A red kidney bean defensin and its antibacterial and antitumor activities and applications

Abstract

The present invention discloses a red kidney bean defensin and its antibacterial and antitumor activity and application, and belongs to the field of molecular biology technology. The present invention identifies and obtains a brand-new defensin D1 from red kidney bean, and the nucleotide sequence is shown in SEQ ID NO.1. Defensin D1 can be used to inhibit Staphylococcus epidermidis, Bacillus subtilis, and Pseudomonas aeruginosa. Further, the results of tumor inhibition activity identification show that it has anti-human breast cancer cells, human ovarian adenocarcinoma cells, human lung cancer cells, and human glioma cells. Defensin D1 has an antibacterial effect and also has the function of inhibiting tumor activity, has a wide range of application prospects, and its potential is worth further exploration.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a red kidney bean defensin, its antibacterial and antitumor activities and applications thereof. Background Art

[0002] Red kidney beans, Leguminosae, Angiosperms, are a specialty of Shanxi. They are large in size, bright in color, and have both nutritional and medicinal value. They are nutritious and healthy. They have always been a best-seller in the international trade market.

[0003] Defensins are a class of alkaline cationic polypeptides without sugar chains that are widely present in humans, invertebrates, fungi, myxobacteria and plants. They are a type of antimicrobial peptide. Human defensins are small molecule, multifunctional cationic polypeptides; they have a wide range of bactericidal activity, cytotoxicity and immune chemotaxis, and play an important role in the body's inherent immunity and adaptive immune response. Over the years, research on defensins has focused on their role in resisting external microbial invasion. It has been found that defensins have a very wide antibacterial spectrum. In addition to having a killing effect on a variety of microorganisms such as bacteria, viruses, and fungi, they can also kill mycoplasmas, chlamydia, and some malignant tumor cells. In recent years, it has been found that defensins also exist in breast milk and play an important role.

[0004] Plant defensins are generally small molecule polypeptides of 45-54 amino acids, all of which contain relatively conservative six to eight cysteine ​​residues. These cysteines form disulfide bonds within the molecule, making the physical and chemical properties of plant defensins very stable and able to resist damage from external temperature, pH and proteases. These characteristics make them good candidates for drug development.

[0005] Red kidney bean is a nutritious plant, but there is relatively little research on the nutritional value of red kidney bean, and there has not been any systematic and in-depth research. In particular, there is little research on the antibacterial and anti-tumor activity of red kidney bean defensins, and there is almost no research on the application of red kidney bean in human cancer drugs. Therefore, in-depth research on red kidney bean defensins has broad market value. Summary of the invention

[0006] The purpose of the present invention is to provide a new red kidney bean defensin, and its antibacterial and antitumor activities and applications. The antibacterial activity identification results of the present invention show that it has a certain inhibitory effect on Staphylococcus epidermidis, Bacillus subtilis, and Pseudomonas aeruginosa. The tumor inhibition activity identification results show that it has the effect of inhibiting human breast cancer cells, human ovarian adenocarcinoma cells, human lung cancer cells, and human glioma cells, which lays a foundation for defensin as a broad-spectrum antibacterial drug and antitumor drug.

[0007] The present invention provides a red kidney bean defensin D1, and the nucleotide sequence of the defensin D1 is shown as SEQ ID NO.1.

[0008] The invention provides a vector or a host cell carrying the red kidney bean defensin D1.

[0009] The invention provides a composition, which contains the red kidney bean defensin D1.

[0010] The invention provides an antibacterial product containing the red kidney bean defensin D1 or the composition.

[0011] In one embodiment, the product is an antimicrobial agent or an antimicrobial drug.

[0012] The present invention provides an anti-tumor drug containing the red kidney bean defensin D1 or the above-mentioned combination.

[0013] In one embodiment, the composition further comprises at least one pharmaceutically acceptable pharmaceutical excipient: solvent, propellant, solubilizer, cosolvent, emulsifier, colorant, binder, disintegrant, filler, lubricant, wetting agent, osmotic pressure regulator, stabilizer, glidant, flavoring agent, preservative, suspending agent, coating material, fragrance, anti-adhesive agent, integrator, penetration enhancer, pH regulator, buffer, plasticizer, surfactant, foaming agent, defoaming agent, thickener, inclusion agent, humectant, flocculant and deflocculating agent, filter aid and release retardant.

[0014] In one embodiment, the above-mentioned drug further comprises a drug carrier selected from microcapsules, microspheres, nanoparticles and liposomes.

[0015] In one embodiment, the dosage forms of the above-mentioned drug include injection, lyophilized powder for injection, suspension, implant, embolic agent, capsule, tablet, pill and oral solution.

[0016] In one embodiment, the tumors include breast cancer, lung cancer, ovarian adenocarcinoma, and glial carcinoma.

[0017] The present invention also provides the use of the red kidney bean defensin D1 or the above composition in the preparation of antibacterial products.

[0018] In one embodiment, the bacteria include Staphylococcus epidermidis, Bacillus subtilis, and Pseudomonas aeruginosa.

[0019] In one embodiment, the product is an antimicrobial agent or an antimicrobial drug.

[0020] The present invention also provides the use of the red kidney bean defensin D1 or the above composition in the preparation of anti-tumor drugs.

[0021] In one embodiment, the tumors include breast cancer, lung cancer, ovarian adenocarcinoma, and glial carcinoma.

[0022] The beneficial effects are:

[0023] 1. The present invention discovers a new plant defensin from red kidney bean. According to the results of antibacterial experiments, it has a certain antibacterial effect on Staphylococcus epidermidis, Bacillus subtilis, and Pseudomonas aeruginosa, has a broad-spectrum bactericidal effect, and has the potential to be developed into antibacterial products, such as medicines, detergents, etc.

[0024] 2. Furthermore, the plant defensins provided by the present invention also have anti-tumor activity, which has the effect of inhibiting human breast cancer cells, human ovarian adenocarcinoma cells, human lung cancer cells, and human glioma cells, and has the potential to be developed as anti-tumor drugs or anti-tumor adjuvant drugs. The defensins provided by the present invention lay the foundation for being a broad-spectrum antibacterial drug and anti-tumor drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Molecular weight diagram of Western blot identification of defensins of the present invention.

[0026] Figure 2 The present invention provides a molecular weight diagram for the identification of defense mass spectrometry.

[0027] Figure 3 This is a test chart of 18 test samples of the defensin N-terminal sequence of the present invention.

[0028] Figure 4 These are the four sequencing peak graphs of the present invention.

[0029] Figure 5 This is the anti-tumor profile of red kidney bean defensin of the present invention. DETAILED DESCRIPTION

[0030] In order to better explain the invention, the main contents of the present invention are further described below in conjunction with specific embodiments, but the contents of the present invention are not limited to the following embodiments.

[0031] Example 1: Preparation of the full base sequence of defensins

[0032] (1) Total RNA extraction from red kidney beans

[0033] 1. Weigh the red kidney bean granules, soak them in distilled water overnight, grind them into powder with liquid nitrogen, and add 1 mL TRIZOL for every 100 mg of powder. Operate on ice, wash the homogenizer tip with PBS, dry it, and insert it into a 1.5 mL EP tube to 2 / 3 of the TRIZOL solution. Homogenize for 3-5 seconds each time, and continue for 2 minutes to prevent overheating;

[0034] 2. Place the homogenized sample on ice for 10 minutes;

[0035] Centrifuge at 3.4°C and 12,000 g for 10 min, and transfer the supernatant into a new EP tube;

[0036] 4. Add 200 μL of chloroform per 1 mL and shake vigorously for 15 seconds, then let stand at room temperature for 5 minutes;

[0037] Centrifuge at 5.4°C and 12,000 g for 15 min. The centrifuged liquid will separate into three layers. Carefully aspirate the upper layer and transfer it to a new EP tube.

[0038] 6. Add an equal volume of isopropanol, mix gently, and let stand at room temperature for 10 minutes;

[0039] Centrifuge at 12000 g for 10 min at 7.4 °C, discard the supernatant, and wash the pellet twice with 1 mL of 75% ethanol;

[0040] Centrifuge at 7500g for 5 min at 8.4℃, discard the supernatant, air-dry the precipitate at room temperature for 5-10 min, and then dissolve it in 50 μL DEPC water to obtain RNA stock solution. Rapidly identify RNA concentration and purity.

[0041] (2) Reverse transcription of red kidney bean mRNA with ployA tail

[0042] The reverse transcription primer sequences are as follows:

[0043] RTPrimer: GTCGTATCCAGTGCAGGGTCCGAGGTTTTTTTTTTTTTTTT;

[0044] Prepare working solutions A and B. Working solution A provides the components required for adding dA base (ATP, poly(A) enzyme, reaction buffer, etc.), and working solution B provides the components required for reverse transcription (dNTP, primers, reverse transcriptase, reaction buffer, etc.). The working solution A and B system are shown below.

[0045] Working fluid A configuration:

[0046]

[0047] Working fluid B configuration:

[0048]

[0049]

[0050] Working solutions A and B were added to the components in sequence according to the above system and mixed evenly. 8 μL working solution A was added to 12 μL working solution B. 1 ng of total RNA was added to the above mixture for reverse transcription. The reaction was carried out at 37°C for 60 min and at 65°C for 20 min. After the reverse transcription was completed, it was immediately stored at -20°C.

[0051] (3) PCR amplification of cDNA 3' end sequence fragment

[0052] The first-chain cDNA obtained by reverse transcription was used as a template for PCR amplification, followed by gel electrophoresis, gel cutting, recovery, and sequencing.

[0053] The sequences of the primers for first-strand cDNA amplification are as follows:

[0054] Sense strand-F: CTTGCGAGAACCTGGCTGATA;

[0055] RT PCRRP:GTGCAGGGTCCGAGGT;

[0056] The cDNA first-strand amplification system is as follows:

[0057]

[0058] The amplification procedure is as follows:

[0059]

[0060] Amplification was performed according to the above system, and the reaction products were subjected to agarose electrophoresis, gel excision, recovery, and sequencing.

[0061] (4) cDNA chain 5' end sequence amplification

[0062] The first-chain cDNA obtained by reverse transcription was used as a template for PCR amplification, followed by agarose gel electrophoresis, gel cutting, recovery, and sequencing.

[0063] The dA reverse transcription primer sequence is as follows:

[0064] RT Primer: GTCGTATCCAGTGCAGGGTCCGAGGTTTTTTTTTTTTTTTT;

[0065] UPG: CTAATACGACTCACTATAGGGCAAGGGGGGGG;

[0066] The dA reverse transcription system is as follows:

[0067]

[0068]

[0069] Add the components in sequence according to the above system and mix evenly. Add 1 ng of total RNA to the above mixture for reverse transcription. The reverse transcription procedure is: 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min. After the reverse transcription is completed, store it at -20°C.

[0070] Use a primer pair consisting of UP / antisense strand-R primers and cDNA first strand as template to amplify the sequence in the 5ˊ direction of the known sequence.

[0071] The amplification primers are:

[0072] UP: CTAATACGACTCACTATAGGGCAA;

[0073] Antisense strand-R: AGAACGTCACTAGTAGCGTCGA.

[0074] The PCR amplification system is as follows:

[0075]

[0076] The amplification procedure is as follows:

[0077]

[0078] Amplification was performed according to the above system, and the reaction products were subjected to agarose gel electrophoresis, gel excision and recovery, and sent for sequencing.

[0079] (5) PCR product gel recovery

[0080] a. Cut the agarose gel containing the target DNA in step (3) and step (4) under ultraviolet light. Calculate the weight of the gel (record the weight of the 1.5mL centrifuge tube in advance), and use this weight as a gel volume (e.g. 100mg = 100μL volume);

[0081] b. Add Binding Buffer of the same volume as the gel, mix well and place in a 50°C water bath until the gel is completely melted (about 6-8 minutes);

[0082] c. Place the binding column in a 2 mL collection tube, add dissolved gel, and centrifuge at 10,000 g for 1 min at room temperature;

[0083] d. Discard the waste liquid in the collection tube, put the binding column back, add an equal volume of Binding Buffer and centrifuge once;

[0084] e. Discard the waste liquid in the collection tube, add 700 μL SPW to wash, and centrifuge at 10000g for 1 min at room temperature;

[0085] f. Repeat once;

[0086] g. Discard the waste liquid in the collection tube, put the empty collection column back, centrifuge at 13000g at room temperature for 2 minutes, and spin dry the column;

[0087] h. Place the collection column in a clean 1.5 mL centrifuge tube, add an appropriate amount of 15-30 μL Elution buffer to dissolve for 2 min, and centrifuge at 13000 g at room temperature for 2 min to elute the product;

[0088] The product obtained by centrifugation is sent for sequencing, and the two sequences obtained by sequencing are compared. The homologous sequence obtained by comparison is the known sequence. The first chain of cDNA is from the homologous sequence to the 3' end, which is the 3' end of the entire sequence; the cDNA is from the 5' end to the homologous sequence, which is the 5' end sequence of the entire sequence. These two sequences are spliced ​​to obtain the full-length sequence of the target fragment.

[0089] (6) Nested PCR verification experiment

[0090] The expression sequence corresponding to the polypeptide segment can be obtained from the sequencing and splicing results of step (5). According to the splicing results, a nested PCR primer pair is designed, and the nested PCR method is used to amplify and verify the sequencing results. According to experiments 1-5, the sequence of the first chain of cDNA is obtained by sequencing and splicing. First, the cDNA chain is directly reverse transcribed. The parts close to the two ends of the cDNA are selected to design large fragment primers red kidney bean F1 / R1. Using the first chain of cDNA as a template, a large fragment can be amplified. Two positions inside the large fragment are selected (the length also needs to be long enough to ensure that the CDS region is included), and nested primers red kidney bean F2 / R2 are designed. The large fragment product obtained by the first amplification is used as a template for PCR amplification to obtain a small fragment. Then, the small fragment product is used as a template, and the nested primers red kidney bean F2 / R2 are amplified for the third time to obtain the product, which is subjected to gel electrophoresis, gel recovery, and sent for sequencing. The experimental steps are as follows:

[0091] (a) Reverse transcription of red kidney bean total RNA into cDNA

[0092] first step:

[0093]

[0094] The total volume was 13 μL. After the centrifugation was completed, the metal bath was set at 65°C for 10 min. After completion, the metal bath was immediately placed on ice for 5 min.

[0095] Step 2:

[0096] After the mixture reaction tube of the first step is cooled in ice for 5 minutes, the following reaction liquid components are added:

[0097]

[0098] The total volume was 20 μL, and the reaction procedure was as follows: 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min. After inversion, the mixture was stored at -20°C.

[0099] (b) Sequence amplification of red kidney bean defensin D1

[0100] The red kidney bean F1 / R1 primers were designed and amplified using conventional PCR to obtain amplified product I.

[0101] The sequence of the red kidney bean primer F1 / R1 is as follows:

[0102] Red kidney bean F1: ATCAGCACACACAGCAGATA;

[0103] Red kidney bean R1: TCAATTAACTAATTCCTTTTCATATAT;

[0104] The first PCR amplification system:

[0105]

[0106] The amplified product I was used as a template for a second PCR amplification to obtain the amplified product II.

[0107] Design nested primers red kidney bean F2 / R2 and use nested PCR to amplify:

[0108] The sequence of the red kidney bean primer F2 / R2 is as follows:

[0109] Red kidney bean F2: TCACTAACTAAGTCATGGAGAA;

[0110] Red Kidney Bean R2: TGATGATACGAAGAAGGATAA

[0111] Second PCR amplification system:

[0112]

[0113] The amplified product II was subjected to agarose gel electrophoresis with a gel concentration of 1%. The band of about 500 bp was cut out and recovered by gel excision. The recovered product was used as a third PCR template to amplify and obtain defensin D1.

[0114] The third PCR amplification system:

[0115]

[0116] The amplification procedure for the three-step amplification is as follows:

[0117]

[0118] After the third PCR amplification was completed, the product was subjected to agarose gel electrophoresis with a gel concentration of 1%. The band of about 520 bp was cut out and recovered by gel excision. The product was sent for sequencing.

[0119] Amplification verification was performed using nested PCR to obtain a product of about 500 bp, which was successfully sequenced. Comparison showed that the sequence had the highest homology with Phaseolus vulgaris cultivar BAT93 defensin D1 mRNA, complete cds (GenBank: HM240258.1). Compared with HM240258.1, the entire sequenced part had 7 mutation sites, of which the first 4 mutations were located in the 5'UTR region, the fifth mutation site was a mutation in the CDS coding region, from G to A, and the last two mutation sites were located in the 3'UTR region. Therefore, this defensin is a new defensin.

[0120] (c) obtaining a partial amino acid sequence of the defensin of the present invention.

[0121] Measurement results

[0122] a. Identification of the molecular weight of the isolated red kidney bean defensin. The results are as follows Figure 1 and Figure 2 shown.

[0123] b. Sequencing analysis of the N-terminal protein of the defensin of the present invention, the test pattern of the test sample is as follows Figure 3 and Figure 4 . The test was repeated for 15 cycles. Finally, the structural identification showed that the N-terminal sequence of the defensin was:

[0124] NH2--Lys-Thr-X-Glu-Asn-Leu-Ala-Asp-Thr-Tyr-Lys-Gly-Pro-X-Phe-Thr-Thr-Gly, Cys corresponds to X.

[0125] Example 2 Preparation of Defensins

[0126] ①Use a mechanical homopolymerizer to homopolymerize red kidney beans for 2 to 4 minutes to obtain 300 mL of homopolymer product;

[0127] ② Centrifuge at 1000g for 30 min at 4°C, and a large amount of lysed fragments are still suspended;

[0128] ③ Centrifuge at 50000g for 30 min at 4°C to separate the supernatant;

[0129] ④ Add 100mM Tris / HCl to the supernatant until the final concentration of Tris / HCl is 10mM;

[0130] ⑤ Equilibrate AffiGel Blue gel with 10 mM Tris for 150 min;

[0131] ⑥ Load the supernatant from step ④ onto the AffiGel column;

[0132] ⑦ Absorbance of nucleic acid and protein monitoring solution;

[0133] ⑧1M NaCl-Tris / HCl was used as the mobile phase. When the absorbance was >0.1, the sample was collected. The highest peak was 0.4, and about 30 mL was collected in total.

[0134] ⑨Put the washing liquid into a dialysis bag with a molecular weight cut-off of <1000 and store it in 1500mL ddH2O at 4℃ overnight;

[0135] ⑩Continue dialysis for 4 hours;

[0136] Install the sp column and use a 20 mL volume biorad chromatography empty column;

[0137] Equilibrate the sp column with 10 mM NH4OAc for 120 min;

[0138] 100mM NH4OAc The dialyzed protein solution was adjusted to 10mM NH4Oac;

[0139] Load the sample from step ⑩ onto the column at about 3 mL / min for about 30 minutes;

[0140] After loading, wash the column with 10 mM NH4OAc for 30 min;

[0141] The purified samples were eluted with 0.2M, 0.4M and 1M NaCl, respectively.

[0142] Example 3 Antibacterial activity detection.

[0143] Staphylococcus epidermidis, Bacillus subtilis and Pseudomonas aeruginosa were used as target bacteria to test the antimicrobial activity of defensins;

[0144] 1) Inoculate Staphylococcus epidermidis, Bacillus subtilis, and Pseudomonas aeruginosa into LB liquid medium and nutrient broth medium respectively, culture at 37°C with shaking for 15 h, and collect the target bacterial liquid for later use;

[0145] 2) Pour 15 mL of heated and melted LB solid medium into a sterile plate, wait for it to solidify to form a bottom layer and place an Oxford cup between them;

[0146] 3) Take 100 μL of the target bacterial solution prepared in step 1) and add them to the Erlenmeyer flasks containing the unsolidified and non-hot LB solid culture medium, mix well, pour 30 mL into the plate in step 2) and wait for solidification to form the upper layer. After solidification, take out the Oxford cup to form the culture plate with holes;

[0147] 4) Add 200 μL of 10, 20, 40, 80, 100, 150, and 200 μM defensins to the wells formed in the culture medium in step 3), and make negative and positive controls. The negative control is a buffer solution, and the positive control is an ampicillin solution with a mass concentration of 100 μg / mL;

[0148] 5) Place in a 37℃ incubator for 15 hours, observe the antibacterial effect, and measure the diameter of the inhibition zone. Repeat the test 3 times and calculate the average value. The minimum inhibitory mass concentration is determined based on the diameter of the inhibition zone being above 10 mm.

[0149] The results showed that Staphylococcus epidermidis IC 50 40±6μM; Bacillus subtilis IC 50 The IC value of Pseudomonas aeruginosa was 68±11μM. 50 It is 102±21μM.

[0150] Example 4 Antitumor Activity Detection

[0151] 1) Take cells (human breast cancer cells; human ovarian adenocarcinoma cells; human lung cancer cells; human glial carcinoma cells) at 6×10 4 / mL of cells were inoculated into a 6-well culture plate, 100 μL per well, and cultured overnight at 37°C, 5% CO2 and saturated humidity;

[0152] 2) Cell plating: Collect cells in the logarithmic phase and plate 96-well plates at 1,000-10,000 cells / well, with 100 μl of liquid added to each well (fill the edge wells with sterile PBS);

[0153] 3) Cultivate in a 5% CO2, 37°C cell culture incubator until the cell confluence is about 80-90%, add defensins, and the final concentration of defensins reaches 1μg / ml, 2μg / ml, 3μg / ml, 4μg / ml, and 5μg / ml. Each group has 5 replicate wells, and the final volume of each well is 200μL. Add an equal amount of DMEM medium to the control group and continue culturing in a 37°C cell culture incubator for 48h;

[0154] 4) Add MTT: aspirate the culture supernatant, add 90 μl culture medium + 10 μl MTT solution (MTT 10%) to each well, and continue culturing for 4 h;

[0155] 5) Add DMSO: Terminate the culture, carefully remove the culture medium in the wells, add 100-150 μl DMSO to each well, and shake at a low speed on a shaker for 10 minutes to fully dissolve the crystals;

[0156] 6) ELISA detection: Measure the absorbance of each well at OD490nm in an enzyme-linked immunosorbent assay.

[0157] 7) Calculate the proliferation inhibition rate. In the MTT method, the drug concentration required to reduce the absorbance OD value of the control group by half is the IC50.

[0158] The results are as follows Figure 5 As shown, human breast cancer cell IC 50 84.351±84.4μM; IC 50 55.046±55.0μM; IC 50 38.346±38.3μM; IC 50 It is 35.974±36.0μM.

[0159] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. The use of red kidney bean defensin D1 in the preparation of anti-tumor drugs, characterized in that: The nucleotide sequence of the defensin D1 is shown in SEQ ID NO.1, and the tumors include lung cancer, ovarian adenocarcinoma and glial carcinoma.

Images