ NO. 1, and a biotin group is modified at its 3′ position; The sequence of cDNA-FAM from 5′ to 3′ is the sequence of SEQ NO.2, and the FAM group is modified at its 5′; The sequence 5′ to 3′ of the aptamer chain DON-Apt is the sequence of SEQ NO.
3.
3. A fluorescent biosensor for detecting DON obtained by the preparation method according to claim 2.