A method for genotyping chicken black skin trait locus
The peak signal of SNP site at the trait site of chicken black skin was obtained by Sanger sequencing, which solved the problems of high detection cost and poor accuracy in the prior art, and achieved a high accuracy and low cost genotyping method.
Patent Information
- Application Number
- CN202310602805.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-26
- Publication Date
- 2025-02-07
- Estimated Expiration
- 2043-05-26
AI Technical Summary
The prior art has the problem of high cost and poor accuracy when detecting the genotype of the trait of chickens, and requires a simpler, more economical and accurate detection method.
The SNP site signal peak was obtained by Sanger sequencing, and the homozygote and heterozygote of chickens were judged by signal peaks. PCR amplification and sequencing were performed using specific primer pairs (WFF1 and WFR1).
Genotyping with high accuracy was achieved, with homozygous accuracy reaching 100%, and heterozygous accuracy was 98%, while reducing detection costs, making the method simple and easy to implement.
Smart Images
Figure CN116590430B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biological breeding, and in particular to a chicken black skin trait locus gene typing method. Background Art
[0002] The skin color, hair color and leg color of chickens are the iconic features that distinguish a breed and group. They are also an important economic trait of broilers, which is directly related to economic benefits. The dark skin trait is caused by the abnormal deposition of melanin in the chicken skin. The dark skin trait is mainly represented by black-bone chickens. Black-bone chickens are a unique medicinal health chicken breed in my country. They have high medicinal value. Their most notable feature is that they contain a large amount of melanin in their bodies. The melanin of black-bone chickens has the functions of removing antioxidants, free radicals, delaying aging and improving the body's immunity.
[0003] The pigment phenotype of black-bone chicken has physiological and genetic complexity, and is also affected by many factors and is regulated by multiple genes. Silky-feathered black-bone chicken is a typical representative of black skin traits and is also the most widely used material for researchers to study black skin traits. In 2011, Ben J Dorhorst et al. reported through whole-genome association analysis that Fm is located at 10.3-13.1Mb on chromosome 20 and the ID gene is located at 72.3Mb on chromosome Z. The Fm gene region has a complex repetitive sequence with a repetitive interval of about 130Kb, including five genes such as EDN3, SLMO2, and TUBB1. The EDN3 gene is closely related to the formation and deposition of melanin. Its mutation is caused by the inversion and insertion of two gene fragments on chromosome 20, each of which is larger than 100kb, which leads to an increase in the expression of the EDN3 gene. When the dominant allele Fm exists, it will lead to a large amount of melanin deposition.
[0004] At present, there are two ways to detect the genotype of the FM locus. One is to identify the SNP sites linked to the FM locus, and the other is to identify the causative mutation corresponding to the FM locus by real-time fluorescence quantitative PCR, thereby determining the genotype of the identified individual. For example, a method invented by Hu Xiaoxiang et al. to detect the homozygous or heterozygous melanin gene of black-bone chickens is based on pyrophosphate sequencing technology. A pair of primers and a sequencing primer are used to analyze the single nucleotide polymorphism of the 170785bp site of chromosome 27 of chickens. This method is simple to operate, highly sensitive, accurate, and has high throughput. It can quickly detect individuals with homozygous genotypes of black skin, but its cost is relatively high. Hangzhou Academy of Agricultural Sciences and Henan Agricultural University have respectively established methods for identifying the copy number of causative mutations corresponding to FM using real-time fluorescence quantitative PCR. The difference between the two is that the former uses relative quantification, while the latter uses absolute quantification, and a standard curve needs to be constructed. Therefore, although the target site of the dark skin trait has been identified, there have been many studies on the typing of the dark skin locus, some of which are aimed at causal mutations, and some are aimed at SNP sites linked to the trait, but these methods have problems such as high cost and poor accuracy. It is necessary to enrich the detection methods to overcome the defects of existing detection technologies in detecting the genotype of the FM locus. Summary of the invention
[0005] The purpose of the present invention is to provide a method for genotyping chicken black skin trait loci to solve the problems existing in the above-mentioned prior art. The method uses Sanger sequencing method to obtain the SNP site signal peak value, and the chicken homozygote and heterozygote can be accurately judged according to the signal peak value. The method is simple, low-cost, easy to implement and has a high accuracy rate.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a primer for detecting the genotyping of a chicken black skin trait locus, comprising a primer pair as shown below:
[0008] WFF1: AGATTACATTTATCACCTTT;
[0009] WFR1: ATGCTTTTATCTGATGTTCT.
[0010] The present invention also provides a kit for detecting the genotyping of the chicken black skin trait locus, the kit comprising the following primer pairs:
[0011] WFF1: AGATTACATTTATCACCTTT;
[0012] WFR1: ATGCTTTTATCTGATGTTCT.
[0013] The present invention provides a chicken black skin trait locus genotyping method, comprising the following steps:
[0014] The chicken genomic DNA to be tested is used as a template, the target gene is amplified using primer pairs, and then the base signal peak of the SNP site of the target gene is obtained by Sanger sequencing, and genotyping is performed based on the base signal peak of the SNP site;
[0015] Among them, the primer pair is, WFF1: AGATTACATTTATCACCTTT; WFR1: ATGCTTTTATCTGATGTTCT; the target gene is the EDN3 gene, and the target site is the C / T mutation at 221bp and the A / G mutation at 321bp of the amplified fragment.
[0016] Preferably, the genotyping judgment standard is: if the base signal ratios of the SNP site T:C and A:G are both 1:1, it is a homozygote; if the signal ratio of the SNP site is any one of the following (1)-(3), it is a heterozygote:
[0017] (1) The signal ratios of T:C at 221 bp and A:G at 321 bp of the SNP site were both 1 / 2;
[0018] (2) SNP site 221 has TT genotype and the signal ratio of A:G at 321 bp is 1:1;
[0019] (3) The signal ratio of T:C at SNP site 221 is 1 / 2, and the signal ratio of A:G at 321bp is 1:1.
[0020] Preferably, the amplification reaction system is: 2×EcoTaq PCR SuperMix, 0.1 μL each of WFF1 / WFR1, 1 μL of template DNA, and ddH2O supplemented to 10 μL.
[0021] Preferably, the amplification reaction procedure is: 95°C for 5 min; 95°C for 10 s, 50-60°C for 30 s, 72°C for 90 s, 35 cycles; 72°C for 7 min; and storage at 16°C.
[0022] The present invention discloses the following technical effects:
[0023] The present invention adopts the ordinary Sanger sequencing method, which cannot accurately detect the ratio of each base number, but can detect integer differences. Compared with the traditional pyrophosphate sequencing method, this method has the advantages of low cost and simplicity. In production practice, cost is also a factor that needs to be considered.
[0024] The method for identifying the genotype of a SNP site by using Sanger sequencing disclosed by the present invention has a homozygous accuracy rate of 100% and a heterozygous accuracy rate of 98%. The method can be used to perform genotyping on the black skin trait of chickens.
[0025] The present invention performs FM locus genotyping according to the Sanger sequencing method, which has the advantages of being simple, easy to implement and having a high accuracy rate compared to traditional fluorescent quantitative PCR detection and pyrophosphate detection methods, and is suitable for application and promotion to assist in the selection of chicken black skin traits. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0027] Figure 1 The sequencing results are as follows: T:C at mutation site 221 and A:G at mutation site 321 are 1:1 (a), T:C at mutation site 221 and A:G at mutation site 321 are 1 / 2 (b), TT genotype at mutation site 221 and A:G at mutation site 321 are 1:1 (c), and T:C at mutation site 221 is 1 / 2 and A:G at mutation site 321 is 1:1 (d); the red box on the left is 221bp of the amplified fragment, and the one on the right is 321bp. DETAILED DESCRIPTION
[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0029] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.
[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0033] Example 1 Typing of individuals with known genotypes
[0034] 1. Experimental Materials
[0035] The DNA templates of homozygous and heterozygous black-bone chickens with known genotypes were derived from the Key Laboratory of Genetic Improvement of Local Chicken Breeds in Jiangxi Province.
[0036] 2. Experimental methods
[0037] 2.1 Blood sample collection
[0038] An appropriate amount of blood was collected from the sub-wing vein, placed in a centrifuge tube containing an anticoagulant, and stored at -20°C for later use.
[0039] 2.2 DNA extraction
[0040] The genomic DNA extraction method was carried out according to the blood DNA extraction instructions of Omega Company.
[0041] 2.3 Primer design
[0042] Table 1 Primer names and sequences, product sizes
[0043]
[0044] 2.5 PCR amplification
[0045] Determine the optimal primer annealing temperature and perform primer annealing temperature gradient determination. This reaction requires the preparation of a 20 μL PCR reaction system, as shown in Table 2:
[0046] Table 2 PCR reaction system
[0047]
[0048] The PCR reaction program settings are shown in Table 3:
[0049] Table 3 PCR reaction procedure
[0050]
[0051]
[0052] 2.5 Sequencing
[0053] The amplified products were submitted to Shanghai Jierui Biotechnology Co., Ltd. for sequencing.
[0054] 2.6 Analysis of SNP locus typing results
[0055] The sequencing results were read using the Seqman software of DNAStar software.
[0056] 2.7 Target site peak map
[0057] The sequencing results showed four types. The first type was 221 T:C and 321 A:G with a ratio of 1:1 ( Figure 1 a); the second is that T:C at 221 and A:G at 321 are 1 / 2 ( Figure 1 b); the third type is TT genotype at 221 and A:G ratio at 321 is 1:1 ( Figure 1 c); The fourth type is that T:C is 1 / 2 at 221 and A:G is 1:1 at 321 ( Figure 1 d). The above signal ratio of 1:1 means that the peak values of the two bases coincide, and 1 / 2 means that the peak values of the two bases differ by half.
[0058] The above sequencing results are as follows (SEQ ID NO: 3):
[0059] AGATTACATTTATCACCTTTCCAATCTCTTTTAAAGATGAAAGGTGAAATAGCATTACTTTAAACTAAGAGGTAAACCCTATATTTCTCTTTGAAATATTTGCCAAGGGAATAATGGGCTTATTTGGCTTTACCTGCACTGCTGAATTTTGTTGAGAACAGCAGTTTTTAATGAATCATTAAAAAAAAACCCATGAAATCTATATATACATACAT TTTGTA[C / T]GGGGGAAAAAGAATTTCTGTGTGAACATACTAAAATTCTGAAGTGGTTTCAAGTATTCTCCTAATAGTGCTGAGTGTTGTATTCTAGAAGCCATTCCTC[G / A]TGTTGTGAAATGAACAACTGTAATGACTCTGTAATTTGGCTTTATTTTCTTCATAGAGATCCTGCATGGATCTATAAGGAGAACATCAGATAAAAGCAT.
[0060] The bases in “[]” indicate the mutation sites.
[0061] 2.8 Statistics of sequencing results of individuals with different genotypes
[0062] Statistical analysis of the sequencing results of individuals with different genotypes showed that all 48 homozygous black-skinned individuals were of the first type mentioned above (T:C at 221 and A:G at 321 were 1), and the heterozygous individuals were of the remaining three types, as shown in Table 4.
[0063] Table 4 Statistics of sequencing results of individuals with different genotypes
[0064]
[0065]
[0066] The above results show that the genotype of the black skin locus can be determined based on the genotype of the SNP sites at 221 and 321 on the amplified fragment using the Sanger sequencing method.
[0067] Example 2
[0068] The detection method of Example 1 was used to identify homozygous black-bone chickens (Group A) and heterozygous black-bone chickens mixed with homozygous black-bone chickens (Group B). 30 homozygous black-bone chickens and 30 heterozygous black-bone chickens mixed with homozygous black-bone chickens were selected. The target site peak graph was analyzed using the detection method of Example 1, and typing was performed. If the peak ratio of T:C at 221 and A:G at 321 of the target gene sequence is 1:1, it is a black-skinned homozygous black-bone chicken; if the peak ratio of T:C at 221 and A:G at 321 of the target gene sequence is 1 / 2; or the peak ratio of TT genotype at 221 and A:G at 321 of the target gene sequence is 1:1; or the peak ratio of T:C at 221 of the target gene sequence is 1 / 2, and the peak ratio of A:G at 321 is 1:1, the above three situations are all black-skinned heterozygous black-bone chickens.
[0069] The results showed that the peak ratios of T:C at 221 and A:G at 321 of the target gene sequence of the black-bone chicken in group A were both 1:1, the peak ratios of T:C at 221 and A:G at 321 of the target gene sequence of 7 black-bone chickens in group B were 1 / 2, the peak ratios of TT genotype at 221 and A:G at 321 of 5 black-bone chickens were 1:1, the peak ratios of T:C at 221 and A:G at 321 of 11 black-bone chickens were 1 / 2 and 1:1, and the peak ratios of T:C at 221 and A:G at 321 of 7 black-bone chickens were both 1:1. Therefore, according to the result data analysis, it can be determined that group A is a black-bone chicken with homozygous black skin, and group B is a heterozygous black-bone chicken mixed with black-bone homozygous.
[0070] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. A method for genotyping chicken black skin trait loci, characterized in that: The following steps are involved: The chicken genomic DNA to be tested is used as a template, the target gene is amplified using primer pairs, and then the base signal peak of the SNP site of the target gene is obtained by Sanger sequencing, and genotyping is performed based on the base signal peak of the SNP site; Wherein, the primer pair is, WFF1: AGATTACATTTATCACCTTT; WFR1: ATGCTTTTATCTGATGTTCT; the target gene is the EDN3 gene, and the target site is the C / T mutation at 221 bp and the A / G mutation at 321 bp of the amplified fragment; The genotyping criteria are: if the base signal ratios of the SNP site T:C and A:G are both 1:1, it is a homozygote; if the SNP site signal ratio is any of the following (1)-(3), it is a heterozygote: (1) The signal ratios of T:C at 221 bp and A:G at 321 bp of the SNP site were both 1 / 2; (2) SNP site 221 has TT genotype and the signal ratio of A:G at 321 bp is 1:1; (3) The signal ratio of T:C at SNP site 221 is 1 / 2, and the signal ratio of A:G at 321bp is 1:
1.
2. The chicken black skin trait locus genotyping method according to claim 1, characterized in that, The amplification reaction system is: 2×EcoTaq PCR SuperMix, 0.1 μL each of WFF1 / WFR1, 1 μL of template DNA, and ddH2O supplemented to 10 μL.
3. The chicken black skin trait locus genotyping method according to claim 1, characterized in that, The amplification reaction procedure is: 95°C for 5 min; 95°C for 10 s, 50-60°C for 30 s, 72°C for 90 s, 35 cycles; 72°C for 7 min; and storage at 16°C.
Citation Information
Patent Citations
Method for detecting homozygosis or heterozygosis of silkie fiber melanin gene
CN102534006A